Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Genetic code”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,333 records · Page 74Linked to original sources
PubMed2002

Rescue of a deficiency in ATP synthesis by transfer of MTATP6, a mitochondrial DNA-encoded gene, to the nucleus.

A T-->G transversion at nt 8993 in mitochondrial DNA of MTATP6 (encoding ATPase 6 of complex V of the respiratory chain) causes impaired mitochondrial ATP synthesis in two related mitochondrial disorders: neuropathy, ataxia and retinitis pigmentosa and maternally inherited Leigh syndrome. To overcome the biochemical defect, we expressed wildtype ATPase 6 protein allotopically from nucleus-transfected constructs encoding an amino-terminal mitochondrial targeting signal appended to a recoded ATPase 6 gene (made compatible with the universal genetic code) that also contained a carboxy-terminal FLAG epitope tag. After transfection of human cells, the precursor polypeptide was expressed, imported into and processed within mitochondria, and incorporated into complex V. Allotopic expression of stably transfected constructs in cytoplasmic hybrids (cybrids) homoplasmic with respect to the 8993T-->G mutation showed a significantly improved recovery after growth in selective medium as well as a significant increase in ATP synthesis. This is the first successful demonstration of allotopic expression of an mtDNA-encoded polypeptide in mammalian cells and could form the basis of a genetic approach to treat a number of human mitochondrial disorders.

Adenosine Triphosphatases↗
PubMed1989

The zygote: to be or not be a person.

It is no longer possible to claim that the biological characteristics of the future adult are already determined at conception. After all, a zygote may develop into a hydatidiform mole rather than into a human being. The development of an individual human person is determined by genetically and non-genetically coded molecules within the embryo, together with the influence of the maternal environment. Consequently, it is an error to regard the zygote's chromosomal (and other) DNA as sufficient to determine the uniqueness of the future individual.

Abortion, Legal↗
PubMed2006

Variation in evolutionary processes at different codon positions.

Evolutionary studies commonly model single nucleotide substitutions and assume that they occur as independent draws from a unique probability distribution across the sequence studied. This assumption is violated for protein-coding sequences, and we consider modeling approaches where codon positions (CPs) are treated as separate categories of sites because within each category the assumption is more reasonable. Such "codon-position" models have been shown to explain the evolution of codon data better than homogenous models in previous studies. This paper examines the ways in which codon-position models outperform homogeneous models and characterizes the differences in estimates of model parameters across CPs. Using the PANDIT database of multiple species DNA sequence alignments, we quantify the differences in the evolutionary processes at the 3 CPs in a systematic and comprehensive manner, characterizing previously undescribed features of protein evolution. We relate our findings to the functional constraints imposed by the genetic code, protein function, and the types of mutation that cause synonymous and nonsynonymous codon changes. The results increase our understanding of selective constraints and could be incorporated into phylogenetic analyses or gene-finding techniques in the future. The methods used are extended to an overlapping reading frame data set, and we discover that overlapping reading frames do not necessarily cause more stringent evolutionary constraints.

Base Sequence↗
PubMed1989

Site-specific DNA endonuclease and RNA maturase activities of two homologous intron-encoded proteins from yeast mitochondria.

Two introns of the mitochondrial genome 777-3A of S. cerevisiae, bl4 in cob and al4 in coxl genes, contain ORFs that can be translated into two homologous proteins. We changed the UGA, AUA, and CUN codons of these ORFs to the universal genetic code, in order to study the functions of their translated products in E. coli and in yeast, by retargeting the nuclear encoded protein into mitochondria. The p27bl4 protein has been shown to be required for the splicing of both introns bl4 and al4. The homologous p28al4 protein is highly toxic to E. coli. It can specifically cleave double-stranded DNA at a sequence representing the junction of the two fused flanking exons. We present evidence that this system is a good model for studying the role of mitochondrial intron-encoded proteins in the rearrangement of genetic information at both the RNA (RNA splicing-bl4 maturase) and DNA levels (intron transposition-al4 transposase).

Base Sequence↗
PubMed1981

Origins of translation: the hypothesis of permanently attached adaptors.

A mechanism for prebiotic translation is proposed in which primeval transfer-RNA (adaptors) are assumed to be permanently associated with messenger nucleic acid molecules. Residual 'fossil' evidences are found to be present within the base sequences of contemporary tRNAs, suggesting the existence of inter-primal-tRNA interactions necessary for the mechanism. The structure of proposed primal-tRNA is such that it can not only choose its own amino acid in the absence of aminoacyl synthetase, but can also associate nonspecifically with adjacent primal-tRNA molecules attached to the neighbouring codons. Such associations can give rise, through cooperative binding between message and adaptors to the 'static template surfaces' which can direct translation of nucleotide sequences into those of amino acids. The origins of ribosomes and contemporary genetic code are suggested by this hypothesis. Proposed structures and processes are thermodynamically compatible. The approximate date of occurrence of the proposed system is calculated, which is consistent with the period of occurrence of the earliest organism with ribosomes.

Amino Acids↗
PubMed1980

Messenger ribonucleic acid of the lipoprotein of the Escherichia coli outer membrane. I. Nucleotide sequence at the 3' terminus and sequences of oligonucleotides derived from complete digests of the mRNA.

The sequence of 92 nucleotides at the 3' end of the mRNA which codes for the lipoprotein of the outer membrane of Escherichia coli has been determined to be GCUAACCAGCGUCUGGACAACAUGGCUACUAAAUACCGCAAGUAAUAGUACCUGUGAAGUGAAAAAUGGCGCACAUUGUGCGCCAUUUUUUUOH. This sequence includes the 50 nucleotides comprising the 3' untranslated region of the mRNA and contains codons for 14 amino acids at the COOH-terminal of the lipoprotein. In addition, the nucleotide sequences of all oligonucleotides derived from complete ribonuclease T1 and ribonuclease A digestions of the lipoprotein mRNA were established. These oligonucleotides were assigned to portions of the known amino acid sequence as well as the 5' untranslated and 3' untranslated regions of the mRNA molecule. With the use of the genetic code, these oligonucleotide sequences served to establish 94% of the mRNA sequence. The lipoprotein mRNA can be deduced to be 322 nucleotides in length. All three translation termination codons (UAA, UAG, and UGA) were found in phase with the coding region of the mRNA. The region at the 3' end of the mRNA showed unusual resistance to partial degradation, and the partial fragments from this region had anomalous mobilities in two-dimensional gels, even under denaturing conditions. This indicates that there is a very stable hairpin stem-and-loop structure at the 3' end. This hairpin structure exhibits all the structural elements implicated in termination of transcription in, prokaryotes.

Base Sequence↗
PubMed2002

Coevolution of color pattern and thermoregulatory behavior in polymorphic pygmy grasshoppers Tetrix undulata.

Ectothermic organisms, such as insects and reptiles, rely on external heat sources to control body temperature and possess physiological and behavioral traits that are temperature dependent. It has therefore been hypothesised that differences in body temperature resulting from phenotypic properties, such as color pattern, may translate into selection against thermally inferior phenotypes. We tested for costs and benefits of pale versus dark coloration by comparing the behaviors (i.e., basking duration and bouts) of pygmy grasshopper (Tetrix undulata) individuals exposed to experimental situations imposing a trade-off between temperature regulation and feeding. We used pairs consisting of two full-siblings of the same sex that represented different (genetically coded) color morphs but had shared identical conditions from the time of fertilization. Our results revealed significant differences in behavioral thermoregulation between dark and pale individuals in females, but not in males. Pale females spent more time feeding than dark females, regardless of whether feeding was associated with a risk of either hypothermia or overheating. In contrast, only minor differences in behavior (if any) were evident between individuals that belonged to the same color morph but had been painted black or gray to increase and decrease their heating rates. This suggests that the behavioral differences between individuals belonging to different color morphs are genetically determined, rather than simply reflecting a response to different heating rates. To test for effects of acclimation on behaviors, we used pairs of individuals that had been reared from hatchlings to adults under controlled conditions in either low or high temperature. The thermal regime experienced during rearing had little effect on behaviors during the experiments reported above, but significantly influenced the body temperatures selected in a laboratory thermal gradient. In females (but not in males) preferred body temperature also varied among individuals born to mothers belonging to different color morphs, suggesting that a genetic correlation exists between color pattern and temperature preferences. Collectively, these findings, at least in females, are consistent with the hypothesis of multiple-trait coevolution and suggest that the different color morphs represent alternative evolutionary strategies.

Animals↗
PubMed1995

The mitochondrial DNA of the amoeboid protozoon, Acanthamoeba castellanii: complete sequence, gene content and genome organization.

In phylogenetic trees based on comparison of nuclear small subunit rRNA sequences, Acanthamoeba castellanii (an amoeboid protozoon) is positioned near the base of the radiation leading to the animals, fungi and plants. However, the specific affiliation of this protist with the major multicellular lineages of eukaryotes is currently uncertain. To further explore the evolutionary position of A. castellanii, we have determined the complete primary sequence of its mitochondrial genome. We find that the circular mtDNA (41,591 bp; 70.6% A+T) encodes two rRNAs (small subunit and large subunit), 16 tRNAs and 33 proteins (17 subunits of the respiratory chain and 16 ribosomal proteins). As well, this genome contains eight open reading frames (ORFs) larger than 60 codons and of undefined function. Two of these ORFs (orf124 and orf142) have homologs in other mtDNAs ("orf25" and "orfB", respectively), three are unique to A. castellanii mtDNA (orf83, orf115 and orf349), and three are intronic ORFs. Among notable features of A. castellanii mtDNA are the following: (1) Genes and ORFs are all encoded on the same strand and are tightly packed, with only 6.8% of the total sequence not having an evident coding function and intergenic spacer sequences ranging from only 1 to 616 bp (average 64 bp). Ten pairs of protein-coding genes overlap by up to 38 bp and two subunits of cytochrome oxidase (COX1 and COX2) are specified by a single continuous ORF. (2) Only three introns, all group I and each containing a free-standing ORF, are present; these are localized in the 3'-half of the large subunit rRNA gene. (3) The genome encodes fewer than the minimal number of tRNA species required to support mitochondrial protein synthesis, suggesting that additional tRNAs are imported from the cytosol into A. castellanii mitochondria. Of the 16 tRNAs specified by A. castellanii mtDNA (one with an 8-nucleotide anticodon loop), 13 have been shown or are predicted to undergo a novel form of RNA editing within the acceptor stem. (4) A modified genetic code is used in which UGA specifies tryptophan. (5) Repeated sequences and obvious small sequence motifs that might represent regulatory elements are absent. In overall size, gene content and organizational pattern, A. castellanii mtDNA most closely resembles the mtDNA of the chlorophycean alga Prototheca wickerhamii (55,326 bp; 74.2% A+T), but is quite different in these respects from the mtDNA of Chlamydomonas reinhardtii (15,758 bp; 54.8% A+T), another chlorophycean alga, as well from characterized animal and fungal mitochondrial genomes.(ABSTRACT TRUNCATED AT 250 WORDS)

Acanthamoeba↗
PubMed2002

Design of binary long-period fiber grating filters by the inverse-scattering method with genetic algorithm optimization.

An approach is presented to the design of binary long-period fiber grating (LPFG) filters based on the Gel'fand-Levitan-Marchenko (GLM) inverse-scattering method and genetic algorithm optimization. The nonuniform coupling strength of the binary grating can be realized by varying the local duty ratio. A coupled-mode theory combined with the Poisson sum formula for treating the binary index perturbation is developed for the application of the GLM synthesis method. Since the coupled-mode theory, which smears out the discrete coupling nature, can be regarded only as an approximation to the modeling of a binary LPFG, we use instead the transfer-matrix model to analyze the coupling behavior of a nonuniform binary LPFG. Based on the synthesized grating patterns from the GLM method, a real-coded genetic algorithm with the transfer-matrix model is used to compensate for the discrepancies resulting from use of the coupled-mode theory and to optimize the design. We exemplify the above procedure by designing a flatband LPFG filter and a high-visibility all-fiber Mach-Zehnder filter.

Journal Article↗
PubMedDate not supplied

Mitochondrial and nuclear DNA complementation in the respiratory chain function and defects.

The 16569 base pairs of the mitochondrial DNA encode with a specific genetic code 13 proteins involved in the respiratory chain complex formation. Nuclear gene products also contribute to the formation of these complexes. In the first point, the organization and expression of the mtDNA are described with the main characteristics of the enzymatic complexes as well as nuclear gene expression. New information concerned with mitochondrial DNA deletions and mutations are described particularly with respect to Kearns-Sayre Syndrome.

DNA↗
PubMed2004

Genetic algorithms with filters for optimal control problems in fed-batch bioreactors.

When using a genetic algorithm (GA) to solve optimal control problems that can arise in a fed-batch bioreactor, the most obvious direct approach is to rely on a finite dimensional discretization of the optimal control problem into a nonlinear programming problem. Usually only the control function is discretized, and the continuous control function is approximated by a series of piecewise constant functions. Even though the piecewise discretized controls that the GA produces for the optimal control problem may give good performances, the control policies often show very high activity and differ considerably from those obtained using a continuous optimization strategy. The present study introduces a few filters into a real-coded genetic algorithm as additional operators and investigates the smoothing capabilities of the filters employed. It is observed that inclusion of a filter significantly smoothens the optimal control profile and often encourages the convergence of the algorithm. The applicability of the technique is illustrated by solving two previously reported optimal control problems in fed-batch bioreactors that are known to have singular arcs.

Algorithms↗
PubMedDate not supplied

Pattern of nucleotide substitution and the extent of purifying selection in retroviruses.

The patterns of point mutation and nucleotide substitution are inferred from nucleotide differences in three coding and two noncoding regions of retroviral genomes. Evidence is presented in favor of the view that the majority of mutations accumulate at the reverse transcription stage. Purifying selection is apparently very weak at the amino acid level, and almost nonexistent between synonymous codons. The pattern of purifying selection obeys the rules previously established in vertebrates [Gojobori T, Li W-H, Graur D (1982) J Mol Evol 18:360-369]; i.e., the magnitude of purifying selection at the amino acid level is negatively correlated with Grantham's [Grantham R (1974) Science 185: 862-864] chemical distances between the amino acids interchanged. We refute Modiano et al.'s [Modiano G, Battistuzzi G, Motulsky AG (1981) Proc Natl Acad Sci USA 78:1110-1114] hypothesis, according to which the pattern of mutation is preadapted to buffer against deleterious mutations. On the contrary, the pattern of mutation reduces the level of conservativeness from that imposed on the amino acid substitution pattern by the structure of the genetic code. The extraordinarily high rate of nucleotide substitution in retroviruses in comparison with that in other organisms is apparently caused by an extremely high rate of mutation coupled with a lack of stringent purifying selection at both the codon and the amino acid levels.

Animals↗
PubMed2005

Gene disruption in Candida albicans using a synthetic, codon-optimised Cre-loxP system.

The development of the molecular toolbox for the fungal pathogen Candida albicans has been hampered by its lack of an exploitable sexual cycle, its diploid nature, and its non-canonical genetic code. We describe the adaptation of the Cre-loxP site-specific recombination system as a tool for the efficient and controlled disruption of C. albicans genes. We have validated this system by disrupting two C. albicans loci: ADE2 and MET15. Ade2 and met15 null mutants were made using loxP-flanked ARG4- and HIS1-based disruption cassettes. These markers were then resolved from the C. albicans genome using a synthetic codon-optimised cre recombinase gene, with near 100% efficiency. Finally, CIp plasmids containing the URA3, HIS1, and ARG4 markers were generated for the reintegration of markers and target genes in control strains. This system allows multiple and sequential genetic manipulations, which will facilitate the functional analysis of multigene families in C. albicans.

Base Sequence↗
PubMed1976

Isolation and identification of the messenger ribonucleic acid for a structural lipoprotein of the Escherichia coli outer membrane.

The cells of Escherichia coli strain CP 78 were labeled with [32P]orthophosphate and the total radioactive RNA was prepared from the cells. The mRNA that codes for a structural lipoprotein in the outer membrane was purified from the total RNA by three successive electrophoreses on polyacrylamide slab gels, twice at pH 8.3 and once at pH 3.5 in 7 M urea. Approximately 0.002% of the total radioactive phosphate used was incorporated into the fraction containing the most purified mRNA. The two-dimensional fingerprint of the T1 ribonuclease digest of the 32P-labeled mRNA showed that the purity of the mRNA was as high as 90%. A preliminary sequence analysis was carried out on the T1 ribonuclease oligonucleotides which had been separated by the fingerprinting procedure. By using the established amino acid sequence of the lipoprotein and the genetic code, three relatively long oligonucleotides were assigned to code for three different parts of the lipoprotein. From these data, the present RNA fraction was identified as the lipoprotein mRNA. From the analysis of the T1 ribonuclease oligonucleotides, the mRNA was estimated to be 360 +/- 10 nucleotides in length. Although the length of the mRNA was enough to code for 2 lipoprotein molecules, T1 ribonuclease digestion of the mRNA yielded only 1 mol/mol of mRNA of the individual oligonucleotides assigned to parts of the amino acid sequence of the lipoprotein. This suggests that the mRNA codes for only 1 molecule of the lipoprotein. It was also found that the mRNA has no polyadenylate sequence at the 3' end.

Base Sequence↗
PubMed1985

Conserved features of eukaryotic hsp70 genes revealed by comparison with the nucleotide sequence of human hsp70.

We have determined the nucleotide sequence of the human hsp70 gene and 5' flanking region. The hsp70 gene is transcribed as an uninterrupted primary transcript of 2440 nucleotides composed of a 5' noncoding leader sequence of 212 nucleotides, a 3' noncoding region of 242 nucleotides, and a continuous open reading frame of 1986 nucleotides that encodes a protein with predicted molecular mass of 69,800 daltons. Upstream of the 5' terminus are the canonical TATAAA box, the sequence ATTGG that corresponds in the inverted orientation to the CCAAT motif, and the dyad sequence CTGGAAT/ATTCCCG that shares homology in 12 of 14 positions with the consensus transcription regulatory sequence common to Drosophila heat shock genes. Comparison of the predicted amino acid sequences of human hsp70 with the published sequences of Drosophila hsp70 and Escherichia coli dnaK reveals that human hsp70 is 73% identical to Drosophila hsp70 and 47% identical to E. coli dnaK. Surprisingly, the nucleotide sequences of the human and Drosophila genes are 72% identical and human and E. coli genes are 50% identical, which is more highly conserved than necessary given the degeneracy of the genetic code. The lack of accumulated silent nucleotide substitutions leads us to propose that there may be additional information in the nucleotide sequence of the hsp70 gene or the corresponding mRNA that precludes the maximum divergence allowed in the silent codon positions.

Amino Acid Sequence↗
PubMed1991

Construction of interleukin-1 alpha mutants using unequal contamination of synthetic oligonucleotides.

Proteins without readily available three-dimensional structural data present a difficult problem in the exploration of structure/function relationships. Saturation mutagenesis using contaminated oligonucleotides can identify potentially interesting regions of such a protein. This technique, in which synthesized oligonucleotides contain low-level base substitutions, allows random mutations to be placed throughout a gene sequence. Using double-stranded cassettes, a region of the human interleukin-1 alpha gene has been altered using such mutagenic oligonucleotides. However, instead of contaminating both strands of the gene sequence at the same level, each strand of the insert was contaminated at a different level. Several recombinants were sequenced and the effects of the mutations on the activity of the proteins were examined. Contaminating the two oligonucleotides at different levels produced a significantly different distribution of nucleotide changes from that seen if both strands were contaminated at the same level. The observed distribution followed the average of the distributions for each of the two contamination levels. This resulted in roughly equal frequencies of 1 to 5 nucleotide changes per clone with very few clones containing the wild-type nucleotide sequence. This helped overcome the redundancy in the genetic code, resulting in a high frequency of amino acid changes, and allowed changes at every amino acid to be sampled in a small number of mutants. This procedure can allow a gene sequence to be screened rapidly by removing most wild-type sequences from analysis while making sure that there are many amino acid changes in the resultant mutants.

Amino Acid Sequence↗
PubMed1989

Isolation and characterization of mutants with deletions in dnaQ, the gene for the editing subunit of DNA polymerase III in Salmonella typhimurium.

dnaQ (mutD) encodes the editing exonuclease subunit (epsilon) of DNA polymerase III. Previously described mutations in dnaQ include dominant and recessive mutator alleles as well as leaky temperature-sensitive alleles. We describe the properties of strains bearing null mutations (deletion-substitution alleles) of this gene. Null mutants exhibited a growth defect as well as elevated spontaneous mutation. As a consequence of the poor growth of dnaQ mutants and their high mutation rate, these strains were replaced within single colonies by derivatives carrying an extragenic suppressor mutation that compensated the growth defect but apparently not the mutator effect. Sixteen independently derived suppressors mapped in the vicinity of dnaE, the gene for the polymerization subunit (alpha) of DNA polymerase III, and one suppressor that was sequenced encoded an altered alpha polypeptide. Partially purified DNA polymerase III containing this altered alpha subunit was active in polymerization assays. In addition to their dependence on a suppressor mutation affecting alpha, dnaQ mutants strictly required DNA polymerase I for viability. We argue from these data that in the absence of epsilon, DNA replication falters unless secondary mechanisms, including genetically coded alteration in the intrinsic replication capacity of alpha and increased use of DNA polymerase I, come into play. Thus, epsilon plays a role in DNA replication distinct from its known role in controlling spontaneous mutation frequency.

Cloning, Molecular↗
PubMed1987

The developmental field concept in pediatric pathology--especially with respect to fibular a/hypoplasia and the DiGeorge anomaly.

Identical anomalies produced by different causes such as aneuploidy, gene mutation, teratogenic chemicals, and certain surgical procedures are a clear indication that embryonic primordia respond as units in the production of developmental anomalies of anatomic structure. Hence, they must also act as units during normal ontogeny. The presence of identical malformations in different mammalian species identifies developmental and anatomic homology by virtue of descent from a common ancestor. These dys- and orthomorphogenetically reactive units are the equivalents of the classic experimental embryologist's epimorphic fields, which are those units of the embryo in which the development of complex structures appropriate to the species is determined and controlled in a spatially coordinated, temporarily synchronous, and epimorphically hierarchical manner that expresses both species-nonspecific (that is, phylogenetic) and species-specific genetically coded developmental information. Thus, it is as important for pathologists as it is for clinical geneticists to steep themselves in the art and science of phenotype analysis and to be able to do all of those studies, including anthropometry, dermatoglyphics, and growth analysis, that are required to arrive at inferences of cause and pathogenesis from the phenotype. There is probably one other incentive besides the ethical and intellectual ones to do this and to do it as well as possible, namely, the medico-legal consequences. If pathologists fail to illuminate the causal genesis of a given case to aid in preventing recurrence, then, in short order, they might be held equally as liable as clinicians for missing high recurrence risk genetic diagnoses. These depressing considerations aside, it is important to close on a positive note. As at the outset, we want to emphasize once more that, without question, this is the most exciting time to be working in the field of developmental pathology. In this specialty a marriage is occurring of several types of investigational methods, ranging from humble morphologic studies to metabolic analysis to the most sophisticated designs of molecular biology, to produce new interdisciplinary approaches to the solution of the oldest intellectual problem confronting medicine--how does the "fabric of the human body" (in the immortal words of Vesalius) come about?(ABSTRACT TRUNCATED AT 250 WORDS)

Aneuploidy↗