Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Expression divergence”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,369 records · Page 76Linked to original sources
PubMed2001

Divergent effects of corticotropin releasing hormone on endothelial cell nitric oxide synthase are associated with different expression of CRH type 1 and 2 receptors.

1. Endothelium is a target for an array of factors involved in inflammation. Endothelial cells express receptors for CRH, a neuropeptide produced during inflammation. We report both the concentration-dependent inhibitory effect of CRH upon cytokine-stimulated nitrite release by H5V murine endothelioma cells, and its stimulatory one in HUVEC cells. 2. Western blot analysis showed that CRH inhibits cytokine-stimulated iNOS protein in H5V cells, and, instead, potentiated it in HUVEC cells. 3. H5V cells expressed both CRH receptors (CRH-R1 and R2) mRNAs, whereas HUVEC cells expressed the CRH-R2 mRNA solely. 4. CRH increased medium nitrites and iNOS protein expression in H5V cells pretreated with the selective CRH-R1 antagonist CP 154,526. However, the selective CRH-R2 antagonist anti-Svg-30 failed to produce similar effects. In fact, anti-Svg-30 inhibited CRH-induced increase of nitrite release and iNOS expression in HUVEC cells. 5. Our results confirm the activating role of CRH on endothelial cells, although it suggests its possible inhibitory role in the late phase of the inflammatory response. NO-mediated effects of CRH on endothelial cells could be exploited in therapeutic strategies related to inflammatory and/or degenerative diseases.

Animals↗
PubMed1990

Genes for Plasmodium falciparum surface antigens cloned by expression in COS cells.

Two genes encoding membrane antigens of Plasmodium falciparum were isolated by transient expression in mammalian cells and selection with human immune sera from African adults exposed to P. falciparum malaria. COS-7 cells were transfected with a plasmid expression library constructed from P. falciparum genomic DNA, and cells expressing reactive malaria antigens on their surface were enriched by adherence to antibody-coated dishes. One of the genes isolated is distinctive in that it does not contain repeat sequences typical of many malarial genes cloned by immunoscreening of bacterial expression libraries. The second gene apparently encodes a polymorphic version of the P. falciparum merozoite surface antigen Ag513, since the two sequences are identical in the 5' and 3' coding regions but diverge completely in the center. The COS-7 expression system provides an alternate means for cloning genes encoding malarial membrane antigens by using those antibodies in complex immune sera that bind membrane-associated, nondenatured molecules.

Amino Acid Sequence↗
PubMed2005

Transcriptional switch of the dia1 and impA promoter during the growth/differentiation transition.

When growth stops due to the depletion of nutrients, Dictyostelium cells rapidly turn off vegetative genes and start to express developmental genes. One of the early developmental genes, dia1, is adjacent to a vegetative gene, impA, on chromosome 4. An intergenic region of 654 bp separates the coding regions of these divergently transcribed genes. Constructs carrying the intergenic region expressed a reporter gene (green fluorescent protein gene) that replaced impA in growing cells and a reporter gene that replaced dia1 (DsRed) during development. Deletion of a 112-bp region proximal to the transcriptional start site of impA resulted in complete lack of expression of both reporter genes during growth or development. At the other end of the intergenic region there are two copies of a motif that is also found in the carA regulatory region. Removing one copy of this repeat reduced impA expression twofold. Removing the second copy had no further consequences. Removing the central portion of the intergenic region resulted in high levels of expression of dia1 in growing cells, indicating that this region contains a sequence involved in repression during the vegetative stage. Gel shift experiments showed that a nuclear protein present in growing cells recognizes the sequence GAAGTTCTAATTGATTGAAG found in this region. This DNA binding activity is lost within the first 4 h of development. Different nuclear proteins were found to recognize the repeated sequence proximal to dia1. One of these became prevalent after 4 h of development. Together these regulatory components at least partially account for this aspect of the growth-to-differentiation transition.

Animals↗
PubMed1996

Neo-Darwinian developmental evolution: can we bridge the gap between pattern and process?

In the past decade, there has been a surge of renewed interest in the study of developmental evolution. One approach that has been taken is to examine the expression patterns of a candidate gene in divergent taxa and to use these results to infer which aspects of a particular genetic pathway are either conserved or altered. Here we consider this approach from the perspective of the neo-Darwinian paradigm for evolutionary change. If adaptations are typically composed of large numbers of gene substitutions that are of small effect individually, then the candidate gene approach is unlikely to bridge the gap between developmental pattern and evolutionary process: changes in gene expression patterns may identify the steps in developmental pathways that have been altered during evolution but fail to identify the actual genetic changes that have occurred. On the other hand, there is growing support for the view that adaptations often involve large-effect genes; fortunately, the candidate gene approach is well suited to this type of genetic architecture.

Animals↗
PubMed1995

Small clusters of divergent amino acids surrounding the effector domain mediate the varied phenotypes of EF-G and LepA expression.

Elongation factors G, Tu, and related proteins (including LepA) form a distinct subgroup within the GTPase superfamily. This observation is based primarily upon amino acid comparisons of the effector region (G2) of the GTP-binding domain. To examine the functional importance of the highly conserved elongation factor G2 domain a series of chimeric proteins were constructed between Escherichia coli EF-G and Micrococcus luteus EF-G, and between E. coli EF-G and LepA (a protein of unknown function). The M. luteus EF-G/E. coli EF-G hybrid, M. luteus EF-G, and E. coli EF-G efficiently complemented EF-G function in an E. coli strain (PEM101) harbouring a temperature-sensitive mutation in fusA (the gene encoding EF-G). A comparison of the amino acid sequences of the M. luteus EF-G and E. coli EF-G indicated that groups of divergent amino acid residues (amino acids 1-9 and 72-80) were not important for function. LepA and LepA/EF-G chimeric proteins were tested for the ability to complement EF-G function in vivo, for cross-linking to 8-azido-[gamma-32P]-GTP in vitro and for fusidic acid-dependent co-sedimentation with 70S ribosomes. With one exception, all chimeras could be readily cross-linked to azido-GTP in an EF-G-like manner, indicating that hybrid protein construction did not generally result in improperly folded GTP-binding domains. However, the inability of such chimeras to complement EF-G function in vivo indicates that the effector domains are not functionally interchangeable. All LepA/EF-G chimeric proteins were severely defective in fusidic acid-dependent complex formation with 70S ribosomes. A comparison of the amino acid sequences of all three proteins suggests that residues 30-33, 43-48, and 63-66 of E. coli EF-G are important for EF-G specific ribosome-associated function.

Amino Acid Sequence↗
PubMed1996

Comparative HPLC, SDS-PAGE, and immunoblot analyses of dental enamel proteins.

The primary structures of amelogenins expressed from different genes vary because of DNA sequence divergence and variations in alternative RNA splicing. The pattern of splicing is unique for each amelogenin gene yet investigated, even when two copies of the gene are expressed in the same cell. Despite the high conservation of amelogenin sequences, diversity in the pattern of RNA splicing leads to significant differences in the number and character of amelogenin isoforms in the developing enamel matrix. Since conservation of molecular structure is an indicator of functional significance, we compared enamel protein preparations from rat, porcine, rabbit, and opossum developing tooth organs. Enamel extracts were fractionated by reversed-phase high-performance liquid chromatography (HPLC) and analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Western blot analyses were performed with polyclonal antibodies raised against recombinant murine amelogenin and the polypeptide encoded by murine exon 4. The opossum enamel extract produced the simplest chromatogram, suggesting that fewer proteins are secreted into the developing enamel matrix. The predominant opossum amelogenin has an apparent molecular mass of 28 kDa and reacts strongly with the recombinant amelogenin antibody but is not recognized by the murine exon 4 antibody. Opossum amelogenin mRNA was amplified with murine amelogenin primers specific for the amino- and carboxyl-terminal coding regions. The mobility of the amplification products on 4% agarose gels indicates that the leucine-rich amelogenin polypeptide (LRAP) is expressed in the opossum and that the major amelogenin is larger than its homologue in the mouse. We conclude that the alternative splicing of amelogenins pre-dates the metatherian and eutherian divergence over 100 million years ago.

Alternative Splicing↗
PubMed2003

TRF3, a TATA-box-binding protein-related factor, is vertebrate-specific and widely expressed.

TATA-box-binding protein (TBP) is a highly conserved RNA polymerase II general transcription factor that binds to the core promoter and initiates assembly of the preinitiation complex. Two proteins with high homology to TBP have been found: TBP-related factor 1 (TRF1), described only in Drosophila melanogaster, and TRF2, which is broadly distributed in metazoans. Here, we report the identification and characterization of an additional TBP-related factor, TRF3. TRF3 is virtually identical to TBP in the C-terminal core domain, including all residues involved in DNA binding and interaction with other general transcription factors. Like other TBP family members, the N-terminal region of TRF3 is divergent. The TRF3 gene is present and expressed in vertebrates, from fish through humans, but absent from the genomes of the urochordate Ciona intestinalis and the lower eukaryotes D. melanogaster and Caenorhabditis elegans. TRF3 is a nuclear protein that is present in all human and mouse tissues and cell lines examined. Despite the highly homologous TBP-like C-terminal core domain, gel filtration analysis indicates that the native molecular weight of TRF3 is substantially less than that of TFIID. Interestingly, after mitosis, reimport of TRF3 into the nucleus occurs subsequent to TBP and other basal transcription factors. In summary, TRF3 is a highly conserved vertebrate-specific TRF whose phylogenetic conservation, expression pattern, and other properties are distinct from those of TBP and all other TRFs.

Amino Acid Sequence↗
PubMed1996

Primary cilium expression in cells from normal and aberrant human skin.

Primary cultures of diploid fibroblasts from human skin have a high incidence of primary cilia associated with their centrosomal centrioles, particularly in stationary phase ("quiescent") cultures. Their progenitor cells in vivo have this same high incidence. Repeated subculturing to > 25 generations did not significantly alter the frequency of expression of cilia. The expression of ciliation remained largely unaffected in fibroblasts grown in culture from cases of hypertrophic scar and keloid, but generally run at a marginally lower level. In contrast, keratinocytes--which have an equally high incidence of primary cilium expression in vivo--seldom express primary cilia in vitro, a distinction most clearly seen when both cell types were present within the same culture. Fibroblasts grown in keratinocyte medium at low total Ca++ concentration ( < 2 x 10-5 M) possessed the same high incidence of ciliation as cells in high Ca++ medium (concentration 1-2.5 x 10-3 M). Increased Ca++ levels in the medium, which induced differentiation of keratinocytes from their low calcium proliferative state, were accompanied by a small increase in the expression of primary cilia over 23 h. The divergent abilities of different cell types in primary culture obtained from a common origin, i.e. skin biopsies, to develop primary cilia are demonstrated, opening up avenues for exploration of factors required for their expression in culture.

Adult↗
PubMed1995

Expression of alternate forms of brain opioid 'orphan' receptor mRNA in activated human peripheral blood lymphocytes and lymphocytic cell lines.

We screened a PHA (phytohemagglutinin)-activated human lymphocyte cDNA library for clones with homology to the recently cloned brain opioid receptors. A cDNA clone, AT7-5EU, was isolated which encodes the opioid 'orphan' receptor, a molecule with very high homology to the opioid receptor gene family, but which has not been shown to bind opioids or any other known compounds. The protein coding region of AT7-5EU has complete homology with a reported opioid 'orphan' clone isolated from human brain, but the 5' untranslated regions of AT7-5EU and the human brain clones are divergent, suggesting mechanisms for tissue-specific expression of this receptor. Northern analysis of AT7-5EU mRNA demonstrates the expression of this message in human lymphocytic cell lines of both B-and T-cell lineages. Furthermore, analysis of mRNA from human peripheral blood lymphocytes demonstrates that activation of the lymphocytes with PHA results in at least a 10-fold induction of the AT7-5EU message. These results suggest that the opioid 'orphan' receptor may have an important immunological function in addition to its function in the nervous system.

Base Sequence↗
PubMed2004

Expression profiling of rice segregating for drought tolerance QTLs using a rice genome array.

Plants alter their gene expression patterns in response to drought. Sometimes these transcriptional changes are successful adaptations leading to tolerance, while in other instances the plant ultimately fails to adapt to the stress and is labeled as sensitive to that condition. We measured the expression of approximately half of the genes in rice ( approximately 21,000) in phenotypically divergent accessions and their transgressive segregants to associate stress-regulated gene expression changes with quantitative trait loci (QTLs) for osmotic adjustment (OA, a trait associated with drought tolerance). Among the parental lines, a total of 662 transcripts were differentially expressed. Only 12 genes were induced in the low OA parent, CT9993, at moderate dehydration stress levels while over 200 genes were induced in the high OA parent, IR62266. The high and low OA parents had almost entirely different transcriptional responses to dehydration stress suggesting a complete absence of an appropriate response rather than a slower response in CT9993. Sixty-nine genes were up-regulated in all the high OA lines and nine of those genes were not induced in any of the low OA lines. The annotation of four of those genes, sucrose synthase, a pore protein, a heat shock and an LEA protein, suggests a role in maintaining high OA and membrane stability. Of the 3,954-probe sets that correspond to the QTL intervals, very few had a differential expression pattern between the high OA and low OA lines that suggest a role leading to the phenotypic variation. However, several promising candidates were identified for each of the five QTL including a snRNP auxiliary factor, a LEA protein, a protein phosphatase 2C and a Sar1 homolog.

Disasters↗
PubMed1994

Activation of the human mitochondrial transcription factor A gene by nuclear respiratory factors: a potential regulatory link between nuclear and mitochondrial gene expression in organelle biogenesis.

Mitochondrial transcription factor A (mtTFA), the product of a nuclear gene, stimulates transcription from the two divergent mitochondrial promoters and is likely the principal activator of mitochondrial gene expression in vertebrates. Here we establish that the proximal promoter of the human mtTFA gene is highly dependent upon recognition sites for the nuclear respiratory factors, NRF-1 and NRF-2, for activity. These factors have been previously implicated in the activation of numerous nuclear genes that contribute to mitochondrial respiratory function. The affinity-purified factors from HeLa cells specifically bind to the mtTFA NRF-1 and NRF-2 sites through guanine nucleotide contacts that are characteristic for each site. Mutations in these contacts eliminate NRF-1 and NRF-2 binding and also dramatically reduce promoter activity in transfected cells. Although both factors contribute, NRF-1 binding appears to be the major determinant of promoter function. This dependence on NRF-1 activation is confirmed by in vitro transcription using highly purified recombinant proteins that display the same binding specificities as the HeLa cell factors. The activation of the mtTFA promoter by both NRF-1 and NRF-2 therefore provides a link between the expression of nuclear and mitochondrial genes and suggests a mechanism for their coordinate regulation during organelle biogenesis.

Base Sequence↗
PubMed1998

NEEDLY, a Pinus radiata ortholog of FLORICAULA/LEAFY genes, expressed in both reproductive and vegetative meristems.

The LEAFY/FLORICAULA genes from Arabidopsis and Antirrhinum are necessary for normal flower development and play a key role in diverse angiosperm species. A homologue of these flower meristem-identity genes, NEEDLY (NLY), has been identified in Pinus radiata. Although the NLY protein shares extensive sequence similarity with its angiosperm counterparts, it is lacking the proline-rich and acidic motifs thought to function as transcriptional activation domains. NLY already is expressed during vegetative development at least 5 years before the transition to the reproductive phase. Expression of NLY in transgenic Arabidopsis promotes floral fate, demonstrating that, despite its sequence divergence, NLY encodes a functional ortholog of the FLORICAULA/LEAFY genes of angiosperms. Expression of the LFY::NLY transgene can largely complement the defects in flower development caused by a severe lfy allele.

Amino Acid Sequence↗
PubMed1997

Two homologous low-temperature-inducible genes from Arabidopsis encode highly hydrophobic proteins.

We have characterized two related cDNAs (RCI2A and RCI2B) corresponding to genes from Arabidopsis thaliana, the expression of which is transiently induced by low, nonfreezing temperatures. RCI2A and RCI2B encode small (54 amino acids), highly hydrophobic proteins that bear two potential transmembrane domains. They show similarity to proteins encoded by genes from barley (Hordeum vulgare L.) and wheatgrass (Lophophyrum elongatum) that are regulated by different stress conditions. Their high level of sequence homology (78%) and their genomic location in a single restriction fragment suggest that both genes originated as a result of a tandem duplication. However, their regulatory sequences have diverged enough to confer on them different expression patterns. Like most of the cold-inducible plant genes characterized, the expression of RCI2A and RCI2B is also promoted by abscisic acid (ABA) and dehydration but is not a general response to stress conditions, since it is not induced by salt stress or by anaerobiosis. Furthermore, low temperatures are able to induce RCI2A and RCI2B expression in ABA-deficient and -insensitive genetic backgrounds, indicating that both ABA-dependent and -independent pathways regulate the low-temperature responsiveness of these two genes.

Abscisic Acid↗
PubMed1996

Cloning, sequencing, and expression of ruvB and characterization of RuvB proteins from two distantly related thermophilic eubacteria.

The ruvB genes of the highly divergent thermophilic eubacteria Thermus thermophilus and Thermotoga maritima were cloned, sequenced, and expressed in Escherichia coli. Both thermostable RuvB proteins were purified to homogeneity. Like E. coli RuvB protein, both purified thermostable RuvB proteins showed strong double-stranded DNA-dependent ATPase activity at their temperature optima (> or = 70 degrees C). In the absence of ATP, T. thermophilus RuvB protein bound to linear double-stranded DNA with a preference for the ends. Addition of ATP or gamma-S-ATP destabilized the T. thermophilus RuvB-DNA complexes. Both thermostable RuvB proteins displayed helicase activity on supercoiled DNA. Expression of thermostable T. thermophilus RuvB protein in the E. coli ruvB recG mutant strain N3395 partially complemented the UV-sensitive phenotype, suggesting that T. thermophilus RuvB protein has a function similar to that of E. coli RuvB in vivo.

Adenosine Triphosphatases↗
PubMed2005

Zebrafish alpha-crystallins: protein structure and chaperone-like activity compared to their mammalian orthologs.

PURPOSE: The vertebrate small heat shock proteins alphaA- and alphaB-crystallin contribute to the transparency and refractive power of the lens and may also prevent the aggregation of non-native proteins that would otherwise lead to cataracts. We previously showed that zebrafish (Danio rerio) and human alphaB-crystallin have diverged far more in primary structure and expression pattern than the orthologous alphaA-crystallins. In this current study we further compare the structure and function of zebrafish and mammalian alpha-crystallins. METHODS: Near UV CD spectroscopy was used to analyze the tertiary structure and thermal stability of recombinant zebrafish alpha-crystallins. The chaperone-like activities of zebrafish and human alpha-crystallins were compared by assaying their ability to prevent the chemically induced aggregation of several target proteins at temperatures between 25 degrees C and 40 degrees C. RESULTS: Zebrafish and human alphaA-crystallin showed very similar tertiary structures, while the alphaB-crystallin orthologs showed differences related to the presence of additional aromatic amino acids in the zebrafish protein. The denaturation temperatures of zebrafish crystallins were lower than those of mammals. The chaperone-like activities of the two zebrafish alpha-crystallins were highly divergent, with alphaA-crystallin showing much greater activity than alphaB-crystallin. CONCLUSIONS: alphaA-crystallin serves a similar physiological function in both zebrafish and mammals as a lens specific chaperone-like molecule. The reduced chaperone-like function of zebrafish alphaB-crystallin and its lack of extralenticular expression indicates that it plays a different physiological role from its mammalian ortholog. Future comparative studies of alpha-crystallin from closely related vertebrate species can help identify specific structural changes that lead to alterations in chaperone-like activity.

Animals↗
PubMed1999

Multiplicity of glutamic acid decarboxylases (GAD) in vertebrates: molecular phylogeny and evidence for a new GAD paralog.

The evolution of chordate glutamic acid decarboxylase (GAD; EC 4.1.1.15), a key enzyme in the central nervous system synthesizing the neurotransmitter gamma-amino-butyric acid (GABA) from glutamate, was studied. Prior to this study, molecular data of GAD had been restricted to mammals, which express two distinct forms, GAD65 and GAD67. These are the products of separate genes and probably are derived from a common ancestral GAD following gene duplication at some point during vertebrate evolution. To enable a comprehensive phylogenetic analysis, molecular information of GAD forms in other vertebrate classes was essential. By reverse transcriptase-polymerase chain reaction (RT-PCR), partial nucleotide sequences of GAD were cloned from brains of zebra finch (Taeniopygia guttata), turtle (Trachemys scripta), goldfish (Carassius auratus), zebrafish (Danio rerio), and armoured grenadier (Coryphaenoides (Nematonurus) armatus, a deep-sea fish), and from the cerebral ganglion plus neural gland of Ciona intestinalis, a protochordate. Whereas GAD65 and GAD67 homologs were expressed in birds, reptiles, and fish, only a single GAD cDNA with equal similarities to both vertebrate GAD forms was found in the protochordate. This indicates that the duplication of the vertebrate GAD gene occurred between 400 and 560 million years ago. For both GAD65 and GAD67, the generated phylogenetic tree followed the general tree topology for the major vertebrate classes. In turtle, an alternative spliced form of GAD65, putatively encoding a truncated, nonactive GAD, was found. Furthermore, a third GAD form, which is equally divergent from both GAD65 and GAD67, is expressed in C. (N.) armatus. This third form might have originated from an ancient genome duplication specific to modern ray-finned fishes.

Alternative Splicing↗
PubMed2025

The Fire Ant Social Chromosome Exerts a Major Influence on Genome Regulation.

Supergenes underlying complex trait polymorphisms ensure that sets of coadapted alleles remain genetically linked. Despite their prevalence in nature, the mechanisms of supergene effects on genome regulation are poorly understood. In the fire ant Solenopsis invicta, a supergene containing over 500 individual genes influences trait variation in multiple castes to collectively underpin a colony level social polymorphism. Here, we present results of an integrative investigation of supergene effects on gene regulation. We present analyses of ATAC-seq data to investigate variation in chromatin accessibility by supergene genotype and STARR-seq data to characterize enhancer activity by supergene haplotype. Integration with gene co-expression analyses, newly mapped intact transposable elements (TEs), and previously identified copy number variants (CNVs) collectively reveals widespread effects of the supergene on chromatin structure, gene transcription, and regulatory element activity, with a genome-wide bias for open chromatin and increased expression in the presence of the derived supergene haplotype, particularly in regions that harbor intact TEs. Integrated consideration of CNVs and regulatory element divergence suggests each evolved in concert to shape the expression of supergene encoded factors, including several transcription factors that may directly contribute to the trans-regulatory footprint of a heteromorphic social chromosome. Overall, we show how genome structure in the form of a supergene has wide-reaching effects on gene regulation and gene expression.

Animals↗
PubMed1992

Modulation of c-jun and jun-B messenger RNA and inhibition of DNA synthesis by prostaglandin E2 in Syrian hamster embryo cells.

Fatty acid metabolites such as prostaglandins are important regulators of DNA synthesis and cell proliferation. However, the mechanisms involved in this regulation are unclear. We have examined the effects of several fatty acid metabolites on the expression of the growth-related genes c-jun and jun-B in Syrian hamster embryo cells. Treatment of cells with prostaglandin E2 (PGE2) resulted in the inhibition of epidermal growth factor (EGF)-induced DNA synthesis and c-jun mRNA accumulation, whereas PGE2 augmented EGF-stimulated jun-B mRNA and markedly stimulated jun-B accumulation in the absence of EGF. Treatment of cells with PGE2 resulted in rapid accumulation of cyclic AMP (cAMP), whereas prostaglandin F2 alpha did not stimulate cAMP formation and did not alter EGF-stimulated DNA synthesis or accumulation of c-jun or jun-B mRNA. Forskolin and 8-(4-chlorophenylthio)-cAMP mimicked the effects of PGE2 on DNA synthesis and on the expression of c-jun and jun-B, suggesting the involvement of cAMP. We have shown that EGF-induced DNA synthesis requires the formation of hydroxyoctadecadienoic acids, formed from linoleic acid by a 15-lipoxygenase, in Syrian hamster embryo cells (Glasgow et al., J. Biol. Chem., 267: 10771-10779). Inhibition of this 15-lipoxygenase blocked EGF-dependent hydroxyoctadecadienoic acid formation and mitogenesis but did not affect EGF-stimulated c-jun or jun-B mRNA accumulation. The data suggest that the modulation of EGF-dependent DNA synthesis by PGE2 is associated with altered expression of c-jun and jun-B in Syrian hamster embryo cells. In contrast, hydroxyoctadecadienoic acids appear to act downstream or divergent from c-jun and jun-B expression in the regulation of EGF-dependent DNA synthesis.

Animals↗