Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Virus Integration”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,315 records · Page 73Linked to original sources
PubMed2001

Molecular genetics and target site specificity of retroviral integration.

Integration is an essential step in the life cycle of retroviruses, resulting in the stable joining of the viral cDNA to the host cell chromosomes. While this critical process makes retroviruses an attractive vector for gene delivery, it also presents a potential hazard. The sites where integration occurs are nonspecific. Therefore,it is possible that integration of retroviral DNA will affect host gene expression and disrupt normal cellular functions. The mechanism by which integration sites are chosen is not well understood, and is influenced by several factors, including DNA sequence and structure, DNA-binding proteins, DNA methylation, and transcription. Integrase, the viral enzyme responsible for catalyzing integration, also plays a key role in controlling the choice of target sites. The integrase domain responsible for target site selection has been mapped to the central core region. A better understanding of the interaction between the target-specifying motif of integrase and the target DNA may allow a means to manipulate integration into particular chromosomal sites. Another approach to directing integration is to fuse integrase with a sequence-specific DNA-binding protein, which results in a bias of integration in vitro into the recognition site of the fusion partner. Successful incorporation of the fusion protein into infectious virions and the identification of optimal proteins that can be fused to integrase will advance the development of site-specific vectors. Retroviruses are promising for the delivery of genes in experimental and therapeutic protocols. A better understanding of integration will aid in the design of safer and more effective gene transfer vectors.

DNA, Viral↗
PubMed2000

A repetitive DNA sequence that characterizes human papillomavirus integration site into the human genome is present in vulvar vestibulitis.

OBJECTIVE: To determine the DNA sequence of polymerase chain reaction (PCR) products obtained from surgical specimens of patients with severe vulvar vestibulitis, in order to identify and type the human papillomavirus (HPV)-DNA associated with vulvar vestibulitis. STUDY DESIGN: Fifty three women, referred for dyspareunia and diagnosed as having severe vestibulitis, underwent perineoplasty operation consisting of surgical removal of the sensitive vestibule. PCR analysis using L1 HPV primer was performed, and DNA sequencing of the samples that were found to contain HPV-DNA was undertaken, using the dideoxy chain termination method. RESULTS: Using PCR, HPV-DNA was detected in 31 of 53 tissue specimens (58%). DNA sequencing of 12 HPV-positive PCR products revealed extensive homology to human Alu consensus sequence, albeit not to any known HPV sequence. CONCLUSIONS: The presence of interspersed, repetitive-DNA sequence Alu, which is known to be the preferred site for HPV integration into human genome, in the PCR product reinforces previous observations, suggesting that HPV may have a role in the pathogenesis of vulvar vestibulitis. It further implies a possible integration of the HPV into human DNA in these cases.

Adolescent↗
PubMed1996

Integration of SV40 at 12q23 in SV40-immortalized human bronchial epithelial cells.

In four SV40-immortalized human bronchial epithelia] cell lines established in our laboratory, we identified the SV40 integration sites by fluorescence in situ hybridization. We found that in the late passage of all the four cell lines, SV40 integrated at 12q23. It is possible that only SV40 integration at 12q23 is necessary for the immortalization of human bronchial epithelial cells. Some DNA sequences or genes in the region, such as IGF-1, may be involved with a proliferative advantage of the cells with 12q23 SV40 integration.

Bronchi↗
PubMed1997

Detection and characterization of human papillomavirus type 45 DNA in the cervical carcinoma cell line MS751.

The cervical carcinoma-derived cell line MS751 was examined for human papillomavirus (HPV) DNA and RNA. A genomic fragment containing both viral and cellular sequences was cloned. Sequence analysis showed that MS751 cells contain a partially deleted HPV-45 genome integrated at a single chromosomal site. HPV sequences from the E6-E7 region are expressed as poly(A)+ RNA.

Base Sequence↗
PubMed2006

Whole genome sequencing of a novel temperate bacteriophage of P. aeruginosa: evidence of tRNA gene mediating integration of the phage genome into the host bacterial chromosome.

Whole genome sequencing of a novel Pseudomonas aeruginosa temperate bacteriophage PaP3 has been completed. The genome contains 45 503 bp with GC content of 52.1%, without more than 100 bp sequence hitting homologue in all sequenced phage genomes. A total of 256 open reading frames (ORFs) are found in the genome, and 71 ORFs are predicated as coding sequence (CDS). All 71 CDS are divided into the two opposite direction groups, and both groups meet at the bidirectional terminator site locating the near middle of the genome. The genome is dsDNA with 5'-protruded cohesive ends and cohesive sequence is 'GCCGGCCCCTTTCCGCGTTA' (20 mer). There are four tRNA genes (tRNA(Asn), tRNA(Asp), tRNA(Tyr) and tRNA(Pro)) clustering at the 5'-terminal of the genome. Analysis of integration site of PaP3 in the host bacterial genome confirmed that the core sequence of (GGTCGTAGGTTCGAATCCTAC-21mer) locates at tRNA(Pro) gene within the attP region and at tRNA(Lys) gene in the attB region. The results indicated that 3'-end of tRNA(Pro) gene of the PaP3 genome is involved in the integration reaction and 5'-end of tRNA(Lys) gene of host bacteria genome is hot spot of the integration.

Chromosomes, Bacterial↗
PubMed2003

Nucleotide sequence of the integration site of the temperate bacteriophage 6220, which carries the Shiga toxin gene stx(1ox3).

The integration site, attR, of the Shiga toxin-encoding phage 6220 (stx(1ox3)) has been determined. The phage integrates into the chromosome of its Escherichia coli host strain, CB6220, within a gene that is homologous to gene Z2577 and encodes an oxidoreductase. This new integration site was found in different Stx1ox3-producing enterohemorrhagic E. coli strains, which were analyzed by PCR.

Base Sequence↗
PubMed1983

Flat revertants of temperature-insensitive transformants induced by simian virus 40 tsA mutants lose their ability to express T-antigen.

Temperature-insensitive transformants that contained simian virus 40 sequences at only one or a few sites in the rat chromosome and that were induced by a temperature-sensitive A gene mutant of simian virus 40 were used to select flat revertants (revertants that had lost the transformed phenotype). The isolation was performed at the nonpermissive temperature so as not to select against temperature-sensitive transformants. Nonetheless, all of the revertants examined had lost their ability to express the T-antigen at both temperatures, and all contained rearrangements of the integrated simian virus 40 sequences. These results are most compatible with the hypothesis that the T-antigen of simian virus 40 is required for the maintenance of the transformed state even in temperature-insensitive cell lines.

Animals↗
PubMed2003

Illegitimate DNA integration in mammalian cells.

Foreign DNA integration is one of the most widely exploited cellular processes in molecular biology. Its technical use permits us to alter a cellular genome by incorporating a fragment of foreign DNA into the chromosomal DNA. This process employs the cell's own endogenous DNA modification and repair machinery. Two main classes of integration mechanisms exist: those that draw on sequence similarity between the foreign and genomic sequences to carry out homology-directed modifications, and the nonhomologous or 'illegitimate' insertion of foreign DNA into the genome. Gene therapy procedures can result in illegitimate integration of introduced sequences and thus pose a risk of unforeseeable genomic alterations. The choice of insertion site, the degree to which the foreign DNA and endogenous locus are modified before or during integration, and the resulting impact on structure, expression, and stability of the genome are all factors of illegitimate DNA integration that must be considered, in particular when designing genetic therapies.

Animals↗
PubMed1994

Characterization of the lactococcal temperate phage TP901-1 and its site-specific integration.

The temperate lactococcal phage TP901-1, induced by UV light from Lactococcus lactis subsp. cremoris 901-1, was characterized. The restriction map was found to be circular, and the packaging of TP901-1 DNA was concluded to occur by a headful mechanism. The pac region was localized on the 38.4-kb phage genome. TP901-1 belongs to the class of P335 phages (V. Braun, S. Hertwig, H. Neve, A. Geis, and M. Teuber, J. Gen. Microbiol. 135:2551-2560, 1989). Evidence is presented that the phages TP936-1 (V. Braun, S. Hertwig, H. Neve, A. Geis, and M. Teuber, J. Gen. Microbiol. 135:2551-2560, 1989) and C3-T1 (A. W. Jarvis, V. R. Parker, and M. B. Bianchin, Can. J. Microbiol. 38:398-404, 1992) are very closely related to or are identical to TP901-1. The lytically propagated TP901-1 phages were able to lysogenize both indicator strains Lactococcus cremoris 3107 and Wg2. Lysogenization resulted in site-specific integration of the phage genome into the bacterial chromosome. Only one chromosomal attB site was found in 20 independent lysogens. The attP region of TP901-1 and the attL and attR regions were cloned and sequenced. The results showed a core region of only 5 bp, in which the recombination occurs, followed after a 1-bp mismatch by a 7-bp identical region, TCAAT(T/C)AAGGTAA. This result was further verified by sequencing of the attB region obtained by PCR. An integration vector was constructed with the 6.5-kb EcoRI fragment from TP901-1 containing attP. This vector also functions in the plasmid-free strains, MG1363 and LM0230 with only one specific attB site, strongly indicating a more general use of the TP901-1-based integration vector in lactococci.

Bacteriophages↗
PubMed1999

Site-specific recombination of temperate Myxococcus xanthus phage Mx8: regulation of integrase activity by reversible, covalent modification.

Temperate Myxococcus xanthus phage Mx8 integrates into the attB locus of the M. xanthus genome. The phage attachment site, attP, is required in cis for integration and lies within the int (integrase) coding sequence. Site-specific integration of Mx8 alters the 3' end of int to generate the modified intX gene, which encodes a less active form of integrase with a different C terminus. The phage-encoded (Int) form of integrase promotes attP x attB recombination more efficiently than attR x attB, attL x attB, or attB x attB recombination. The attP and attB sites share a common core. Sequences flanking both sides of the attP core within the int gene are necessary for attP function. This information shows that the directionality of the integration reaction depends on arm sequences flanking both sides of the attP core. Expression of the uoi gene immediately upstream of int inhibits integrative (attP x attB) recombination, supporting the idea that uoi encodes the Mx8 excisionase. Integrase catalyzes a reaction that alters the primary sequence of its gene; the change in the primary amino acid sequence of Mx8 integrase resulting from the reaction that it catalyzes is a novel mechanism by which the reversible, covalent modification of an enzyme is used to regulate its specific activity. The lower specific activity of the prophage-encoded IntX integrase acts to limit excisive site-specific recombination in lysogens carrying a single Mx8 prophage, which are less immune to superinfection than lysogens carrying multiple, tandem prophages. Thus, this mechanism serves to regulate Mx8 site-specific recombination and superinfection immunity coordinately and thereby to preserve the integrity of the lysogenic state.

Bacteriophages↗
PubMed2004

Sugarcane bacilliform virus encapsidates genome concatamers and does not appear to integrate into the Saccharum officinarum genome.

Sugarcane bacilliform virus (SCBV) DNA molecules larger than the complete genome length of 7.6 kbp were detected in infected plants and in virions. We have confirmed that these high molecular weight nucleic acids were open circular DNA and viral in origin. Due to their open circular conformation, accurate size determination of the DNA molecules was not possible using conventional electrophoresis. Using field inversion gel electrophoresis (FIGE), however, the DNA appeared to increase in genome size increments, with sizes ranging from 1 to 4 genomes (31 kbp) detected. The DNA was packaged into virions, which may explain the observation of purified virions with lengths corresponding to one, two or three times the modal length of 130 nm. The DNA products were possibly concatamers formed during replication as a result of a terminal overlap on the sense strand, and were shown to be overlapped individual genome-length molecules and not covalently-bonded continuous DNA strands. Southern analysis indicated that SCBV sequences are not integrated into the sugarcane genome and that the high molecular weight DNA observed in the sugarcane accessions analysed represents SCBV concatamers.

Badnavirus↗
PubMed2006

Effect of DNA repair protein Rad18 on viral infection.

Host factors belonging to the DNA repair machineries are assumed to aid retroviruses in the obligatory step of integration. Here we describe the effect of DNA repair molecule Rad18, a component of the post-replication repair pathway, on viral infection. Contrary to our expectations, cells lacking Rad18 were consistently more permissive to viral transduction as compared to Rad18(+/+) controls. Remarkably, such susceptibility was integration independent, since retroviruses devoid of integration activity also showed enhancement of the initial steps of infection. Moreover, the elevated sensitivity of the Rad18(-/-) cells was also observed with adenovirus. These data indicate that Rad18 suppresses viral infection in a non-specific fashion, probably by targeting incoming DNA. Furthermore, considering data published recently, it appears that the interactions between DNA repair components with incoming viruses, often result in inhibition of the infection rather than cooperation toward its establishment.

Adenoviridae Infections↗
PubMed1992

Viral integration and fragile sites in human papillomavirus-immortalized human keratinocyte cell lines.

Human papillomavirus (HPV) types 16 and 18 integration sites were mapped in six HPV-immortalized human keratinocyte cell lines by fluorescence in situ hybridization (FISH). Mapping of HPV sequences in these cell lines revealed that HPV integration varied in copy number and location but that integration sites were stable over extended passages in culture. Integration occurred at different sites throughout the genome and did not correspond to the location of specific cellular genes. However, integration sites were consistent with integration near or within known fragile sites in five of the six cell lines. Induction of aphidicolin-sensitive fragile sites in one cell line prior to in situ hybridization revealed that integrated HPV DNA was disrupted by fragile-site expression, suggesting that integration occurred within a fragile site.

Cell Line, Transformed↗
PubMed2005

Redefining the common insertion site.

Retroviral mutagenesis has been used as a powerful tool to discover genes involved in oncogenesis through a technique called Common Insertion Site (CIS) analysis where tumors are induced by proviral integrations and the genomic loci of the proviruses are identified. A fundamental assumption made in this analysis is that multiple proviral insertions in close proximity occurring more frequently than would be predicted randomly provides evidence that the genes near the integrations are involved in the formation of the tumors. We demonstrate here using data derived from MLV integrations not put under selection for tumor induction that CIS analysis as currently defined is often not a sufficient argument for a gene's significance in tumorigenesis.

Gene Expression Regulation↗
PubMed2005

A role for LEDGF/p75 in targeting HIV DNA integration.

HIV DNA integration is favored in active genes, but the underlying mechanism is unclear. Cellular lens epithelium-derived growth factor (LEDGF/p75) binds both chromosomal DNA and HIV integrase, and might therefore direct integration by a tethering interaction. We analyzed HIV integration in cells depleted for LEDGF/p75, and found that integration was (i) less frequent in transcription units, (ii) less frequent in genes regulated by LEDGF/p75 and (iii) more frequent in GC-rich DNA. LEDGF is thus the first example of a cellular protein controlling the location of HIV integration in human cells.

Adaptor Proteins, Signal Transducing↗
PubMed2005

Genome-wide analysis of retroviral DNA integration.

Retroviral vectors are often used to introduce therapeutic sequences into patients' cells. In recent years, gene therapy with retroviral vectors has had impressive therapeutic successes, but has also resulted in three cases of leukaemia caused by insertional mutagenesis, which has focused attention on the molecular determinants of retroviral-integration target-site selection. Here, we review retroviral DNA integration, with emphasis on recent genome-wide studies of targeting and on the status of efforts to modulate target-site selection.

Animals↗
PubMed2001

Chromosomal integration pattern of a helper-dependent minimal adenovirus vector with a selectable marker inserted into a 27.4-kilobase genomic stuffer.

Helper-dependent minimal adenovirus vectors are promising tools for gene transfer and therapy because of their high capacity and the absence of immunostimulatory or cytotoxic viral genes. In order to characterize this new vector system with respect to its integrative properties, the integration pattern of a minimal adenovirus vector with a neo(r) gene inserted centrally into a noncoding 27.4-kb genomic stuffer element derived from the human X chromosome after infection of a sex chromosome aneuploid (X0) human glioblastoma cell line was studied. Our results indicate that even extensive homologies and abundant chromosomal repeat elements present in the vector did not lead to integration of the vector via homologous or homology-mediated mechanisms. Instead, integration occurred primarily by insertion of a monomer with no or little loss of sequences at the vector ends, apparently at random sites, which is very similar to E1 deletion adenovirus vectors. It is therefore unlikely that the incorporation of stuffer elements derived from human genomic DNA, which were shown to allow long-term transgene expression in vivo in a number of studies, leads to an enhanced risk of insertional mutagenesis. Furthermore, our findings indicate that the potential of minimal adenovirus vectors as tools for targeted insertion and gene targeting is limited despite the possibility of incorporating long stretches of homologous sequences. However, we found an enhanced efficiency of stable neo(r) transduction of the minimal adenovirus vector compared to an E1 deletion adenovirus vector, possibly caused by the absence of potential growth-inhibitory viral genes. Complete integration of the vector and tolerance of the integrated vector sequences by the cell might indicate a potential use of these vectors as tools for stable transfer of (large) genes.

Adenoviruses, Human↗
PubMed2004

Systematic review of genomic integration sites of human papillomavirus genomes in epithelial dysplasia and invasive cancer of the female lower genital tract.

Cancers of the anogenital tract as well as some head and neck cancers are caused by persistent infections with high-risk type human papillomaviruses (HPVs). Two viral oncogenes, E6 and E7, induce severe chromosomal instability associated with centrosome aberrations, anaphase bridges, chromosome lagging, and breaking. This occurs early in preneoplastic lesions, when the viral genome still persists in an episomal state. In most invasive cancers and also in a few high-grade dysplastic lesions, however, integration of high-risk HPV genomes into the host genome is observed. Integration seems to be a direct consequence of chromosomal instability and an important molecular event in the progression of preneoplastic lesions. Disruption or deregulation of defined critical cellular gene functions by insertional mutagenesis by integrated HPV genome fragments has been hypothesized as one major promoting factor in the pathogenesis of HPV-associated cancers. This hypothesis was based on the detection of HPV integration events in the area of tumor-relevant genes in few cases. Here, we reviewed >190 reported integration loci with respect to changes in the viral structure and the targeted genomic locus. This analysis confirms that HPV integration sites are randomly distributed over the whole genome with a clear predilection for genomic fragile sites. No evidence for targeted disruption or functional alteration of critical cellular genes by the integrated viral sequences could be found.

Cell Transformation, Viral↗