Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “RIBONUCLEIC ACID”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,315 records · Page 73Linked to original sources
PubMed1989

Expression of substance P/neurokinin A-encoding preprotachykinin messenger ribonucleic acids in the rat enteric nervous system.

The cellular localization of substance P/neurokinin A-encoding preprotachykinin mRNAs in the rat enteric nervous system was studied by means of in situ hybridization histochemistry using 35S- or 3H-labeled single-stranded ribonucleic acid (RNA) probes which recognize all three preprotachykinin mRNA species, alpha, beta, and gamma. Substance P/neurokinin A-encoding mRNAs are expressed in neurons within the myenteric plexus of the esophagus and stomach, being more numerous in the latter, and in ganglion cells distributed to both the myenteric and submucosal plexuses of the intestine. Specificity of the hybridization was demonstrated by the lack of specific signal above background in sections incubated with a sense RNA probe or pretreated with ribonuclease A before hybridization. Ribonucleic acid blot hybridization analysis of RNA extracts from both the muscle layer-myenteric plexus and submucosal layer preparations of the duodenum demonstrated a single band of hybridization at 1.3 kb. Solution hybridization-nuclease protection assays showed multiple preprotachykinin-encoding transcripts in these RNA extracts, with an abundance level of gamma-mRNA greater than beta-mRNA much greater than alpha-mRNA, which is similar to that observed in the rat brain. Our results indicate that the preprotachykinin gene encoding the tachykinin peptides, substance P and neurokinin A, is transcribed in a population of enteric neurons that have a regional distribution comparable to the previously described tachykinin-like immunoreactive neurons, suggesting that specific mRNAs and the posttranslationally processed peptides are localized in the same structures.

Animals↗
PubMed1959

Densitygradient centrifugation with infectious ribonucleic acid of foot-and-mouth disease virus.

The sedimentation constant of an infectious component in ribonucleic acid preparations from foot-and-mouth disease virus has been determined by density-gradient centrifugation. A sedimentation constant of 37 Svedberg units (S(t)) was obtained. On the assumption that the relation between the molecular weight and the sedimentation constant found by Gierer is applicable to our system as well, a value of 3.1 x 10(6) was calculated for the molecular weight of the infectious component.

Animals↗
PubMed2026

Increased expression of Ribonucleic acid export 1 (RAE1) gene promotes gastric carcinogenesis and is associated with Hippo signaling pathway.

BACKGROUND: Ribonucleic acid export 1 (RAE1) autoantibody may have good potential for early detection of gastric cancer (GC). However, the carcinogenicity of RAE1 in GC remains unknown. We aimed to explore the role and the potential mechanism for RAE1 in the carcinogenesis of GC. METHODS: Immunohistochemical assay was applied to analyze the expression of RAE1 in GC and precancerous lesion (PL) tissues and its relationship with clinical characteristics. The effects of RAE1 on proliferation, migration, apoptosis, and cell cycle were explored by constructing RAE1 knockdown and overexpression in GC cells. The effects of RAE1 knockdown on tumor growth were observed in a murine xenograft model. The signaling pathways involved in GC development that may be affected by RAE1 were investigated by transcriptome sequencing and Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis. RESULTS: Immunohistochemical expression of RAE1 was significantly higher in early GC patients than in PL and normal tissues, and the RAE1 expression was correlated with clinical stage (P<0.001). In vitro, knockdown of RAE1 inhibited the proliferation and migration of GC cells with promoted apoptosis and arrested cell cycle in the S phase, while overexpression of RAE1 showed the opposite trend. In vivo, knockdown of RAE1 inhibited the growth of subcutaneous graft tumors in mice. Transcriptome sequencing and subsequent analysis of RAE1 knockdown cells revealed that the Hippo signaling pathway was activated by RAE1 knockdown. CONCLUSIONS: RAE1 promotes GC cells proliferation and migration and is associated with the inhibition of the Hippo signaling pathway, and may be a potential biomarker for early diagnosis and treatment of GC.

Gastric cancer (GC)↗
PubMed1962

Ribonucleic acid in "transformation" of lymphoid cells.

When incubated with "reactive" ribonucleic acid extracted from lymph nodes of rabbits immunized by skin homografts, "neutral" lymph node cells from nongrafted rabbits were apparently altered to a state of transpiantation immunity, as manifested by a positive skin reaction upon injection of these cells into the donor of the skin homografts.

Animals↗
PubMed1973

Isolation and characterization of phi80 transducing bacteriophage for a ribonucleic acid polymerase gene.

A new method for isolating specialized transducing phages is described. It was used to isolate a group of phi80 transducing phages which carry various bacterial markers from the metB region of the Escherichia coli chromosome. Some of the phages selected for transduction of the supA36 marker were also shown to carry rif, a locus known to specify the beta subunit of ribonucleic acid polymerase. Expression of the prophage rif(r) gene in lysogens was demonstrated by its ability to confer rifampin resistance on part of the cellular ribonucleic acid polymerase pool.

Chromosome Mapping↗
PubMed1981

Tn9 and IS1 inserts in a ribosomal ribonucleic acid operon of Escherichia coli are incompletely polar.

Transcription is known to be coupled to translation in many or all bacterial operons which code for proteins. In these operons, nonsense codons which prevent normal translation often result in premature termination of transcription (polarity). However, efficient transcription of ribosomal ribonucleic acid operons (rrn operons) occurs, although rrn transcripts are not translated. It therefore seemed possible that insertion sequences and transposable elements which are polar in protein-coding operons might not be polar in rrn operons. Previously, it has been shown (E. A. Morgan, Cell 21:257-265, 1980) that Tn10 is incompletely polar in the rrnX operon. Here we show that the transposon Tn9 and the insertion sequence IS1 also incompletely polar in rrnX. In normal cells expression of sequences distal to the insertions can be detected by genetic methods. In ultraviolet-irradiated cells expression of distal sequences is about 80% of that observed in uninterrupted rrnX operons. These observations provide evidence that ribonucleic acid polymerase molecules beginning at rrnX promoters can read through Tn9 and IS1 and that, at least in ultraviolet-irradiated cells, read-through is very efficient.

Bacteriophage lambda↗
PubMed1980

Comparison of the ribonucleic acid polymerases from both phases of Histoplasma capsulatum.

The three ribonucleic acid (RNA) polymerases (ribonucleoside triphosphate RNA nucleotidyltransferases, EC 2.7.7.6) of the two phases (yeast and mycelial) of the dimorphic fungus Histoplasma capsulatum have been purified and characterized. The corresponding enzymes from the two phases differ in sensitivity to alpha-amanitin, ion and salt requirements, temperature sensitivity, and subunit structure. This is the first case in which such qualitative differences in RNA polymerases have been demonstrated in two growth states of the same organism.

Amanitins↗
PubMed1975

Separation of transfer ribonucleic acid by sepharose chromatography using reverse salt gradients.

The transfer ribonucleic acids of Escherichia coli bind to unsubstituted Sepharose in the presence of high concentrations of ammonium sulfate at pH 4.5. Transfer RNA species are eluted individually from the Sepharose by a gradient from high to low concentrations of ammonium sulfate; leucine tRNA is fractionated into five isoaccepting species. The order of elution of these isoaccepting species differs from that seen with reverse phase chromatography. By means of only these two procedures, one isoaccepting species of leucine tRNA can be purified to apparent homogeneity. Isoaccepting tRNA species for 9 amino acids have been resolved. This established the general utility of this chromatographic system for the separation and purification of specific isoaccepting transfer RNAs.

Chromatography, Gel↗
PubMed1964

THE CONTENT AND RELATIVE BASE RATIOS OF RIBONUCLEIC ACID IN AMOEBA.

The amount and relative base ratios of ribonucleic acid (RNA) in the nucleus and cytoplasm of Amoeba proteus and A. dubia, and of homospecies cells obtained by nuclear transfer with A. proteus, have been determined by microelectrophoresis. In A. proteus the average amounts of RNA in the nucleus and the cytoplasm were 134. micromicrograms and 2520. micromicrograms; in A. dubia the averages for the nucleus and cytoplasm were 67. micromicrograms and 1427. micromicrograms. The relative base ratio of RNA of the nucleus is similar to that of the RNA of the cytoplasm within a species, but the two species differed in this respect. Homospecies nuclear transfer did not affect the relative base ratio or amount of RNA.

Amoeba↗
PubMed1976

Changes in transfer ribonucleic acids of Bacillus subtilis during different growth phases.

The transfer ribonucleic acids (tRNAs) of B. subtilis at different growth phases are examined for changes in the composition and the methylation of minor constituents. The composition of the tRNAs indicates about equal amounts of adenosine and uridine, and of guanosine and cytidine. About 3-4 residues are present as modified bases in the average tRNA molecule. The net composition of tRNAs appears to remain unaltered during different growth phases. In vitro methylation of tRNAs indicates lack of methyl groups in both exponentially growing cells and spores. In vivo methylation studies show tRNA methylation occurs during the stationary phase in the absence of net tRNA synthesis. Thus, both in vitro and in vivo methylation indicate that the tRNAs in exponentially growing cells do not contain their full complement of modified bases. More complete modification is noted in tRNAs from stationary cells or spores. Hence, tRNA mofifications in general are preserved with fidelity even in the dormant spore but the possibility is left open that specific modifications of selected isoacceptors of tRNAs may occur.

Bacillus subtilis↗
PubMed1980

Nucleotide sequence of Crithidia fasciculata cytosol 5S ribosomal ribonucleic acid.

The complete nucleotide sequence of the cytosol 5S ribosomal ribonucleic acid of the trypanosomatid protozoan Crithidia fasciculata has been determined by a combination of T1-oligonucleotide catalog and gel sequencing techniques. The sequence is: GAGUACGACCAUACUUGAGUGAAAACACCAUAUCCCGUCCGAUUUGUGAAGUUAAGCACC CACAGGCUUAGUUAGUACUGAGGUCAGUGAUGACUCGGGAACCCUGAGUGCCGUACUCCCOH. This 5S ribosomal RNA is unique in having GAUU in place of the GAAC or GAUC found in all other prokaryotic and eukaryotic 5S RNAs, and thought to be involved in interactions with tRNAs. Comparisons to other eukaryotic cytosol 5S ribosomal RNA sequences indicate that the four major eukaryotic kingdoms (animals, plants, fungi, and protists) are about equally remote from each other, and that the latter kingdom may be the most internally diverse.

Animals↗
PubMed1975

A rapid technique for the estimation of polynucleotide adenylyltransferase and ribonucleic Acid polymerase in plant tissues.

Nucleic acid-dependent polynucleotide adenylytransferase (EC 2.7.7.19) and ribonucleic acid polymerase (EC 2.7.7.6) have been partially purified from maize tissues (Zea mays L.) utilizing ammonium sulfate precipitation and batch diethylaminoethylcellulose chromatography. The technique is applicable to the simultaneous processing of up to eight samples of plant tissue and affords a rapid and reproducible means of assaying these two enzymes from small quantities of kernels or seedlings. The kinetic characteristics of the partially purified enzymes resemble those from more extensively purified preparations.

Journal Article↗
PubMed1976

Induction of antiviral activity in vivo and in vitro by human placenta ribonucleic acid treated with nitrous acid.

Induction of antiviral activity and interferon by human placenta ribonucleic acid deaminated with sodium nitrite (NO2-RNA) was studied in vitro and in vitro. (1) Viral multiplication in diploid cells from human kidney (HK cells) was depressed by pretreatment with NO2-RNA, but not by pre-treatment with the original placenta RNA. (2) NO2-RNA showed an interferon-inducing activity in rabbits and mice. (3) NO2-RNA sedimenting in 18 S and 28 S regions showed a higher antiviral activity than that sedimenting in 4 S region.

Adenine↗
PubMed1981

Distribution of ribonucleic acid coliphages in animals.

To determine the distribution pattern of ribonucleic acid (RNA) coliphages (classified by serological groups I through IV) in animal sources, we isolated RNA phages from (i) feces samples from domestic animals (cows, pigs, horses, and fowls), some other animals in a zoological garden, and humans, (ii) the gastrointestinal contents of cows and pigs, and (iii) sewage samples from treatment plants in slaughter houses. These samples were then analyzed serologically. The concentration of RNA phages in the first and second kinds of material was fairly low (10 to 10(3) plaque-forming units per original phage sample), whereas that in the third kind of material was fairly high (10(3) to 10(5) plaque-forming units per original phage sample). Concerning the group types of the RNA phages in the first and second kinds of material, human feces contained RNA phages of groups II and III almost equally, the gastrointestinal contents of pigs included those of groups I and II equally, and the feces or gastrointestinal contents of other mammals other than humans and pigs had those of group I exclusively. In the third type of material we found mostly group I phages with a minor fraction of group II phages. Thus, the prominent features of the distribution pattern of RNA phages are the predominance of groups III and II in humans and the predominance of group I in animals.

Animals↗
PubMed1981

Distribution of ribonucleic acid coliphages in Korea.

To determine the geographical distribution of ribonucleic acid (RNA) coliphages in Korea, we collected sewage samples from domestic drainage in densely populated urban areas in July through August, 1979. Of 132 samples, 74 (56%) contained RNA phages (106 strains). They were classified into groups I, II and III (4:47:55) by serological analysis. Based on previous data for Japan (groups II and III [3:11]) and Southeast Asia (mostly group III), the distribution pattern of RNA phages in Korea was of an intermediate type between those of Japan and Southeast Asia.

Coliphages↗
PubMed1971

Biosynthetic precursors of some modified nucleosides in the transfer ribonucleic acid of Mycoplasma mycoides var. capri.

The ribosomal and transfer ribonucleic acid (tRNA) from Mycoplasma mycoides var. capri, grown in a medium containing uridine-((14)C)-5'-triphosphate and cytidine-(5-(3)H)-5'-triphosphate, were isolated and separated. The uridine in both species of RNA was shown to contain (14)C and the cytidine to contain both (3)H and (14)C. Comparison of the labeling of 4-thiouridine and pseudouridine, obtained from an enzymatic digest of the RNA, indicates that their biosynthetic precursor is uridine, not cytidine. It is probable that ribothymidine and dihydrouridine have the same derivation.

Carbon Isotopes↗
PubMed1971

Biochemical characterization of a mutant isoleucyl-transfer ribonucleic acid synthetase from Escherichia coli K-12.

Isoleucyl-transfer ribonucleic acid (tRNA) synthetase [l-isoleucine: soluble RNA ligase (adenosine monophosphate), EC 6.1.1.5; IRS] was partially purified from Escherichia coli K-12 and from an ileS mutant that appears to be altered in IRS. The half-life of wild-type IRS, incubated at 60.5 C, is 69 min, whereas that of mutant IRS is 8 min. Mutant IRS shows about a 100-fold lower affinity than wild-type IRS for isoleucine, dl-valine, thiaisoleucine, and O-methyl-dl-threonine, both in the pyrophosphate exchange assay and in the assay of isoleucyl-tRNA formation. The affinity of the mutant enzyme for adenosine triphosphate in the assay of isoleucyl-tRNA formation is 15-fold lower than that of the wild-type enzyme. The affinity of mutant IRS for tRNA is not changed as compared with wild-type IRS. These data show that mutant IRS has an altered structure and clearly confirm that ileS is the structural gene for IRS.

Adenosine Triphosphate↗