Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Inverted Repeat Sequences”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,405 records · Page 78Linked to original sources
PubMed1987

Stabilization of translationally active mRNA by prokaryotic REP sequences.

The REP sequence is a highly conserved inverted repeat that is present in about 25% of all E. coli transcription units. We show that the REP sequence can stabilize upstream RNA, independently of any other sequences, by protection from 3'-5' exonuclease attack. The REP sequence is frequently responsible for the differential stability of different segments of mRNA within an operon. We demonstrate that REP-stabilized mRNA can be translated in vivo and that cloning the REP sequence downstream of a gene can increase protein synthesis. This provides direct evidence that alterations in mRNA stability can play a role in determining bacterial gene expression. The implications of these findings for the mechanisms of mRNA degradation and for the role of RNA stability in the regulation of gene expression are discussed.

Bacterial Proteins↗
PubMed1994

Mariner-like elements in hymenopteran species: insertion site and distribution.

Copies of mariner-like element (MLE) transposons in two species, the bumble bee, Bombus terrestris, and the ant, Myrmica ruginodis, were sequenced. The full-sized elements are 1250 bp long in both species and include 28-bp inverted terminal repeats. The five copies sequenced were approximately 75% similar to a mariner element (peach) of Drosophila mauritiana. The distribution of MLE in 27 hymenopteran species was studied by PCR and Southern blot hybridization; 93% of the species contained one or more of the four major forms of the element. They are inserted in their host genomes, in the middle of a degenerated 30-bp palindrome, which is itself located in an 85-bp conserved region with a purine-rich tail at one of its ends. The hymenopteran MLEs lie in a specific insertion site, suggesting that this region is conserved. It is thus possible that this region may be a selectively neutral insertion site, which would explain why these elements are widespread in hymenopteran genomes and are not eliminated by male haploidy.

Animals↗
PubMed1998

cis-acting sequences required for NtcB-dependent, nitrite-responsive positive regulation of the nitrate assimilation operon in the cyanobacterium Synechococcus sp. strain PCC 7942.

There are three binding sites for NtcA (nirI, nirII, and nirIII), the global nitrogen regulator of cyanobacteria, in the DNA region between the two divergently transcribed operons (nirA and nirB operons) involved in nitrate assimilation in Synechococcus sp. strain PCC 7942. Using the luxAB reporter system, we showed that nirI and nirIII, which are located 23 bp upstream from the -10 promoter element of nirA and nirB, respectively, are required for induction by nitrogen depletion of the nirA and nirB operons, respectively. The induction of nirA operon transcription was a prerequisite for the nitrite-responsive positive regulation of the transcription by NtcB, a LysR-type protein. The NtcA-binding site nirII, located in the middle of the nirA-nirB intergenic region, and a potential binding site for a LysR-type protein (TGCAN5TGCA; designated L1), located between nirI and nirII, were required for the nitrite-responsive, NtcB-dependent enhancement of nirA operon transcription. Although the requirement for the L1 site was consistent with the involvement of the LysR family protein NtcB in transcriptional regulation, NtcB did not bind to the nirA regulatory region in vitro in the presence of nitrite and NtcA, suggesting the involvement of some additional factor(s) in the regulation. An L1-like inverted repeat with the consensus sequence TGCN7GCA was conserved in the nirA promoter region of cyanobacteria, being centered at position -23 with respect to the NtcA-binding site corresponding to nirI, which suggested the common occurrence of nitrite-responsive regulation of the nitrate assimilation operon among cyanobacteria.

Bacterial Proteins↗
PubMed2006

Adeno-associated virus 2-mediated gene transfer: role of a cellular serine/threonine protein phosphatase in augmenting transduction efficiency.

We have documented that a cellular chaperone protein, FKBP52, when phosphorylated at tyrosine and/or serine/threonine (Ser/Thr) residues, interacts with the D-sequence in the inverted terminal repeats of the adeno-associated virus 2 (AAV) genome, inhibits the viral second-strand DNA synthesis, and leads to inefficient transgene expression from recombinant AAV vectors in certain cell types. We have also demonstrated that FKBP52 is dephosphorylated at tyrosine residues by T-cell protein tyrosine phosphatase (TC-PTP), and that deliberate overexpression of TC-PTP leads to more efficient viral second-strand DNA synthesis, and increased transgene expression. However, the identity of the putative Ser/Thr protein phosphatase that dephosphorylates FKBP52 at Ser/Thr residues has remained elusive. Using known inhibitors of Ser/Thr phosphatases, we have now identified protein phosphatase 5 (PP5) to be a candidate enzyme. Deliberate overexpression of PP5 in 293 cells, which does not influence cellular growth, leads to approximately 5-fold increase in the transduction efficiency of conventional single-stranded AAV vectors, but no significant enhancement in the transduction efficiency of self-complementary AAV vectors, suggesting that PP5 plays a role in AAV second-strand DNA synthesis. Electrophoretic mobility-shift assays show that in cells overexpressing PP5, the extent of the complex formation between FKBP52 and the AAV D-sequence is significantly reduced. These studies suggest that PP5-mediated dephosphorylation of FKBP52 at Ser/Thr residues augments viral second-strand DNA synthesis and enhances AAV transduction efficiency, which has implications in the optimal use of these vectors in human gene therapy.

Cell Line↗
PubMed1991

Degenerate oligonucleotide sequence-directed cross-species PCR cloning of the BCP 54/ALDH 3 cDNA: priming from inverted repeats and formation of tandem primer arrays.

Bovine corneal protein 54 (BCP 54) is the major soluble protein of the bovine cornea, and immunoreactive forms of this protein have been described in a wide range of mammals. Dideoxy sequence determination of a previously synthesized 420-bp cDNA to BCP 54 generated by the novel mixed oligonucleotide primer amplification of cDNA (MOPAC) procedure revealed extensive similarity to the cDNA encoding tumor-associated rat liver (class 3) aldehyde dehydrogenase (RATALD). PCR amplification with additional pairs of degenerate oligonucleotide sequence (DOS) primers derived from both BCP 54-amino-acid sequence and amino acid and nucleotide sequence data from RATALD produced three PCR products that were cloned and subsequently sequenced. The major product was 716-bp BCP 54 cDNA clone encompassing the BCP 54 carboxy-terminal amino acid sequence for which the DOS pair was designed. Sequence alignment of the BCP 54 cDNA and its translation product with RATALD demonstrated 81% and 85% identity at the nucleotide and amino acid levels, respectively. Analysis of the additional two clones established that they were the results of PCR artifactual processes. The first of these was a 552-bp product occurring at elevated primer concentrations that formed through bidirectional amplification from a single DOS annealing to an inverted repeat located in the BCP 54 coding sequence. The second artifactual product was a 212-bp sequence that contained several unreported amplification anomalies, including the formation of a tandem primer array.

Aldehyde Dehydrogenase↗
PubMed1997

A fusion promoter created by a new insertion sequence, IS1490, activates transcription of 2,4,5-trichlorophenoxyacetic acid catabolic genes in Burkholderia cepacia AC1100.

Transposition and transcriptional activation by insertion sequences in Burkholderia cepacia AC1100 were investigated. Two closely related new elements, IS1413 and IS1490, were identified and characterized. These elements are not highly related to other insertion sequences identified in AC1100 or other B. cepacia isolates. Based on their structures and the sequences of the inverted terminal repeats and the putative transposase protein, the insertion elements (IS elements) are similar to IST2 of Thiobacillus ferrooxidans and several related elements. All the IS elements that have been identified in this strain are found in multiple copies (10 to 40), and they have high-level promoter activity capable of stimulating transcription from a distance up to 500 bp from a target gene. Strain AC1100 was originally isolated after prolonged selection for the ability to utilize the herbicide 2,4,5-trichlorophenoxyacetic acid (2,4,5-T) as a sole carbon source. Three IS elements are located near the first gene of the 2,4,5-T catabolic pathway, tftA. IS1490 inserted 110 bp upstream of tftA and created a fusion promoter responsible for constitutive transcription of the gene. Our results confirm the hypothesis that IS elements play a central role in transcription of 2,4,5-T genes and likely have stimulated rapid evolution of the metabolic pathway.

2,4,5-Trichlorophenoxyacetic Acid↗
PubMed1996

Prt1, an unusual retrotransposon-like sequence in the fungus Phycomyces blakesleeanus.

This work reports the isolation and structural characterization of Prt1, a 4.7 kb retrotransposon-like sequence from the filamentous fungus Phycomyces blakesleeanus. Two open reading frames are found within Prt1. The first shows no similarity with known genes. The second encodes peptide stretches similar to the reverse transcriptase and RNaseH domains of the Ty3/gypsy family of LTR-retrotransposons. Prt1 lacks long terminal repeats, having instead short (54 bp) terminal inverted repeats. No target site duplication has been found. A single copy of Prt1 was detected in the genome of P. blakesleeanus. Adjacent to this sole copy of Prt1, a cluster of various short sequence repeats, both direct and inverted, is found. These sequences, which are reminiscent of defective, non-retroviral transposable elements, are also represented in other regions of the P. blakesleeanus genome.

Amino Acid Sequence↗
PubMed1997

Differential regulation by the homologous response regulators NarL and NarP of Escherichia coli K-12 depends on DNA binding site arrangement.

The NarL and NarP proteins are homologous response regulators of Escherichia coli that control the expression of several operons in response to nitrate and nitrite. A consensus heptameric NarL DNA-binding sequence has been identified, and previous observations suggest that the NarP protein has a similar sequence specificity. However, some operons are regulated by NarL alone, whereas others are controlled by both NarL and NarP. In this study, DNase I footprinting experiments with the fdnG, nirB and nrfA control regions revealed that NarP only binds to heptamer sequences organized as an inverted repeat with a 2 bp spacing (7-2-7 sites). The NarL protein also binds to these 7-2-7 sites but, unlike NarP, also recognizes heptamers in other arrangements. These results provide an explanation for the regulation of some operons by NarL alone and for the different effects of NarL and NarP at common target operons, such as fdnG and nrfA. To investigate this differential DNA binding further, derivatives of the nrfA control region were constructed in which the spacing of the 7-2-7 heptamers was increased (7-n-7 constructs). Increasing the spacing to four or more basepairs abolished NarP binding and significantly reduced NarL binding. The NarL protein also had a reduced binding affinity for heptamers adjacent to the 7-n-7 heptamer pair, suggesting a decrease in cooperative interactions. In conclusion, we propose that 7-2-7 sites are preferred by both NarL and NarP. NarL can also recognize other binding site arrangements, an ability that appears to be lacking in NarP.

Bacterial Proteins↗
PubMed2003

DNA supercoiling enables the type IIS restriction enzyme BspMI to recognise the relative orientation of two DNA sequences.

Many proteins can sense the relative orientations of two sequences at distant locations in DNA: some require sites in inverted (head-to-head) orientation, others in repeat (head-to-tail) orientation. Like many restriction enzymes, the BspMI endonuclease binds two copies of its target site before cleaving DNA. Its target is an asymmetric sequence so two sites in repeat orientation differ from sites in inverted orientation. When tested against supercoiled plasmids with two sites 700 bp apart in either repeated or inverted orientations, BspMI had a higher affinity for the plasmid with repeated sites than the plasmid with inverted sites. In contrast, on linear DNA or on supercoiled DNA with sites 1605 bp apart, BspMI interacted equally with repeated or inverted sites. The ability of BspMI to detect the relative orientation of two DNA sequences thus depends on both the topology and the length of the intervening DNA. Supercoiling may restrain the juxtaposition of sites 700 bp apart to a particular alignment across the superhelical axis, but the juxtaposition of sites in linear DNA or far apart in supercoiled DNA may occur without restraint. BspMI can therefore act as a sensor of the conformational dynamics of supercoiled DNA.

Binding Sites↗
PubMed1999

Novel genetic polymorphisms in DNA repair genes: O(6)-methylguanine-DNA methyltransferase (MGMT) and N-methylpurine-DNA glycosylase (MPG) in lung cancer patients from Poland.

Individuals with a decreased DNA repair capacity are at increased cancer risk. The aim of our investigation was to detect genetic polymorphisms in DNA repair genes. Two genes, MPG and MGMT, involved in repair of alkylated purines, have been selected. The genetic polymorphisms in the coding exons 2, 3 and 4 of MPG and in the enhancer region of MGMT were searched for in DNA samples from a group of 33 non-small-cell lung cancer (NSCLC) patients from Poland. The PCR products were sequenced with fluorescently labeled terminators and separated on automatic sequencer. Two polymorphisms in MPG were found: in exon 2: CGC-->TGC, (8603C>T, Genbank Accession Z69720) and in exon 3: CCG-->CCA, (12235G>A, Genbank Accession Z69720). The polymorphism in exon 2 results in amino acid substitution (Arg>Cys). Three polymorphisms within or around 59 bp enhancer of MGMT were detected: 1) 1034A>G (Genbank Accession X61657), 2) 1099C>T (Genbank Accession X61657), 3) 79G>T (Genbank Accession U95038). Polymorphism 2 is located in the 59-bp enhancer sequence, within a palindrome GGTGCGCACC. Polymorphism 3 destroys an inverted repeat GGGTGGGGGGCCGCCCTGACCCCCACCC that contains two PuF binding sequences GGGTGGG separated by Sp1 site. The nature and location of these polymorphisms is consistent with the hypothesis that they may have functional significance.

Carcinoma, Non-Small-Cell Lung↗
PubMed1993

Expression of the open reading frames of a senescence-inducing, linear mitochondrial plasmid of Neurospora crassa.

Senescence-prone strains of Neurospora crassa from Aarey, India, harbor a linear mitochondrial plasmid, maranhar, which potentially encodes an RNA polymerase and a DNA polymerase (Court and Bertrand, 1992). To investigate the expression of the open reading frames (ORFs) of this plasmid, the mitochondria of the prototype of the senescence-prone strains, Aarey-1e, were analyzed for the presence of maranhar-specific transcripts and proteins. In addition to several low-abundance and small RNAs, two major large transcripts, each encompassing one of the long ORFs, were identified. The 5'-termini of these two transcripts are identical and coincide with a nucleotide sequence that is located in the terminal inverted repeats of the plasmid and partially resembles the promoter sequences of Neurospora mitochondrial genes. The 3' end of one of the plasmid transcripts also has been mapped. It is located within the DNA spacer between the two convergent ORFs and does not coincide with a conventional transcription-termination or RNA-processing signal. Two novel proteins, which may be the plasmid-encoded DNA and RNA polymerases, are synthesized in the mitochondria of the maranhar-containing strain. Although the termini of the plasmid are linked to terminal protein, a third plasmid-specific polypeptide was not observed. Transcripts encompassing three small ORFs in the maranhar nucleotide sequence also were identified. These RNAs occur in rather low copy numbers, and translation products that might correspond to the small ORFs were not detected in the mitochondria of the plasmid-containing strain.

Amino Acid Sequence↗
PubMed1990

Three domains in the simian virus 40 core origin orchestrate the binding, melting, and DNA helicase activities of T antigen.

The simian virus 40 (SV40) core origin of replication consists of three functional domains. The sequence 5'-CACTACTTCTGGAATAG-3' with an imperfect inverted repeat (underlined), a palindrome with four 5'-GAGGC-3' pentanucleotide repeats, and a 17-base-pair A + T-rich segment. We have been able to assign primary functions to each domain. Remarkably, SV40 large T antigen melted the inverted repeat domain in the complete absence of other origin sequences. Presumably, this protein-DNA interaction initiates a replication bubble that leads to daughter strand DNA synthesis. The pentanucleotide domain alone docked and arranged T antigen at the origin. The A + T-rich domain had no independent function, but, in the presence of the other two domains, allowed bound T antigen to extend the replication bubble. Thus, three domains of the origin coordinate the binding, melting, and DNA helicase activities of T antigen in an ordered sequence of events to initiate DNA replication.

Antigens, Polyomavirus Transforming↗
PubMed1989

Adjacent upstream activation sequence elements synergistically regulate transcription of ADH2 in Saccharomyces cerevisiae.

A 22-base-pair (bp) inverted repeat present in the ADH2 promoter is an upstream activation sequence (UAS1) which confers ADR1-dependent activation upon a heterologous Saccharomyces cerevisiae promoter. UAS1 was nonfunctional when placed within an intron 3' to the transcription start site. The 11-bp sequence which constitutes one-half of the UAS1 palindrome did not activate transcription in a single copy, as direct repeats, or in an inverted orientation opposite to that of ADH2 UAS1. Furthermore, two pairs of symmetrical point mutations within UAS1 significantly reduced activation. This result suggests that a specific orientation of sequences within UAS1 is necessary for ADR1-dependent activation. We determined that an ADR1-dependent complex was formed with UAS1 and, to a lesser extent, with the nonfunctional 11-bp half palindrome. However, the 11 bp did not confer UAS activity, suggesting that ADR1 binding is not sufficient for activation in vivo. ADR1 did not bind to mutant UAS1 sequences in vitro, indicating that their decreased activation is attributable to a reduced affinity of ADR1 for these sequences. We also identified an additional 20-bp ADH2 element (UAS2) that increased the expression of CYC1-lacZ 20-fold when combined with UAS1. UAS2 permitted ADR1-independent, glucose-regulated expression of the hybrid gene. Consistent with this observation, ADR1 did not form a detectable complex with UAS2. Deletion of UAS2 at the chromosomal ADH2 locus virtually abolished ADH2 derepression and had no effect on glucose repression.

Alcohol Dehydrogenase↗
PubMed1998

Snapshot of a large dynamic replicon in a halophilic archaeon: megaplasmid or minichromosome?

Extremely halophilic archaea, which flourish in hypersaline environments, are known to contain a variety of large dynamic replicons. Previously, the analysis of one such replicon, pNRC100, in Halobacterium sp. strain NRC-1, showed that it undergoes high-frequency insertion sequence (IS) element-mediated insertions and deletions, as well as inversions via recombination between 39-kb-long inverted repeats (IRs). Now, the complete sequencing of pNRC100, a 191,346-bp circle, has shown the presence of 27 IS elements representing eight families. A total of 176 ORFs or likely genes of 850-bp average size were found, 39 of which were repeated within the large IRs. More than one-half of the ORFs are likely to represent novel genes that have no known homologs in the databases. Among ORFs with previously characterized homologs, three different copies of putative plasmid replication and four copies of partitioning genes were found, suggesting that pNRC100 evolved from IS element-mediated fusions of several smaller plasmids. Consistent with this idea, putative genes typically found on plasmids, including those encoding a restriction-modification system and arsenic resistance, as well as buoyant gas-filled vesicles and a two-component regulatory system, were found on pNRC100. However, additional putative genes not expected on an extrachromosomal element, such as those encoding an electron transport chain cytochrome d oxidase, DNA nucleotide synthesis enzymes thioredoxin and thioredoxin reductase, and eukaryotic-like TATA-binding protein transcription factors and a chromosomal replication initiator protein were also found. A multi-step IS element-mediated process is proposed to account for the acquisition of these chromosomal genes. The finding of essential genes on pNRC100 and its property of resistance to curing suggest that this replicon may be evolving into a new chromosome.

Chromosome Mapping↗
PubMed1988

Purification of multiple erythroid cell proteins that bind the promoter of the alpha-globin gene.

Three erythroid cell factors that bind the murine alpha-globin promoter were enriched more than 1,000-fold by conventional and DNA sequence affinity chromatography. Visualization of enriched polypeptides revealed simple patterns suggesting that each binding activity was purified. Two of the purified proteins, alpha-CP1 and alpha-CP2, have been shown previously to interact with distinct binding sites that overlap in the alpha-globin CCAAT box. Affinity purification of alpha-CP1 revealed seven polypeptides with Mrs raging from 27,000 to 38,000. In contrast, purified alpha-CP2 was made up of a polypeptide doublet with Mrs of 64,000 and 66,000. The third purified binding activity, alpha-IRP, interacted with sequences that formed an inverted repeat (IR) between the alpha-globin CCAAT and TATAA boxes. Affinity-purified alpha-IRP was made up of a single polypeptide with an Mr of 85,000. We confirmed that the purified polypeptides corresponded to alpha-CP1-, alpha-CP2-, and alpha-IRP-binding activities by UV cross-linking experiments (alpha-CP2 and alpha-IRP) or by renaturation of binding activity after elution of polypeptides from sodium dodecyl sulfate-polyacrylamide gels (alpha-CP1 and alpha-CP2). The apparent complexity of the polypeptides accounting for alpha-CP1 binding activity prompted a further physical characterization of this factor. Sedimentation of affinity-purified alpha-CP1 in glycerol gradients containing 100 mM KCl showed that all seven polypeptides migrated as a complex that cosedimented with alpha-CP1-binding activity. In contrast, when sedimented in glycerol gradients containing 500 mM KCl, alpha-CP1 dissociated into at least two components. Under these conditions, alpha-CP1-binding activity was reduced or lost. Activity was reconstituted, however, by combining fractions that were enriched in the two components. These results were confirmed by experiments in which we showed that alpha-CP1-binding activity can be recovered only by combining distinct sets of polypeptides that were isolated and renatured from sodium dodecyl sulfate-polyacrylamide gels. Our results suggest that the seven polypeptides visualized after affinity purification of alpha-CP1 interact to form a heterotypic complex (or set of complexes) required for alpha-CP1-binding activity.

Animals↗
PubMed1996

Gene organization in the UL region and inverted repeats of the canine herpesvirus genome.

Restriction mapping and the determination of scattered nucleotide sequences have permitted a description of the global structure and evolutionary affinities of the canine herpesvirus (CHV) genome. The global structure closely resembles that of the totally sequenced genomes of varicella-zoster virus and equine herpesvirus 1 (EHV-1) in having a 37 bp inverted repeat flanking a long unique region (UL) of approximately 100,000 bp, and a 10,100-10,700 bp inverted repeat flanking a short unique region (U8) of roughly 7,400-8,600 bp. On the basis of the sequences obtained, 35 homologues to previously identified herpesvirus gene products were found in UL and the major inverted repeat, and the level of the similarities indicated that CHV belongs to the genus Varicellovirus. Within the genus, CHV appears to be most closely related to EHV-1, pseudorabies virus and feline herpesvirus. Surprisingly, genes for both subunits of the viral ribonucleotide reductase were found to be missing from their equivalent place in other herpesvirus genomes. Either they have been translocated to another position in the CHV genome or, we think more likely, they have been lost.

Amino Acid Sequence↗
PubMed1994

Tn5401, a new class II transposable element from Bacillus thuringiensis.

A new class II (Tn3-like) transposable element, designated Tn5401, was recovered from a sporulation-deficient variant of Bacillus thuringiensis subsp. morrisoni EG2158 following its insertion into a recombinant plasmid. Sequence analysis of the insert revealed a 4,837-bp transposon with two large open reading frames, in the same orientation, encoding proteins of 36 kDa (306 residues) and 116 kDa (1,005 residues) and 53-bp terminal inverted repeats. The deduced amino acid sequence for the 36-kDa protein shows 24% sequence identity with the TnpI recombinase of the B. thuringiensis transposon Tn4430, a member of the phage integrase family of site-specific recombinases. The deduced amino acid sequence for the 116-kDa protein shows 42% sequence identity with the transposase of Tn3 but only 28% identity with the TnpA transposase of Tn4430. Two small open reading frames of unknown function, designated orf1 (85 residues) and orf2 (74 residues), were also identified. Southern blot analysis indicated that Tn5401, in contrast to Tn4430, is not commonly found among different subspecies of B. thuringiensis and is not typically associated with known insecticidal crystal protein genes. Transposition was studied with B. thuringiensis by using plasmid pEG922, a temperature-sensitive shuttle vector containing Tn5401. Tn5401 transposed to both chromosomal and plasmid target sites but displayed an apparent preference for plasmid sites. Transposition was replicative and resulted in the generation of a 5-bp duplication at the target site. Transcriptional start sites within Tn5401 were mapped by primer extension analysis. Two promoters, designated PL and PR, direct the transcription of orf1-orf2 and tnpI-tnpA, respectively, and are negatively regulated by TnpI. Sequence comparison of the promoter regions of Tn5401 and Tn4430 suggests that the conserved sequence element ATGTCCRCTAAY mediates TnpI binding and cointegrate resolution. The same element is contained within the 53-bp terminal inverted repeats, thus accounting for their unusual lengths and suggesting an additional role for TnpI in regulating Tn5401 transposition.

Amino Acid Sequence↗
PubMed1995

The inverted repeat regions of the simian varicella virus and varicella-zoster virus genomes have a similar genetic organization.

Simian varicella virus (SVV) causes a varicella-like disease in nonhuman primates. The DNA sequence and genetic organization of the inverted repeat region (RS) of the SVV genome was determined. The SVV RS is 7559 bp in size with 56% guanine+cytosine (G+C) content and includes 3 open reading frames (ORFs). The SVV RS1 ORF encodes a 1279 amino acid (aa) protein with 58 and 39% identity to the varicella-zoster virus (VZV) gene 62 and herpes simplex virus type 1 (HSV-1) ICP4 homologs, respectively. The predicted 261 aa SVV RS2 polypeptide possesses 52% identity with the VZV gene 63 homolog and 23% identity with the HSV-1 ICP22. The SVV RS3 encodes a 187 aa polypeptide with 56% and 28% identity to the VZV gene 64 and the HSV-1 US10 homologs, respectively, and includes an atypical zinc finger motif. A G+C-rich 16 base-pair (bp) sequence which is repeated 7 times and a putative SVV origin of replication were identified between the RS1 and RS2 ORFs. Comparison with the VZV RS indicates the SVV and VZV RS regions are similar in size and genetic organization.

Amino Acid Sequence↗