Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “PROTOZOA”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 145 records · Page 8Linked to original sources
PubMed1994

Simulation of the dynamics of protozoa in the rumen.

A modified mathematical model is described that simulates the dynamics of rumen micro-organisms, with specific emphasis on the rumen protozoa. The model is driven by continuous inputs of nutrients and consists of nineteen state variables, which represent the N, carbohydrate, fatty acid and microbial pools in the rumen. Several protozoal characteristics were represented in the model, including preference for utilization of starch and sugars compared with fibre, and of insoluble compared with soluble protein; engulfment and storage of starch; no utilization of NH3 to synthesize amino acids; engulfment and digestion of bacteria and protozoa; selective retention within the rumen; death and lysis related to nutrient availability. Comparisons between model predictions and experimental observations showed reasonable agreement for protozoal biomass in the rumen, but protozoal turnover time was not predicted well. Sensitivity analyses highlighted the need for more reliable estimates of bacterial engulfment rate, protozoal maintenance requirement, and death rate. Simulated protozoal biomass was increased rapidly in response to increases in dietary starch content, but further increases in starch content of a high-concentrate diet caused protozoal mass to decline. Increasing the sugar content of a concentrate diet, decreased protozoa, while moderate elevations of the sugar content on a roughage diet increased protozoal biomass. Simulated protozoal biomass did not change in response to variations in dietary neutral-detergent fibre (NDF) content. Reductions in dietary N resulted in an increased protozoal biomass. Depending on the basal intake level and dietary composition, protozoal concentration in the rumen was either increased or decreased by changes in feed intake level. Such changes in relative amounts of protozoal and bacterial biomass markedly affected the supply of nutrients available for absorption. The integration of protozoal, bacterial and dietary characteristics through mathematical representation provided an improved understanding of mechanisms of protozoal responses to changes in dietary inputs.

Animals↗
PubMed1981

The 5S ribosomal RNA of Euglena gracilis cytoplasmic ribosomes is closely homologous to the 5S RNA of the trypanosomatid protozoa.

The complete nucleotide sequence of the major species of cytoplasmic 5S ribosomal RNA of Euglena gracilis has been determined. The sequence is: 5' GGCGUACGGCCAUACUACCGGGAAUACACCUGAACCCGUUCGAUUUCAGAAGUUAAGCCUGGUCAGGCCCAGUUAGUAC UGAGGUGGGCGACCACUUGGGAACACUGGGUGCUGUACGCUUOH3'. This sequence can be fitted to the secondary structural models recently proposed for eukaryotic 5S ribosomal RNAs (1,2). Several properties of the Euglena 5S RNA reveal a close phylogenetic relationship between this organism and the protozoa. Large stretches of nucleotide sequences in predominantly single-stranded regions of the RNA are homologous to that of the trypanosomatid protozoan Crithidia fasticulata. There is less homology when compared to the RNAs of the green alga Chlorella or to the RNAs of the higher plants. The sequence AGAAC near position 40 that is common to plant 5S RNAs is CGAUU in both Euglena and Crithidia. The Euglena 5S RNA has secondary structural features at positions 79-99 similar to that of the protozoa and different from that of the plants. The conclusions drawn from comparative studies of cytochrome c structures which indicate a close phylogenetic relatedness between Euglena and the trypanosomatid protozoa are supported by the comparative data with 5S ribosomal RNAs.

Animals↗
PubMedDate not supplied

Enteric pathogenic protozoa in homosexual men from San Francisco.

The prevalence of enteric protozoa was studied in a survey conducted among 150 male homosexual patients in San Francisco. All patients were from a private practice in internal medicine. Each was asked to complete a questionnaire and to submit multiple stool specimens for examination. Of this group, 47% were positive for one or more potentially pathogenic intestinal protozoa; Entamoeba histolytica was found in 36%, Entamoeba hartmanni in 35%, Giardia lamblia in 5%, and Dientamoeba fragilis in 1.3%. Symptoms were unreliable as a diagnostic index of intestinal protozoan infection. Colonization rates could not be correlated with any specific sexual technique. The large number of homosexuals at risk, combined with the potential for difficulties in diagnosis and contact-tracing, indicate the possibility that enteric pathogenic protozoa will cause future health problems in this population.

Adult↗
PubMed1995

Sex allocation and population structure in malaria and related parasitic protozoa.

Here we demonstrate how sex allocation theory, one of the best verified areas of metazoan evolutionary biology, can be successfully applied to microparasitic organisms, by relating parasite prevalence and sex ratio in the Haemosporina. Members of this taxon, which includes Plasmodium, are parasitic protozoa with obligate sexual cycles in which dioecious haploid gametes drawn from the peripheral blood of a vertebrate host fuse within a dipteran vector. Consequently mating takes place within a highly subdivided population, a condition known to promote local mate competition and inbreeding and hence the evolution of female-biased sex ratios. We used an epidemiological framework to investigate mating patterns and sex ratio evolution within natural populations of these parasites. This phenotypic approach compliments more conventional biochemical approaches to the population genetics of parasitic protozoa. Data are presented which support a theoretical relation between transmission-stage sex ratio and prevalence across parasite populations. These results are consistent with a large inter-population variation in genetic structure and argue against sweeping generalizations about the clonality or otherwise of populations of these parasitic protozoa.

Animals↗
PubMed1976

The cultivation of cellulolytic protozoa isolated from the rumen.

Conditions are described for the isolation from the rumen and subsequent growth of six species of cellulolytic protozoa: Enoploplastron triloricatum, Eudiplodinium maggii, Diploplastron affine, Epidinium ecaudatum caudatum, Diploidinium monacanthum and Diploidinium pentacanthum. The protozoa were grown in an atmosphere of 95% nitrogen plus 5% carbon dioxide, or pure carbon dioxide, in a potassium phosphate-rich medium containing cysteine, sometimes 10% prepared fresh rumen fluid, and daily additions of powdered dried grass. Population densities of 10 to 6000 protozoa/ml (depending on the species) were obtained in cultures that were diluted with fresh medium twice each week. Extracts of these protozoa digested a [14C]cellulose preparation, liberating soluble 14C-labelled compounds.

Animals↗
PubMed1984

Long-term cultivation of certain rumen protozoa in a continuous fermentation system supplemented with sponge materials.

Inert polyurethane-sponge cubes were added to an 'artificial rumen' fermenter. With crushed barley as protozoal substrate this system maintained a population of Entodinia in both substrate bags and sponge cubes for 64 d in numbers (1 X 10(6)/ml) comparable with those found in vivo. This culture was more tolerant of variations in mechanical agitation and size and shape of substrate bags than a similar culture without the sponge cubes. The extent of protozoal sequestration, 2 h after feeding, on to the sponge cubes as well as on to acetone-treated hay was evaluated. The bags of acetone-treated hay and barley, and those of sponge cubes and barley could sequestrate the protozoa to the same extent as normal hay and barley. Based on the results of the short-term experiments and those of the long-term experiment with sponge cubes, a polyurethane-sponge wall was added to the inside of the fermenter. This system maintained a varied protozoal population including large protozoa, holotrichs and Entodinia with a normal fermentation. The molar percentages of butyrate in the total volatile fatty acid (VFA) in each part of the fermenter with a sponge wall were higher than those in a fermenter without a sponge wall, suggesting that there was high protozoal activity related to the sponge wall. These results show that the introduction of the sponge wall to the fermenter produced an enlargement of the area for protozoal sequestration and a suitable micro-habitat for the maintenance of Entodinia , large protozoa and holotrichs .

Animals↗
PubMed1991

Effect of ciliate protozoa on the activity of polysaccharide-degrading enzymes and fibre breakdown in the rumen ecosystem.

The effect of ciliate protozoa on the activity of polysaccharide-degrading enzymes in microbial populations from the digesta solids and liquor fractions of rumen contents was examined after the refaunation of ciliate-free sheep with an A-type rumen protozoal population. Although the culturable rumen bacterial population was reduced after refaunation the number of fibrolytic micro-organisms detected was higher; the xylanolytic bacterial population and numbers of fungal zoospores were increased after refaunation. The proportion of propionic acid was lower in the refaunated animals, whereas the concentration of ammonia and the acidic metabolites acetate, butyrate and valerate were all increased. The range of enzyme activities present in the digesta subpopulations were the same in defaunated and refaunated animals. The activities of the polysaccharide-degrading enzymes, however, were increased in the microbial populations associated with the digesta solids after refaunation, and at 16 h after feeding the activities were 4-8 times (beta-D-xylosidase 20 times) higher than the levels detected in the adherent population from defaunated sheep. The protozoa, either directly through their own enzymes or indirectly as a consequence of their effects on the population size and activity of the other fibrolytic micro-organisms present, have an important role in determining the level of activity of polysaccharide-degrading enzymes in the rumen ecosystem. Although the extent of ryegrass (Lolium perenne) hay digestion was similar after 24 h in the absence or presence of protozoa, the initial ruminal degradation was higher in refaunated sheep.

Ammonia↗
PubMed1992

The rate of uptake and metabolism of starch grains and cellulose particles by Entodinium species, Eudiplodinium maggii, some other entodiniomorphid protozoa and natural protozoal populations taken from the ovine rumen.

The rates of engulfment and breakdown of starch grains and cellulose particles and of the rate of synthesis of amylopectin from cellulose by individual species of entodiniomorphid protozoa (grown in vivo and in vitro) and incubated anaerobically in vitro were studied. Rates of starch uptake varied from 2.3 to 770 micrograms/mg protozoal protein/min; the lowest was found with Diploplastron affine and the highest with Entodinium spp. on initial incubation with starch grains. The rate of starch breakdown varied from 0.49 to 8.6 micrograms/mg protein/min; the rate was dependent on the initial starch concentration inside the protozoa. Eudiplodinium maggii engulfed cellulose particles more rapidly (2-7 times) than rice starch grains and digested the cellulose at rates of 10 to 16.5 micrograms/mg protein/min. In a mixture of starch grains and cellulose particles, it engulfed the latter at 1.35 to 25 times the rate of the former. Eudiplodinium maggii and Epidinium caudatum, but not Entodinium spp. or Dip. affine, synthesized an amylopectin-like material from cellulose at rates of 0.4 to 4.75 micrograms/mg protein/min. If these reactions occur in the rumen in vivo, up to 9 g of amylopectin could be synthesized from cellulose each day by the entodiniomorphid protozoa.

Amylopectin↗
PubMed2004

Phylogenetic analysis of protozoa in the rumen contents of cow based on the 18S rDNA sequences.

AIMS: To examine the diversity of protozoa in the rumen contents of cow. METHODS AND RESULTS: Protozoa that inhabit the rumen were detected by PCR using protozoan-specific primers. Libraries of protozoan rDNA sequences were constructed from rumen fluid, solid tissues and epithelium. Twenty-three clones isolated from rumen fluid fell into two genera identified as Entodinium (69.6% of clones) and Epidinium (31.4% of clones). Of the clones isolated from rumen fluid, a moderate number were unidentifiable (30.4%). CONCLUSIONS: The predominant protozoan genus identified in the whole rumen belonged to the Entodinium group (81.1%). Protozoa were not detected in the rumen epithelium. SIGNIFICANCE AND IMPACT OF THE STUDY: These findings suggest that rumen fluid and solid tissues contain different protozoan populations that may play specific roles in rumen function. Quantitative PCR techniques and a more specific set of phylogenetic probes that distinguish between protozoan species are needed to determine the significance of newly identified groups and to determine the distribution of identified protozoan clusters in rumen microbial communities.

Animals↗
PubMed1995

Macrophage response to microbial pathogens: modulation of the expression of adhesion, CD14, and MHC class II molecules by viruses, bacteria, protozoa and fungi.

The ability of inactivated viruses, bacteria, protozoa and fungi to modulate the expression of CD14, CD49d, CD49f, CD11a (LFA-1), and CD54 (ICAM-1) molecules in unprimed bone marrow-derived mononuclear phagocytes (BMM phi) was investigated by means of flow cytometry. Incubation with bacterial agents resulted in the large majority of experimental situations in enhanced expression of these macrophage surface molecules. In contrast, viruses and fungi down-regulated the expression of several adhesion receptors, especially integrins. Amplification of MHC class II expression triggered in macrophages by interferon gamma was clearly inhibited by viruses, bacteria, protozoa and fungi. The findings explain earlier results showing that, under the same experimental conditions, bacterial agents are, for the most part, potent stimulators of secretory and cell-mediated macrophage activities while viruses, protozoa and fungi are poor in this respect.

Animals↗
PubMed1995

The importance of methanogens associated with ciliate protozoa in ruminal methane production in vitro.

The importance of methanogenic bacteria associated with ciliate protozoa was estimated either by removing protozoa from whole rumen fluid (using defaunated rumen fluid to correct for the effects of centrifugation on bacteria) or by isolating the protozoa. Rumen fluid was withdrawn from sheep inoculated with either Polyplastron multivesiculatum, a co-culture of Isotricha prostoma plus Entodinium spp. or a mixed type B fauna of Entodinium, Eudiplodinium and Epidinium spp. Methanogenesis was highest in rumen fluid containing a mixed protozoal population of the following genera: Entodinium, Eudiplodinium and Epidinium, was lower in defaunated rumen fluid and lowest in rumen fluid containing either I. prostoma plus Entodinium or P. multivesiculatum. Methanogenic bacteria associated with rumen ciliates were apparently responsible for between 9 and 25% of methanogenesis in rumen fluid.

Animals↗
PubMed1996

The role of ciliate protozoa in the lysis of methanogenic archaea in rumen fluid.

Predation by ciliate protozoa can account for 90% of the eubacterial protein turnover in the rumen. However, little is known about the factors affecting the lysis of archaea in rumen fluid. Bacterial lysis was followed from the release of acid-soluble 14C from 14C leucine-labelled bacteria. The rumen methanogen Methanobrevibacter MF1 was broken down more rapidly than other non-ruminal archaea in rumen fluid withdrawn from sheep harbouring either a mixed protozoa population or monofaunated with Polyplastron multivesiculatum or Entodinium spp. The removal of protozoa from the rumen fluid had little effect on the breakdown of Methanobrevibacter, while lysis of the non-methanogenic ruminal bacterium Selenomonas ruminantium decreased by over 70%. Substantial lysis of Methanobrevibacter occurred in cell-free rumen fluid and this effect could be abolished by autoclaving. In view of the high number of bacteriophages in rumen fluid and susceptibility of ruminal bacteria to phage-induced lysis it is tempting to suggest that phages have a role in the lysis of archaea in rumen fluid.

Animals↗
PubMedDate not supplied

Influence of host diet on the fatty acid composition and content of rumen protozoa in cattle.

The fatty acid profiles and contents of protozoa from the rumen fluid of cattle varied according to the type of diet consumed by their host. Changing from a high-quality hay diet to a low-quality hay diet (DA) decreased the proportions of saturated acids and increased the proportions of the unsaturated acids 18:1 cis-9, 18:2 and 18:3 in neutral lipids (NL) and phospholipids (PL). Adding sucrose, urea and sulphur (SUS) to DA increased the proportions of branched chain acids in PL while addition of safflower oil increased polyunsaturated acids in PL and 18:1 trans-11 in NL. Diet did not alter the PL fatty acid content of protozoa but oil supplement of DA resulted in a 10-fold increase in the content of free fatty acids. The defaunating effect of oil supplement was partly reversed by SUS suggesting that factors other than the fatty acid content of cells are important in determining the toxicity of oil to rumen protozoa. The results indicate that the amounts of individual long-chain fatty acids taken up by rumen ciliates are largely determined by their concentrations in rumen digesta.

Analysis of Variance↗
PubMedDate not supplied

Density and diversity of protozoa in some arid Australian soils.

This is the first extensive study of soil protozoa of arid lands. Twenty-six samples from litters, soils, termitaria, and a cyanobacterial crust, collected from central and south Australian arid lands, were analyzed for numbers and species of gymnamoebae, ciliates, and testacea. Amoebae ranged from 1,000-5,000/g of material, and were two orders of magnitude more abundant than ciliates. Both groups increased in abundance and species richness from bare soils through spinifex to mulga to chenopod vegetations. Testacea ranged 900-5,000/g with similar species richness throughout vegetations, but reached 11,900/g with a doubling of species in a refugium in Kings Canyon. The most prevalent species of amoebae, ciliates, and testacea were taxa associated with ephemeral and disturbed habitats (r-selection). The cyanobacterial crust might be considered a micro-refugium because it contained a number of non-encysting protozoa, including Thecamoeba sp. and Nassula picta, feeding on cyanobacterial filaments. The numbers and species richness of protozoa under shrubs were greater than in bare soils, supporting the resource island hypothesis that desert plants create soil heterogeneity by localizing soil fertility under their canopies.

Amoeba↗
PubMed1983

Alternative prey: a mechanism for elimination of bacterial species by protozoa.

Antibiotic-resistant strains of Salmonella typhimurium and Klebsiella pneumoniae died readily after their addition to raw sewage, but they grew in sterilized sewage. The decline was not a result of abiotic stresses, and because the bacteria were able to survive in large numbers for at least 15 days in solutions containing no organic nutrients, it was not a result of competition. Toxin production, bacteriophages, and Bdellovibrio sp. did not cause the disappearance of the two bacterial species. A decline was also evident if the sewage was first passed through a 3-micron (pore size) filter or treated with cycloheximide or cycloheximide plus nystatin, but protozoa developed under these conditions. Little or no decline occurred if the sewage was filtered and treated with the eucaryotic inhibitors before the addition of S. typhimurium or K. pneumoniae, and protozoa were not detected. S. typhimurium increased in abundance if cycloheximide, streptomycin, and erythromycin or large amounts of glucose were added to sewage. Tetrahymena thermophilus did not significantly reduce the population of S. typhimurium in buffer when the density of the bacterium was about 10(4)/ml. However, when more than 10(8) Enterobacter agglomerans cells per ml were added to the buffer, T. thermophilus reduced the abundance of E. agglomerans and S. typhimurium to 10(6) and 10/ml, respectively. The density of S. typhimurium was further decreased by a second increment of E. agglomerans cells. The disappearance of S. typhimurium and K. pneumoniae from sewage thus is the result of predation by protozoa.(ABSTRACT TRUNCATED AT 250 WORDS)

Amoeba↗
PubMed2005

Survival of Campylobacter jejuni in waterborne protozoa.

The failure to reduce the Campylobacter contamination of intensively reared poultry may be partially due to Campylobacter resisting disinfection in water after their internalization by waterborne protozoa. Campylobacter jejuni and a variety of waterborne protozoa, including ciliates, flagellates, and alveolates, were detected in the drinking water of intensively reared poultry by a combination of culture and molecular techniques. An in vitro assay showed that C. jejuni remained viable when internalized by Tetrahymena pyriformis and Acanthamoeba castellanii for significantly longer (up to 36 h) than when they were in purely a planktonic state. The internalized Campylobacter were also significantly more resistant to disinfection than planktonic organisms. Collectively, our results strongly suggest that protozoa in broiler drinking water systems can delay the decline of Campylobacter viability and increase Campylobacter disinfection resistance, thus increasing the potential of Campylobacter to colonize broilers.

Acanthamoeba castellanii↗
PubMed2001

Drug targets and mechanisms of resistance in the anaerobic protozoa.

The anaerobic protozoa Giardia duodenalis, Trichomonas vaginalis, and Entamoeba histolytica infect up to a billion people each year. G. duodenalis and E. histolytica are primarily pathogens of the intestinal tract, although E. histolytica can form abscesses and invade other organs, where it can be fatal if left untreated. T. vaginalis infection is a sexually transmitted infection causing vaginitis and acute inflammatory disease of the genital mucosa. T. vaginalis has also been reported in the urinary tract, fallopian tubes, and pelvis and can cause pneumonia, bronchitis, and oral lesions. Respiratory infections can be acquired perinatally. T. vaginalis infections have been associated with preterm delivery, low birth weight, and increased mortality as well as predisposing to human immunodeficiency virus infection, AIDS, and cervical cancer. All three organisms lack mitochondria and are susceptible to the nitroimidazole metronidazole because of similar low-redox-potential anaerobic metabolic pathways. Resistance to metronidazole and other drugs has been observed clinically and in the laboratory. Laboratory studies have identified the enzyme that activates metronidazole, pyruvate:ferredoxin oxidoreductase, to its nitroso form and distinct mechanisms of decreasing drug susceptibility that are induced in each organism. Although the nitroimidazoles have been the drug family of choice for treating the anaerobic protozoa, G. duodenalis is less susceptible to other antiparasitic drugs, such as furazolidone, albendazole, and quinacrine. Resistance has been demonstrated for each agent, and the mechanism of resistance has been investigated. Metronidazole resistance in T. vaginalis is well documented, and the principal mechanisms have been defined. Bypass metabolism, such as alternative oxidoreductases, have been discovered in both organisms. Aerobic versus anaerobic resistance in T. vaginalis is discussed. Mechanisms of metronidazole resistance in E. histolytica have recently been investigated using laboratory-induced resistant isolates. Instead of downregulation of the pyruvate:ferredoxin oxidoreductase and ferredoxin pathway as seen in G. duodenalis and T. vaginalis, E. histolytica induces oxidative stress mechanisms, including superoxide dismutase and peroxiredoxin. The review examines the value of investigating both clinical and laboratory-induced syngeneic drug-resistant isolates and dissection of the complementary data obtained. Comparison of resistance mechanisms in anaerobic bacteria and the parasitic protozoa is discussed as well as the value of studies of the epidemiology of resistance.

Anaerobiosis↗
PubMedDate not supplied

The evidence for G-protein-coupled receptors and heterotrimeric G proteins in protozoa and ancestral metazoa.

In higher eukaryotes G-protein-coupled signal transduction pathways are a common mechanism used to detect an extracellular message and transmit a signal, via a membrane-bound receptor and a heterotrimeric G protein, to second messenger producing enzymes and effector proteins. The techniques used to identify components of these pathways are increasingly being applied to protozoa and ancestral metazoa. Many of the organisms studied do seem to express functional homologues of those found in higher eukaryotes and increasingly genes encoding these proteins are being cloned. Sequence analysis of the isolated alpha-subunits of heterotrimeric G proteins shows that these proteins have extensive homology to their mammalian counterparts, and often show absolute sequence identity in functionally significant regions. The receptor clones isolated clearly establish that protozoa and early metazoa express proteins with seven transmembrane spanning domains. Comparisons with mammalian receptors indicate that these proteins are likely to be regulated by phosphorylation and dephosphorylation events, although the pathways which control these are yet to be identified. The postulated regulatory mechanisms and the number of homologous clones isolated from some protozoa suggest that a highly regulated system of transmembrane signalling appeared at a relatively early stage in evolution.

Animals↗