Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Structure”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,351 records · Page 75Linked to original sources
PubMed2000

Structural and functional consequences of peptide-carbohydrate mimicry. Crystal structure of a carbohydrate-mimicking peptide bound to concanavalin A.

The functional consequences of peptide-carbohydrate mimicry were analyzed on the basis of the crystal structure of concanavalin A (ConA) in complex with a carbohydrate-mimicking peptide, DVFYPYPYASGS. The peptide binds to the non-crystallographically related monomers of two independent dimers of ConA in two different modes, in slightly different conformations, demonstrating structural adaptability in ConA-peptide recognition. In one mode, the peptide has maximum interactions with ConA, and in the other, it shows relatively fewer contacts within this site but significant contacts with the symmetry-related subunit. Neither of the peptide binding sites overlaps with the structurally characterized mannose and trimannose binding sites on ConA. Despite this, the functional mimicry between the peptide and carbohydrate ligands was evident. The peptide-inhibited ConA induced T cell proliferation in a dose-dependent manner. The effect of the designed analogs of the peptide on ConA-induced T cell proliferation and their recognition by the antibody response against alpha-d-mannopyranoside indicate a role for aromatic residues in functional mimicry. Although the functional mimicry was observed between the peptide and carbohydrate moieties, the crystal structure of the ConA-peptide complex revealed that the two peptide binding sites are independent of the methyl alpha-d-mannopyranoside binding site.

Binding Sites↗
PubMed2001

Structural insights into steroid hormone binding: the crystal structure of a recombinant anti-testosterone Fab fragment in free and testosterone-bound forms.

The monoclonal anti-testosterone antibody (3-C(4)F(5)) has a relatively high affinity (3 x 10(8) m(-1)) with an overall good specificity profile. However, the earlier characterized binding properties have shown that both the affinity and specificity of this antibody must be improved if it is intended for use in clinical immunoassays. In this paper, the crystal structures of the recombinant anti-testosterone (3-C(4)F(5)) Fab fragment have been determined in the testosterone-bound and free form at resolutions of 2.60 and 2.72 A, respectively. The high affinity binding of the (3-C(4)F(5)) Fab is mainly determined by shape complementarity between the protein and testosterone. Only one direct hydrogen bond is formed between the hydroxyl group of the testosterone D-ring and the main-chain oxygen of Gly100(J)H. The testosterone is deeply bound in a hydrophobic pocket, and the close shape complementarity is mainly formed by the third complementarity-determining regions (CDR) of the heavy and light chain. Comparison of the bound structure with the free structure indicates conformational changes in the protein upon testosterone binding. The conformational changes of the side chains of two residues Glu95H and Tyr99H in the CDR-H3 are particularly essential for the binding. Interesting similarities in the binding of different steroids were also observed upon comparison of the available structures of anti-steroid antibodies.

Amino Acid Sequence↗
PubMed2002

The effect of cytosine methylation on the structure and geometry of the Holliday junction: the structure of d(CCGGTACm5CGG) at 1.5 A resolution.

The single crystal structure of the methylated sequence d(CCGGTACm(5)CGG) has been solved as an antiparallel stacked X Holliday junction to 1.5 A resolution. When compared with the parent nonmethylated d(CCGGTACCGG) structure, the duplexes are translated by 3.4 A along the helix axis and rotated by 10.8 degrees relative to each other, rendering the major grooves more accessible overall. A Ca(2+) complex is seen in the minor groove opposite the junction but is related to the B conformation of the stacked arms. At the junction itself, the hydrogen bond from the N4 nitrogen of cytosine C8 to the C7 phosphate at the crossover in the parent structure has been replaced by a water bridge. Thus, this direct interaction is not absolutely required to stabilize the junction at the previously defined ACC trinucleotide core. The more compact methylated junction forces the Na(+) of the protected central cavity of the nonmethylated junction into a solvent cluster that spans the space between the junction crossover and the stacked arms. A series of void volumes within the methylated and the nonmethylated structures suggests that small monovalent cations can fill and vacate this central cavity without the need to unfold the four-stranded Holliday junction completely.

Base Sequence↗
PubMed2002

The three-dimensional structure of the human alpha 2-macroglobulin dimer reveals its structural organization in the tetrameric native and chymotrypsin alpha 2-macroglobulin complexes.

Three-dimensional electron microscopy reconstructions of the human alpha(2)-macroglobulin (alpha(2)M) dimer and chymotrypsin-transformed alpha(2)M reveal the structural arrangement of the two dimers that comprise native and proteinase-transformed molecules. They consist of two side-by-side extended strands that have a clockwise and counterclockwise twist about their major axes in the native and transformed structures, respectively. This and other studies show that there are major contacts between the two strands at both ends of the molecule that evidently sequester the receptor binding domains. Upon proteinase cleavage of the bait domains and subsequent thiol ester cleavages, which occur near the central region of the molecule, the two strands separate by 40 A at both ends of the structure to expose the receptor binding domains and form the arm-like extensions of the transformed alpha(2)M. During the transformation of the structure, the strands untwist to expose the alpha(2)M central cavity to the proteinase. This extraordinary change in the architecture of alpha(2)M functions to completely engulf two molecules of chymotrypsin within its central cavity and to irreversibly encapsulate them.

Chymotrypsin↗
PubMedDate not supplied

Population structure of two black Venezuelan populations studied through their mating structure and other related variables.

In order to obtain information about the population structure of two black Venezuelan populations with historical differences both in their origins and development, a variety of variables were utilized, especially on marital structure, including: frequency of surnames, isonymy, population genealogical consanguinity, multiple unions, and marital distances, all of which provided information and isolation, migration, endogamy, consanguinity, and patri-matrifocality. Results showed differences in the extent of isolation and endogamy, as well as differences in population structure, which can be directly related with historical conditions of each population. Results agree with those previously obtained with traditional genetic polymorphisms and with the historical information available. Thus, the usefulness of surnames for inferring about population structure is supported, as well as the usefulness of historical information for explaining genetic diversity.

Anthropology, Cultural↗
PubMed2001

Recognition and stabilization of a unique CPRI--structural motif in cucurbitaceae family trypsin inhibitor peptides: molecular dynamics based homology modeling using the X-ray structure of MCTI-II.

The high resolution crystallographic structure of MCTI-II complexed with beta trypsin (PDB entry 1MCT) was used to model the corresponding structures of the six inhibitor peptides belonging to Cucurbitaceae family (MCTI-I, LA-1, LA-2, CMTI-I, CMTI-III, CMTI-IV). Two model inhibitors, LA-1 and LA-2 were refined by molecular dynamics to estimate the average solution structure. The difference accessible surface area (DASA) study of the inhibitors with and without trypsin revealed the Arginine and other residues of the inhibitors which bind to trypsin. The hydration dynamics study of LA1 and LA2 also confirm the suitability of water molecules at the active Arg site. Moreover, the presence of a unique 3D-structural motif comprises with the four CPRI residues from the amino terminal is thought to be conserved in all the six studied inhibitors, which seems essential for the directional fixation for proper complexation of the Arg (5) residue towards the trypsin S1-binding pocket. The role of the disulphide linkage in the geometrical stabilization of CPRI (Cysteine, Proline, Arginine, Isoleucine) motif has also been envisaged from the comparative higher intra molecular Cys (3) -Cys (20) disulphide dihedral energies.

Amino Acid Motifs↗
PubMed2002

A new peculiar DNA structure: NMR solution structure of a DNA kissing complex.

The deoxyoligoribonucleotide d(CTTGCTGAAGCGCGCACGGCAAG) (dSL1) corresponding to the reverse transcripted sequence of the dimerization initiation site SL1 of HIV- 1(Lai) RNA was synthesized using phosphoramidite chemistry. Like its oligoribonucleotide counterpart, dSL1 dimerized spontaneously in solution. Here we report the first NMR solution structure of a kissing complex formed with two DNA strands. The melting point of the DNA dimer (35 degrees C) was found slightly higher than the one of the corresponding RNA dimer (32 degrees C). Despite this only slight difference in melting point, several structural differences were observed between the ribo- and the deoxyribo- dimers. The solution structure of the deoxy- dimer was a symmetric homodimer with a loop-loop interaction stabilized by four central G-C base-pairs, a head to tail A-A base-pair arrangement between the A8 residues of the two strands and a stacking of A9 with C15. As a consequence, G10 was not paired and occupied a position outside the stem and the loop. Each stem was formed by seven base-pairs whose axis made an angle of about 100 degree with the plane of the loops. The distortion of the helix at the junction of the stem and of the loop induced a fold up of the A8pA9 step with a phosphate-phosphate distance lowered to 4.5 A. The plane of the non-canonical A-A base-pair was oriented perpendicularly to the axis of the stems. The four central base-pairs formed an open fan-shaped motif with an angle of 20 degrees between the bases and each of them was oriented perpendicularly to the A8-A8 plane. The deviation of the computed chemical shifts and the experimental ones for the aromatic proton was always less than 0.25ppm for each of the 16 converged solution structures and their average less than 0.1ppm.

Base Sequence↗
PubMed2005

Effects of a 8-oxoadenosine incorporation on quadruplex structures: thermal stabilities and structural studies.

The effects of incorporation of 8-oxoadenosine in two different truncations of human telomeric sequence forming quadruplex structures are reported. In order to characterise their structures, a combination of NMR and UV spectroscopy and computational techniques were used. Both oligonucleotides have been found to form fourfold symmetric quadruplex structures. As a tautomeric equilibrium between keto and enol forms of 8-oxoadenosine may establish in solution and intrinsic stabilities effects, such as internal H-bonds, for example, may determine the predominance of some particular tautomer, molecular modelling studies were performed on quadruplex structures containing both the tautomeric forms. Both molecules resulted to be thermally less stable than the natural.

Adenosine↗
PubMed1980

Primary structure of diphtheria toxin fragment B: structural similarities with lipid-binding domains.

Two different lipid-associating domains have been identified in the B fragment of diphtheria toxin using automated Edman degradation of its cyanogen bromide peptides, secondary structure prediction analysis, and comparisons with known phospholipid-interacting proteins. The first domain is located in the highly hydrophilic (polarity index [PI] = 61.0%) 9.00-dalton N-terminal region of fragment B. This region shows primary and predicted secondary structures dramatically similar to those found for the phospholipid headgroup-binding domains of human apolipoprotein A1 (surface lipid-associating domain). The second domain is located in the highly hydrophobic (PI = 32.4%) middle region of fragment B. Its structure resembles that found for the membranous domain of intrinsic membrane proteins (transverse lipid-associating domain). In contrast, the hydrophilic C-terminal 8,000-dalton region of fragment B (PI = 53.8%) does not show structural similarity with lipid-associating domains.

Amino Acid Sequence↗
PubMed1998

The crystal structure of ribosomal protein S4 reveals a two-domain molecule with an extensive RNA-binding surface: one domain shows structural homology to the ETS DNA-binding motif.

We report the 1.7 A crystal structure of ribosomal protein S4 from Bacillus stearothermophilus. To facilitate the crystallization, 41 apparently flexible residues at the N-terminus of the protein have been deleted (S4Delta41). S4Delta41 has two domains; domain 1 is completely alpha-helical and domain 2 comprises a five-stranded antiparallel beta-sheet with three alpha-helices packed on one side. Domain 2 is an insertion within domain 1, and it shows significant structural homology to the ETS domain of eukaryotic transcription factors. A phylogenetic analysis of the S4 primary structure shows that the likely RNA interaction surface is predominantly on one side of the protein. The surface is extensive and highly positively charged, and is centered on a distinctive canyon at the domain interface. The latter feature contains two arginines that are totally conserved in all known species of S4 including eukaryotes, and are probably crucial in binding RNA. As has been shown for other ribosomal proteins, mutations within S4 that affect ribosome function appear to disrupt the RNA-binding sites. The structure provides a framework with which to probe the RNA-binding properties of S4 by site-directed mutagenesis.

Amino Acid Sequence↗
PubMed1982

Primary and secondary structures of Tetrahymena and aphid 5.8S rRNAs: structural features of 5.8S rRNA which interacts with the 28S rRNA containing the hidden break.

The Tetrahymena 5.8S rRNA is 154 nucleotides long, the shortest so far reported except for the split 5.8S rRNAs of Diptera (m5.8S plus 2S rRNA). In this molecule several nucleotides are deleted in the helix e (GC-rich stem) region. Upon constructing the secondary structure in accordance with "burp-gun" model, the Tetrahymena 5.8S rRNA forms a wide-open "muzzle" of the terminal regions due to both extra nucleotides and several unpaired bases. The aphid 5.8S rRNA consists of 161 nucleotides and can form stable helices in both terminal and helix e regions. As a whole, the secondary structure of Tetrahymena 5.8S rRNA resembles that of Bombyx 5.8S molecule while the aphid 5.8S rRNA shares several structural features with the HeLa 5.8S molecule. Likely, the 5.8S rRNA attached to the 28S rRNA with the hidden break differs in structure from those interacting with the 28S partners without the break. Nucleotide sequences of 5.8S rRNA in insects as well as in protozoans are not so conservative evolutionarily as in vertebrates.

Animals↗
PubMed1987

Anomalous structure and properties of poly (dA).poly(dT). Computer simulation of the polynucleotide structure with the spine of hydration in the minor groove.

The results of the search for low-energy conformations of poly(dA).poly(dT) and of the poly(dA).poly(dT) "complex" with the spine of hydration similar to that found by Dickerson and co-workers (Kopka, M.L., Fratini, A.V., Drew, H.R. and Dickerson, R.E. (1983) J. Mol. Biol. 163, 129-146) in the minor groove of the CGCGAATTCGCG crystals are described. It is shown that the existence of such a spine in the minor groove of poly(dA).poly(dT) is energetically favourable. Moreover, the spine of hydration makes the polynucleotide conformation similar to the poly(dA).poly(dT) structure in fibers and to the conformation of the central part of CGCGAATTCGCG in crystals; it also acquires features characteristic of the structure of poly(dA).poly(dT) and DNA oligo(dA)-tracts in solution. It is shown that the existence of the TpA step in conformations characteristic of the poly(dA).poly(dT) complex with the spine of hydration is energetically unfavourable (in contrast to the ApT step) and therefore this step should result in destabilization of the spine of hydration in the DNA minor groove. Thus, it appears that the spine of hydration as described by Dickerson and co-workers is unlikely to exist in the poly d(A-T).poly d(A-T) structure. The data obtained permit us to interpret a large body of experimental facts concerning the unusual structure and properties of poly(dA).poly(dT) and oligo(dA)-tracts in DNA both in fibers and in solution. The results provide evidence of the existence of the minor groove spine of hydration both in fibers and in solution on A/T tracts of DNA which do not contain the TpA step. The spine plays an active role in the formation of the anomalous conformation of these tracts.

Base Sequence↗
PubMed1990

Probing of unusual DNA structures in topologically constrained form V DNA: use of restriction enzymes as structural probe.

The ability of DNA sequences to adopt unusual structures under the superhelical torsional stress has been studied. Sequences that are forced to adopt unusual conformation in topologically constrained pBR322 form V DNA (Lk = 0) were mapped using restriction enzymes as probes. Restriction enzymes such as BamHI, PstI, AvaI and HindIII could not cleave their recognition sequences. The removal of topological constraint relieved this inhibition. The influence of neighbouring sequences on the ability of a given sequence to adopt unusual DNA structure, presumably left handed Z conformation, was studied through single hit analysis. Using multiple cut restriction enzymes such as NarI and FspI, it could be shown that under identical topological strain, the extent of structural alteration is greatly influenced by the neighbouring sequences. In the light of the variety of sequences and locations that could be mapped to adopt non-B conformation in pBR322 form V DNA, restriction enzymes appear as potential structural probes for natural DNA sequences.

Base Sequence↗
PubMed1991

Structural and kinetic aspects of chemical reactions in DNA duplexes. Information on DNA local structure obtained from chemical ligation data.

Chemical ligation of oligonucleotides in double-stranded helices has been considered in its structural-kinetic aspect. A study was made of (i) two series of DNA duplexes with various arrangements of reacting groups in the ligation junction induced by mispairing or by alteration of furanose structure (the replacement of dT unit with rU, aU, IU, xU, dxT ones) and of (ii) eight synthetic water-soluble carbodiimides with different substituents at N1 and N3 atoms. We assumed that some information on the local structure of modified sites in the duplex can be obtained from kinetic parameters of oligonucleotide coupling reaction. The ratio of kinetic constants k3/(k2 + k3) for productive and nonproductive decomposition of the activated phosphomonoester derivative apparently reflects the reaction site structure: for a given duplex this parameter is virtually independent of the condensing agent composition. Based on the analysis of the chemical ligation kinetics a suggestion has been made about the conformation of some modified units in the double helix.

Autoradiography↗
PubMed1992

The molecular structure of a 4'-epiadriamycin complex with d(TGATCA) at 1.7A resolution: comparison with the structure of 4'-epiadriamycin d(TGTACA) and d(CGATCG) complexes.

The structure of the complex between d(TGATCA) and the anthracycline 4'-epiadriamycin has been determined by crystallographic methods. The crystals are tetragonal, space group P4(1)2(1)2 with unit cell dimensions of a = 28.01, c = 52.95A. The asymmetric unit consists of one strand of hexanucleotide, one molecule of 4'-epiadriamycin and 34 waters. The R-factor is 20.2% for 1694 reflections with F greater than or equal to 2 sigma F to 1.7A. Two asymmetric units associate to generate a duplex complexed with two drug molecules at the d(TpG) steps of the duplex. The chromophore intercalates between these base pairs with the anthracycline amino-sugar positioned in the minor groove. The double helix is a distorted B-DNA type structure. Our structure determination of d(TGATCA) complexed to 4'-epiadriamycin allows for comparison with the previously reported structures of 4'-epiadriamycin bound to d(TGTACA) and to d(CGATCG). The three complexes are similar in gross features and the intercalation geometry is the same irrespective of whether a d(CpG) or d(TpG) sequence is involved. However, the orientation of the amino-sugar displays a dependence on the sequence adjacent to the intercalation site. The flexibility of this amino-sugar may help explain why this class of antibiotics displays a relative insensitivity to base sequence when they bind to DNA.

Epirubicin↗
PubMed1996

Sequence and structure determinants of Drosophila Hsp70 mRNA translation: 5'UTR secondary structure specifically inhibits heat shock protein mRNA translation.

Preferential translation of Drosophila heat shock protein 70 (Hsp70) mRNA requires only the 5'-untranslated region (5'-UTR). The sequence of this region suggests that it has relatively little secondary structure, which may facilitate efficient protein synthesis initiation. To determine whether minimal 5'-UTR secondary structure is required for preferential translation during heat shock, the effect of introducing stem-loops into the Hsp70 mRNA 5'-UTR was measured. Stem-loops of -11 kcal/mol abolished translation during heat shock, but did not reduce translation in non-heat shocked cells. A -22 kcal/mol stem-loop was required to comparably inhibit translation during growth at normal temperatures. To investigate whether specific sequence elements are also required for efficient preferential translation, deletion and mutation analyses were conducted in a truncated Hsp70 5'-UTR containing only the cap-proximal and AUG-proximal segments. Linker-scanner mutations in the cap-proximal segment (+1 to +37) did not impair translation. Re-ordering the segments reduced mRNA translational efficiency by 50%. Deleting the AUG-proximal segment severely inhibited translation. A 5-extension of the full-length leader specifically impaired heat shock translation. These results indicate that heat shock reduces the capacity to unwind 5-UTR secondary structure, allowing only mRNAs with minimal 5'-UTR secondary structure to be efficiently translated. A function for specific sequences is also suggested.

Animals↗
PubMed2000

PCR hot start using primers with the structure of molecular beacons (hairpin-like structure).

A new technique of PCR hot start using oligonucleotide primers with a stem-loop structure is developed here. The molecular beacon oligonucleotide structure without any chromophore addition to the ends was used. The 3'-end sequence of the primers was complementary to the target and five or six nucleotides complementary to the 3'-end were added to the 5'-end. During preparation of the reaction mixture and initial heating, the oligonucleotide has a stem-loop structure and cannot serve as an effective primer for DNA polymerase. After heating to the annealing temperature it acquires a linear structure and primer extension can begin.

Base Pairing↗
PubMed1981

Primary and secondary structures of Escherichia coli MRE 600 23S ribosomal RNA. Comparison with models of secondary structure for maize chloroplast 23S rRNA and for large portions of mouse and human 16S mitochondrial rRNAs.

We determined 90% of the primary structure of E.coli MRE 600 23S rRNA by applying the sequencing gel technique to products of T1, S1, A and Naja oxiana nuclease digestion. Eight cistron heterogeneities were detected, as well as 16 differences with the published sequence of a 23S rRNA gene of an E.coli K12 strain. The positions of 13 post-transcriptionally modified nucleotides and of single-stranded, double-stranded and subunit surface regions of E.coli 23S rRNA were identified. Using these experimental results and by comparing the sequences of E.coli 23S rRNA, maize chloro. 23S rRNA and mouse and human mit 16S rRNAs, we built models of secondary structure for the two 23S rRNAs and for large portions of the two mit rRNAs. The structures proposed for maize chloroplast and E.coli 23S rRNAs are very similar, consisting of 7 domains closed by long-range base-pairings. In the mitochondrial 16S rRNAs, 3 of these domains are strongly reduced in size and have a very different primary structure compared to those of the 23S rRNAs. These domains were previously found to constitute a compact area in the E.coli 50S subunits. The conserved domains do not belong to this area and contain almost all the modified nucleotides. The most highly conserved domain, 2042-2625, is probably part of the ribosomal A site. Finally, our study strongly suggests that in cytoplasmic ribosomes the 3'-end of 5.8S rRNA is basepaired with the 5'-end of 26S rRNA. This confirms the idea that 5.8S RNA is the counterpart of the 5'-terminal region of prokaryotic 23S rRNA.

Animals↗