Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “PYROPHOSPHATES”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,333 records · Page 74Linked to original sources
PubMed1975

Calcium pyrophosphate-induced pleurisy in rats: a new model of acute inflammation.

A model is described of acute inflammation in the pleural cavity of rats using calcium pyrophosphate as the irritant. This model would seem to simulate the pseudogout syndrome. It has been shown to be acute in onset, dominated by polymorphonuclear cells, complement independent. The advantage of the model is that volume of exudate, numbers and types of cells may be quantitated. Prostaglandins and cyclic AMP have been measured in the migrating cells. The significance of these findings has been discussed.

Animals↗
PubMed1990

Polymerization of the cyclic pyrophosphates of nucleosides and their analogues.

When 2'-deoxythymidine-3',5'-cyclic diphosphate, or the cyclic pyrophosphates of the acyclic nucleoside analogues II and IV are heated to 65-85 degrees C in the presence of imidazole, oligomers with lengths up to 20-30 are formed in excellent yield. This reaction provides a useful source of oligomers for use as templates in aqueous condensation reactions. In the absence of evidence to the contrary, we assume that the oligomers are atactic. The potential significance of this reaction in prebiotic chemistry is discussed.

Diphosphates↗
PubMed1988

Synovial fluid lactic acid in acute and chronic pyrophosphate arthropathy and in osteoarthritis.

A comparison of synovial fluid lactate levels has been made in cases of chronic pyrophosphate arthropathy (PA) with and without joint destruction, acute PA and osteoarthritis. No statistically significant difference could be observed between results of chronic PA and osteoarthritis. By contrast, synovial fluid lactate levels were significantly higher in acute PA in comparison with the two other groups. These data suggest that hypoxia is unlikely to play a role in destructive arthropathy commonly found in chronic PA.

Acute Disease↗
PubMed1991

Hypophosphataemic rickets and pyrophosphate arthropathy.

Pyrophosphate arthropathy (PA) has been reported in association with a number of diseases, usually occurring in the older age group. We report a 40-year-old female with untreated X-linked hypophosphataemic rickets who presented with PA.

Adult↗
PubMed1995

Induction of geranyl pyrophosphate pyrophosphatase activity by cholesterol-suppressive isoprenoids.

Diets supplemented (1 mmol/kg) with thymol, carvacrol, and beta-ionone significantly decreased the serum cholesterol levels of cockerels. These mevalonate-derived end products of plant secondary metabolism (isoprenoids) had no impact on two cytosolic prenyl alcohol (and ethanol) dehydrogenase activities; each treatment increased microsomal geranyl pyrophosphate pyrophosphatase activity by greater than twofold. The structural diversity of the isoprenoids which suppress cholesterol synthesis may be reconciled by their ability to increase pyrophosphatase activity, thus leading to the production of the endogenous, post-transcriptional regulator of 3-hydroxy-3-methylglutaryl coenzyme A reductase activity.

Animals↗
PubMed1988

Mevalonate 5-pyrophosphate decarboxylase in isolated villus and crypt cells of chick intestine.

Mevalonate 5-pyrophosphate decarboxylase was studied in isolated enterocytes obtained from duodenal, jejunal and ileal villi and crypts. In our assay conditions, decarboxylase activity was linear for 60 min and up to 0.3 mg of protein. The subcellular location of decarboxylase in chick enterocytes was investigated. About 94% of the total activity was recovered in the cytosol. The distribution of enzyme activity in epithelial cells also was studied. Maximal specific activity was found in cell fractions from jejunum followed by ileum and duodenum. About 80% of total activity was recovered in the villus cells, indicating an active role of these cells in cholesterogenesis. Ileal cells showed the highest cholesterol content. In all the intestinal epithelial cells assayed, free cholesterol represented about 95% of the total cholesterol.

Animals↗
PubMed1975

An ultrastructural study of the articular cartilage in calcium pyrophosphate dihydrate (CPPD) crystal deposition disease (chondrocalcinosis articularis).

An ultrastructural study of articular cartilage from five patients with calcium pyrophosphate dihydrate (CPPD) crystal deposition disease was performed. The CPPD crystals, identified by micro X-ray diffraction, were usually found in clusters, located in intercellular areas of the intermediate cartilage layer. The matrix surrounding the clusters either showed a normal morphology or a homogeneous appearance, within which faint cross striations but no distinctly fibrillar outlines could be identified. Another change in the matrix, characterized by an increased electron density and longitudinally fragmented collagen fibres, was also seen. This latter change was generally seen without concomitant CPPD crystal deposition. No specific relationship between the crystals and the collagen fibres or the granular background material of the matrix was encountered.

Adult↗
PubMed1997

Pyrophosphate and adenosine 5'-diphosphate synthesis from phospho(enol)pyruvate: catalysis by phosphate minerals and modulation by dimethyl sulfoxide.

Phospho(enol)pyruvate (PEP) undergoes transphosphorylation to form pyrophosphate (PPi) and adenosine 5'-diphosphate (5'-ADP) with high yields in the presence of an adsorbent surface of calcium phosphate (Pi.Ca), which is considered to be an ancient mineral with catalytic properties. PPi formation is a result of the phosphorolytic cleavage of the enol phosphate group of PEP by precipitated Pi. The synthesis of PPi is dependent on the amount of the solid matrix; it increases with the amount of adsorbed PEP and upon addition of dimethyl sulfoxide (Me2SO), a molecule with high dipolar moment. Although it is saturated with PEP at neutral pH, the phosphorylating Pi.Ca surface becomes effective only in alkaline conditions. In a parallel reaction, PEP phosphorylates 5'-AMP to 5'-ADP with a yield that is sevenfold higher in the presence of the Pi.Ca surface than in its absence, indicating that the solid matrix promotes interaction between adsorbed molecules with a high potential for phosphoryl transfer. In contrast to phosphorolysis, this latter reaction is stimulated by Me2SO only in homogeneous solution. It is concluded that phosphate minerals may have coadjuvated in reactions involving different phosphorylated compounds and that molecules with high dipolar moment may have acted in mildly alkaline, primitive aqueous environments to modulate phosphoryl transfer reactions catalyzed by phosphate minerals.

Adenosine Diphosphate↗
PubMed1998

The pyrophosphate-dependent phosphofructokinase of the protist, Trichomonas vaginalis, and the evolutionary relationships of protist phosphofructokinases.

The pyrophosphate-dependent phosphofructokinase (PPi-PFK) of the amitochondriate protist Trichomonas vaginalis has been purified. The enzyme is a homotetramer of about 50 kDa subunits and is not subject to allosteric regulation. The protein was fragmented and a number of peptides were sequenced. Based on this information a PCR product was obtained from T. vaginalis gDNA and used to isolate corresponding cDNA and gDNA clones. Southern analysis indicated the presence of five genes. One open reading frame (ORF) was completely sequenced and for two others the 5' half of the gene was determined. The sequences were highly similar. The complete ORF corresponded to a polypeptide of about 46 kDa. All the peptide sequences obtained were present in the derived sequences. The complete ORF was highly similar to that of other PFKs, primarily in its amino-terminal half. The T. vaginalis enzyme was most similar to PPi-PFK of the mitochondriate heterolobosean, Naegleria fowleri. Most of the residues shown or assumed to be involved in substrate binding in other PPi-PFKs were conserved in the T. vaginalis enzyme. Direct comparison and phylogenetic reconstruction revealed a significant divergence among PPi-PFKs and related enzymes, which can be assigned to at least four distantly related groups, three of which contain enzymes of protists. The separation of these groups is supported with a high percentage of bootstrap proportions. The short T. vaginalis PFK shares a most recent common ancestor with the enzyme from N. fowleri. This pair is clearly separated from a group comprising the long (>60-kDa) enzymes from Giardia lamblia, Entamoeba histolytica pfk2, the spirochaetes Borrelia burgdorferi and Trepomena pallidum, as well as the alpha- and beta-subunits of plant PPi-PFKs. The third group ("X") containing protist sequences includes the glycosomal ATP-PFK of Trypanosoma brucei, E. histolytica pfk1, and a second sequence from B. burgdorferi. The fourth group ("Y") comprises cyanobacterial and high-G + C, Gram-positive eubacterial sequences. The well-studied PPi-PFK of Propionibacterium freudenreichii is highly divergent and cannot be assigned to any of these groups. These four groups are well separated from typical ATP-PFKs, the phylogenetic analysis of which confirmed relationships established earlier. These findings indicate a complex history of a key step of glycolysis in protists with several early gene duplications and possible horizontal gene transfers.

Amino Acid Sequence↗
PubMed2001

Osteoarthritis of the scaphoidtrapezium joint: an early sign of calcium pyrophosphate dihydrate disease.

The aim of this study was to determine the value of scaphoidtrapezium osteoarthritis (ST osteoarthritis) as an early sign of calcium pyrophosphate dihydrate disease (CPDD) in a cohort of patients undergoing surgery for osteoarthritis of the first carpometacarpal joint. We examined whether patients with cartilage calcification of the wrist at the time of operation had ST osteoarthritis, indicating CPDD at an earlier time (retrospective study), and whether patients with ST osteoarthritis but without cartilage calcification at the time of surgery develop radiological or clinical signs of CPDD at a later time (prospective study). From 1 January 1989 to 31 December 1995 a total of 169 patients (from an orthopaedic clinic) with a diagnosis of osteoarthritis of the first carpometacarpal joint were included in the study; 167 underwent surgery and two were treated without. Of the 16 patients showing calcification on surgery and therefore included in the retrospective study, 12 had prior radiographs, of which eight showed ST osteoarthritis. Among these, four had no concomitant cartilage calcification in the prior radiographs. Of the 32 patients in the prospective group having ST osteoarthritis but no calcifications at the time of surgery, 27 could be clinically examined. Of these, two showed cartilage calcifications on the follow-up radiographs of the hands. The presence of ST osteoarthritis is a helpful diagnostic finding for the diagnosis of CPDD, especially in cases without radiographic cartilage or fibrocartilage calcification of the wrist. ST osteoarthritis may then point to the correct diagnosis.

Aged↗
PubMed2003

Calcium pyrophosphate dihydrate crystal deposition disease mimicking malignant soft tissue tumor.

Calcium pyrophosphate dihydrate (CPPD) crystal deposition disease has multiple clinical features with variable courses creating several pitfalls in clinical diagnosis. There are number of reported cases mimicking malignant skeletal tumors such as chondrosarcoma. However, no case of CPPD disease with radiographic noncalcified soft tissue mass has been reported in the literature. Here we report a case of CPPD disease clinically mimicking soft tissue tumor with its magnetic resonance imaging appearance and histopathology.

Aged↗
PubMed2001

Sequencing, high-level expression and phylogeny of the pyrophosphate-dependent phosphofructokinase from the thermophilic spirochete Spirochaeta thermophila.

The full-length gene encoding a 554-amino-acid, active pyrophosphate-dependent phosphofructokinase from Spirochaeta thermophila was cloned and sequenced using a combination of degenerate and inverse PCR, and the enzyme expressed to a high level in Escherichia coli. The recombinant enzyme, with a calculated molecular mass of 61 kDa, was purified to near homogeneity and found to be similar to the purified native enzyme for most properties examined. Phylogenetic analysis demonstrated a close relationship between the thermophilic S. thermophila phosphofructokinase and the large beta-subunits of the phosphofructokinases from Borrelia burgdorferi and Treponema pallidum.

Amino Acid Sequence↗
PubMed2006

Individual Vgamma2-Jgamma1.2+ T cells respond to both isopentenyl pyrophosphate and Daudi cell stimulation: generating tumor effectors with low molecular weight phosphoantigens.

Human Vgamma2Vdelta2 T cells exhibit T cell receptor-dependent, MHC-unrestricted recognition of antigen and play important roles in tumor and pathogen immunity. To characterize antigen recognition by the Vgamma2Vdelta2 TCR, we used the combined approach of spectratyping and CDR3 sequence analysis that measures changes in the TCR repertoire before and after stimulation with a phosphoantigen (isopentenyl pyrophosphate) or an irradiated tumor cell line (Daudi B lymphoma). Here we describe common Vgamma2 chains that are substantially involved in the response to both phosphoantigens and tumor cells. The recognition properties of common Vgamma2 chains explains the observation that Vgamma2Vdelta2 T cells expanded by phosphoantigen stimulation specifically recognize and kill some but not all tumor cell lines. Our studies further justify efforts to stimulate tumor immunity by administering low molecular weight phosphoantigens and boosting the frequency and tumor effector functions of circulating Vgamma2Vdelta2 T cells.

Adult↗
PubMed2003

Expression of the carG gene, encoding geranylgeranyl pyrophosphate synthase, is up-regulated by blue light in Mucor circinelloides.

A new structural gene, carG, involved in the biosynthesis of carotenoids in the fungus Mucor circinelloides was isolated by heterologous hybridisation, using a probe derived from the Gibberella fujikuroi ggs1 gene. Functional analyses in Escherichia coli showed that the encoded protein has geranylgeranyl pyrophosphate (GGPP) synthase activity. A comparison of the deduced protein with other GGPP synthases suggested that the carG gene might have evolved from other larger genes present in some fungi. The analysis of carG mRNA accumulation after blue light irradiation showed that the expression of this gene is up-regulated by blue light, as happens with the other structural genes involved in carotenogenesis in M. circinelloides. Analysis of the promoter region revealed the presence of several APE-like sequences, which participate in the blue-light regulation of the expression of different fungal genes. These sequences are also present in the above-mentioned Mucor genes and strongly support the idea that this gene plays an important role in the regulation of carotenoid synthesis, despite belonging to a more general metabolic pathway.

Alkyl and Aryl Transferases↗
PubMed2007

Identification of a 20-bp regulatory element of the Arabidopsis pyrophosphate:fructose-6-phosphate 1-phosphotransferase alpha2 gene that is essential for expression.

Arabidopsis harbors two alpha and two beta genes of pyrophosphate:fructose-6-phosphate 1-phosphotransferase (PFP). The spatial expression patterns of the two AtPFPalpha genes were analyzed using transgenic plants containing a promoter::ss-glucuronidase (GUS) fusion construct. Whereas the AtPFPalpha1 promoter was found to be ubiquitously active in all tissues, the AtPFPalpha2 promoter is preferentially expressed in specific heterotrophic regions of the Arabidopsis plant such as the trichomes of leaves, cotyledon veins, roots, and the stamen and gynoecium of the flowers. Serial deletion analysis of the AtPFPalpha2 promoter identified a key regulatory element from nucleotides -194 to -175, CGAAAAAGGTAAGGGTATAT, which we have termed PFPalpha2 and which is essential for AtPFPalpha2 gene expression. Using a GUS fusion construct driven by this 20-bp sequence in conjunction with a -46 CaMV35S minimal promoter, we also demonstrate that PFPalpha2 is sufficient for normal AtPFPalpha2 expression. Hence, this element can not only be used to isolate essential DNA-binding protein(s) that control the expression of the carbon metabolic enzyme AtPFPalpha2, but has also the potential to be utilized in the production of useful compounds in a specific organ such as the leaf trichomes.

Arabidopsis↗
PubMed1997

Calcium pyrophosphate dihydrate crystal deposition disease presenting as a pseudotumor of the temporomandibular joint.

We report a case of a 66-year-old white woman with calcium pyrophosphate dihydrate (CPPD) crystal deposition disease. The patient related a 2-month history of swelling with tenderness over the left pre-auricular region. A CT scan suggested a synovial chondromatosis. Surgical removal was done and histologic study showed CPPD crystals. This disease rarely involves the temporomandibular joint (TMJ) and is not usually considered in the differential diagnosis. To our knowledge, only 14 cases have been reported in the literature.

Aged↗
PubMed2003

[Cervical myelopathy induced by calcium pyrophosphate tophus in primary chondrocalcinosis].

A 78 year old female patient with cervical myelopathy induced by a calcium pyrophosphate dihydrate tophus around the dens axis with clinical signs of a cervical tumor is presented. After operation of the tumor, the diagnosis of a generalized CPPD disease was established retrospectively, where by patient had complained of joint pain already for many years. This known complication of a primary chondrocalcinosis should be a reason for a careful investigation of the cervical spine in CPPD disease, because neurological disturbances might increase the joint destruction in the manner of "Charcot joints".

Aged↗