Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Netropsin”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 145 records · Page 8Linked to original sources
PubMed2000

Raman and surface-enhanced Raman scattering spectroscopy of bis-netropsins and their DNA complexes.

The interactions of three bis-netropsins (bis-Nts), which are potent catalytic inhibitors of DNA-binding enzymes, with three double-stranded oligonucleotides (OLIGs), which contain sites of different specific affinities for each bis-Nt, were analyzed. Raman spectroscopy was performed for selective monitoring of modifications of the bis-Nt or the OLIG structure upon bis-Nt-DNA binding, and surface-enhanced Raman scattering spectroscopy (SERS) was an additional tool for topology studies of ligand-DNA complexes. The spectral data showed conformational changes of both partners (bis-Nt and OLIG) upon complexation. Structural variations of bis-Nts appeared to be dependent on a bis-Nt-OLIG binding constant and were found to be small in the specific DNA binding and highest for nonspecific binding of bis-Nt with the corresponding OLIG. The conformational changes of the OLIGs were varied with a bis-Nt-OLIG binding constant in the same manner. The bis-Nts seemed to induce a perturbation in the OLIG's structure, as well as in the positions of their direct binding. These DNA structural modification effects may explain the inhibition of DNA-binding enzymes in the variety of very distinct DNA-enzyme binding sites by bis-Nts reported previously.

Anti-Bacterial Agents↗
PubMedDate not supplied

Influence of netropsin's charges on the minor groove width of d(CGCGAATTCGCG)2.

The exact understanding of the interaction of minor groove binding drugs with DNA is of interest due to their importance as transcription controlling drugs. In this study we performed four molecular dynamics simulations, one of the uncomplexed d(CGCGAATTCGCG)(2) dodecamer and three simulations of the DNA complexed with the minor groove binder netropsin. The charged guanidinium and amidinium ends of the small ligand were in one simulation formally uncharged, in the second one normally charged, and in the third simulation we doubled the charges of the two ends. So we are able to filter out the influence the charges exert on the DNA structure. The positive charges reduce the width of the minor groove showing that charges are able to modify the groove width by charge neutralization of the negative phosphate groups. The quality of the used force field was successfully tested by comparing the results of the uncomplexed dodecamer with already reported NMR and x-ray studies. Thus our simulations should be able to describe the minor groove width of DNA in a correct manner underlying the validity of the results.

Base Sequence↗
PubMed1991

Heteronuclear two-dimensional 15N- and 13C-NMR studies of DNA oligomers and their netropsin complexes using indirect proton detection.

Heteronuclear multispin coherence proton-detected two-dimensional nmr spectroscopic experiments were used to obtain information on protonated carbons and nitrogens of the self-complementary d(G-G-T-A-T-A-C-C) and d(G-G-A-A-T-T-C-C) duplexes, with and without the drug netropsin dissolved in aqueous solution. Many correlations of protons coupled to 13C nuclei on the base and sugar rings of the octanucleotides were detected, allowing the carbon resonances to be assigned based on previous homonuclear proton two-dimensional nmr studies. Imino nitrogen assignments can also be made using the proton assignments from previous one-dimensional nuclear overhauser effect experiments. Imino nitrogen shifts may be useful indicators of changes in local hydrogen-bonding interactions to base-pair edges.

Base Sequence↗
PubMed1994

Exploring DNA minor groove interactions through a probe conjugate in major groove: fluorescence studies on netropsin complexation with dU-5-aminodansyl-DNA.

The binding of netropsin to 5-Aminodansyl-dU-DNA (2-5) in minor groove is shown to correlate with fluorescence changes of dansyl fluorophore located in major groove. This enables a study of a minor groove binding event through crosstalk with conjugated probe in major groove. The dielectric constant of major groove estimated from fluorescence properties of (2-6) is about 55D in contrast to the literature reported minor groove dielectric constant of 20D in the poly[d(AT)]-poly[d(AT)] duplex.

Base Sequence↗
PubMed1999

Stacking interaction of guanine with netropsin in the minor groove of d(CGTATATACG)2.

We present the structure of the decanucleotide d(CGTATATACG) determined by single crystal X-ray diffraction at 1.58 A resolution. A netropsin drug is found in the minor groove with guanine stacked on a pyrrole ring of the drug, a feature described here for the first time. The stacked guanine is an extra-helical base coming from the end of a neighbour oligonucleotide. This observation may open the way to the development of minor groove binding drugs with a higher sequence selectivity. The oligonucleotide is in the B-conformation, but the terminal base-pairs are disrupted: the cytosine residues are disordered while the guanine residues penetrate into the minor groove of neighbouring duplexes. Four hydrated Ni ions with octahedral co-ordination are found associated with the N7 atoms of each guanine. The high affinity of these ions with guanine suggests that they may be used as probes for specific guanine residues.

Crystallography, X-Ray↗
PubMed1992

Stimulation of the onset of sporulation of Clostridium perfringens type A by netropsin and distamycin.

The basic peptide antibiotics, netropsin and distamycin, previously shown to inhibit sporulation of Bacillus subtilis, stimulated low levels of sporulation of Clostridium perfringens strain NCTC 8798 at concentrations of 1.0 and 0.1 microgram/ml respectively. Most sporulating cells produced in the presence of the antibiotics were defective. These were blocked at Stage III of sporulation, and many possessed forespores exterior to the sporangium. The same antibiotics could also inhibit the caffeine-induced stimulation of sporulation of this strain.

Clostridium perfringens↗
PubMed1990

Subcellular distribution of a nitroxide spin-labeled netropsin-acridine hybrid in living KB cells: Electron Spin Resonance Study.

NETGA is an hybrid derivative which possesses an intercalating heterocyclic nucleus related to amsacrine and a minor groove binding squeletton related to netropsin. Cellular uptake of this drug has been studied by Electron Spin Resonance (ESR) spectroscopy using a spin-label derivative of NETGA (SL-NETGA). ESR determination of the kinetics of the drug repartition between the cytoplasm and nucleus showed that NETGA accumulated very rapidly and predominantly in the nucleus. Analysis of the anisotropic ESR spectra recorded in the nuclear compartment are in agreement with a strong binding of the drug to the DNA besides confirmed by a maximum delta Tm of 12 degrees C between the spin-label compound-DNA complex and the DNA alone.

Acridines↗
PubMed1983

Z-DNA and other non-B-DNA structures are reversed to B-DNA by interaction with netropsin.

The interaction between the B-form specific ligands netropsin (Nt) and distamycin-3 (Dst-3) and DNA duplexes has been studied under conditions of salt concentration and low water activity that modify the polymer conformation into a non-B DNA form, putatively a Z-like form. Three polymers with strict alternating purine-pyrimidine sequences and GC content from 100-0% have been tested: poly(dG-dC) . poly(dG-dC), poly(dA-dC) . poly(dG-dT) and poly(dA-dT) . poly(dA-dT). The titrations by Nt and Dst-3 were followed by circular dichroism. Although specific binding of Nt to the Z-form of poly(dG-dC) . poly(dG-dC) does not occur, Nt reverses this Z structure to the B-type conformation; Dst-3 is, however, totally inefficient. The presumed non-B or Z-like structure of poly(dA-dC) . poly(dG-dT) is reversed to the B-form upon interaction with Nt; Dst-3 also induces this reversal but at higher ligand ratios. The modified B-structure of poly(dA-dT) . poly(dA-dT) in low water activity is efficiently reversed to the B-form by interaction with both Nt and Dst-3.

Chemical Phenomena↗
PubMed1987

Hydroxyl radical footprinting of the sequence-selective binding of netropsin and distamycin to DNA.

Hydroxyl radicals, generated by allowing an iron (II).EDTA complex to react with hydrogen peroxide, have been employed to cleave the 160-base pair tyrT DNA fragment in the presence and absence of the minor groove-binding antibiotics netropsin and distamycin A. The control DNA cleavage pattern is practically independent of nucleotide sequence, which overcomes certain limitations of other footprinting techniques, so that additional information can be gained about the AT-rich sequence preference of the minor groove-binding ligands.

Base Composition↗
PubMed1994

Effect of netropsin, distamycin A and chromomycin A3 on the binding and cleavage reaction of DNA gyrase.

The influence of netropsin (Nt), distamycin A (Dst-3) and chromomycin A3 (CHR) on the binding of gyrase from Streptomyces noursei to an 162 bp-fragment of pBR 322 containing a strong gyrase cleavage site and on the gyrase mediated cleavage of this fragment was analyzed. Binding of the enzyme to the fragment is effectively inhibited by the GC-specific drug CHR, but poorly influenced by Dst-3, while Nt is ineffective. Cleavage of the fragment catalysed by the enzyme is inhibited by all three ligands but to different extent. Dst-3 and Nt inhibit the enzyme cleavage reaction at 20- or 250-fold higher concentration than that required for CHR. The inhibitory mechanism of CHR on gyrase-DNA binding and cleavage may be related to a competitive interaction of the ligand to GC sequences located at and around the gyrase cleavage site. The fact that AT-specific minor groove binders Dst-3 and Nt poorly inhibit the binding of gyrase to the fragment due to the low amount of the AT basepair sequences contained in the fragment and their inhibitory influence on the cleavage step underlines the role of the DNA minor groove during enzyme action.

Base Sequence↗
PubMed1995

Novel cytotoxic DNA sequence and minor groove targeted photosensitizers: conjugates of pyrene and netropsin analogues.

The design, syntheses, photochemical and biological properties of conjugates of pyrene with pyrrole- (1) and imidazole-containing (2) analogues of netropsin are reported. The results of an ethidium displacement assay and circular dichroism (CD) titration studies show both compounds bind with a higher affinity to poly(dA-dT) than to poly(dG-dC). In addition they bind as strongly to T4 coliphage DNA as to calf thymus DNA suggesting the binding occurs in the minor groove. The quenching rate constants of the singlet excited states of agents 1 and 2 by molecular oxygen were found to be 8.5 x 10(9) M-1S-1 and 7.7 x 10(9) M-1S-1, suggesting the involvement of singlet oxygen. Both compounds showed some cytotoxicity to human chronic myeloid leukemia K562 cells in the dark. Upon irradiation the activities were significantly enhanced resulting in photoinduced dose modifications of 8 and 14 for 1 and 2, respectively under the conditions employed. Both agents were markedly more phototoxic than 1-pyrenebutyric acid 8. To address the mechanism of action of compounds 1 and 2 their photoactivated abilities to produce DNA strand breaks were measured. Both agents caused increased single strand breakage with increasing UV exposure. The concentrations (EC50) of 1 and 2 needed to cause 50% single-strand cleavage of pBR322 DNA upon UV-A activation were found to be 40 microM and 45 microM, respectively. In contrast, no DNA strand breaks were observed in the dark with either conjugate or with 8 following irradiation. DNA strand breaks were measured in drug treated K562 cells using alkaline elution.(ABSTRACT TRUNCATED AT 250 WORDS)

Antineoplastic Agents↗
PubMed2006

Binding of netropsin and 4,6-diamidino-2-phenylindole to an A2T2 DNA hairpin: a comparison of biophysical techniques.

Isothermal titration calorimetry (ITC), differential scanning calorimetry (DSC), and biosensor-surface plasmon resonance (SPR) are evaluated for their accuracy in determining equilibrium constants, ease of use, and range of application. Systems chosen for comparison of the three techniques were the formation of complexes between two minor groove binding compounds, netropsin and 4,6-diamidino-2-phenylindole (DAPI), and a DNA hairpin having the sequence 5'-d(CGAATTCGTCTCCGAATTCG)-3'. These systems were chosen for their structural differences, simplicity (1:1 binding), and binding affinity in the range of interest (K approximately 10(8) M(-1)). The binding affinities determined from all three techniques were in excellent agreement; for example, netropsin/DNA formation constants were determined to be K = 1.7x10(8) M(-1) (ITC), K = 2.4x10(8) M(-1) (DSC), and K = 2.9x10(8) M(-1) (SPR). DSC and SPR techniques have an advantage over ITC in studies of ligands that bind with affinities greater than 10(8) M(-1). The ITC technique has the advantage of determining a full set of thermodynamic parameters, including deltaH, TdeltaS, and deltaC(p) in addition to deltaG (or K). The ITC data revealed complex binding behavior in these minor groove binding systems not detected in the other methods. All three techniques provide accurate estimates of binding affinity, and each has unique benefits for drug binding studies.

Amidines↗
PubMed2005

Amplification of C1027-induced DNA cleavage and apoptosis by a quinacrine-netropsin hybrid molecule in tumor cell lines.

We examined the effect of a newly synthesized DNA-binding ligand, quinacrine-netropsin hybrid molecule (QN), on cytotoxicity, apoptosis, and DNA strand breaks induced by an enediyne antitumor antibiotic, C1027. QN significantly enhanced C1027-induced cellular DNA strand breaks, caspase-3 activation, and DNA ladder formation, characteristic of apoptosis, in human HL-60 cells. Flow cytometry revealed that C1027-induced intracellular H(2)O(2) generation was enhanced by QN, suggesting that QN enhances C1027-induced cytotoxic effect through H(2)O(2)-mediated apoptosis. QN also significantly enhanced C1027-induced apoptosis in BJAB cells, and the inhibition of apoptosis was observed in BJAB cells transfected with Bcl-2 gene. The experiment using (32)P-labeled DNA fragments showed that the addition of QN enhanced C1027-induced double-stranded DNA cleavage at the 5'-AGG-3'/3'-TCC-5' sequence (cutting sites are underlined). These results suggest that QN enhances C1027-induced antitumor effect via DNA cleavage and apoptosis. The present study shows a novel approach to the potentially effective anticancer therapy.

Aminoglycosides↗
PubMed2006

Fluorescent intercalator displacement analyses of DNA binding by the peptide-derived natural products netropsin, actinomycin, and bleomycin.

The response of the high-throughput fluorescent intercalator displacement (HT-FID) assay reported recently by Boger et al. to peptide-based DNA binding intercalators and metal complexes was examined through the study of actinomycin and Co(III).bleomycin-B2. Along with a validation of netropsin that illustrated the good laboratory-to-laboratory reproducibility of the assay, our examination of actinomycin revealed results for a four base pair cassette library of DNA hairpins that paralleled the known DNA site-selectivity of this agent and also indicated the involvement of the flanking sequences of the hairpin oligonucleotide. In addition, for Co(III).bleomycin-B2 the established cleavage site-selectivity for 5'-GT and 5'-GC sites was correlated to drug-DNA association in this binding-only assay; our results also suggest a tetranucleotide site-selectivity for metallobleomycin involving cross-strand, 'back-to-back' 5'-GT and 5'-GC sites such as 5'-ACGT and 5'-ACGC.

Anti-Bacterial Agents↗
PubMed2002

DNA structural alterations induced by bis-netropsins modulate human DNA topoisomerase I cleavage activity and poisoning by camptothecin.

Bis-netropsins (bis-Nts) are efficient catalytic inhibitors of human DNA topoisomerase I (top I). These DNA minor groove binders are considered to serve as suppressors of top I-linked DNA breaks, which is generally believed to be related to their affinity to DNA. In this study, it was found that bis-Nts exhibit sequence-specificity of suppression of the strong top I-specific DNA cleavage sites and that this sequence-specificity is determined by differential ligand-induced structural alterations of DNA. Raman scattering analysis of bis-Nts interactions with double-stranded oligonucleotides, each containing the site of specific affinity to one of bis-Nts and a distinctly located top I degenerate consensus, demonstrated that bis-Nts induce not only structural changes in duplex DNA at their loading position, but also conformational changes in a distant top I-specific DNA cleavage site. The ability to alter the DNA structure correlates with the anti-top I inhibitory activities of the ligands. In addition, DNA structural alterations induced by bis-Nts were shown to be responsible for modulation of the camptothecin (CPT)-mediated DNA cleavage by top I. This effect is expressed in the bis-Nts-induced enhancement of some of the CPT-dependent DNA cleavage sites as well as in the CPT-induced enhancement of some of the top I-specific DNA cleavage sites suppressed by bis-Nts in the absence of CPT.

Base Sequence↗
PubMed2003

Benzoyl nitrogen mustard derivatives of benzoheterocyclic analogues of netropsin: synthesis and biological activity.

Synthesis, DNA binding properties and biological activity of a series of bis-benzoheterocycle derivatives 5-11, structurally related to the natural dipyrrole antitumor agent netropsin, and tethered to a benzoyl nitrogen mustard (BAM) as alkylating moiety is reported and structure-activity relationships determined. These compounds 5-11 have been evaluated for sequence selective alkylating properties and cytotoxicity against murine L1210 and human K562 leukaemia cells. Using as target sequence a portion of the long terminal repeat of the type-1 human immunodeficiency virus, we found that these compounds induce similar patterns of DNA fragmentation. In addition, the results obtained indicate that all synthesized compounds retain a good antiproliferative activity in the submicromolar range, and generally are more active against L1210 than K562 cells. With respect to both these cell lines, compounds 6, 7, 10 and 11 showed the greatest potency, ranging from 0.3 to 1 microM, while compounds 8 and 9 exhibit the lowest activity (IC(50)=2-12 microM). Among compounds 5-11, the derivative 11 was found to be the most potent member of this class and it is 5 and 10-fold less active than the bis-pyrrole counterpart 2 against K562 and L1210 cell lines, respectively. For compound 11, the substitution of the C-terminus benzofurane with N-methylindole and indole (to give the compounds 5 and 6, respectively) led to a decrease in cytotoxicity, which is more evident against the K562 cell line. Finally, differences were found among compounds 5-11 in induction of K562 differentiation. Some of them (compounds 7, 8 and 9) are potent inducers of erythroid differentiation of K562 cells, and could be proposed for differentiation anti-cancer therapy.

Animals↗