Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Molecular Dynamic simulation”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,315 records · Page 73Linked to original sources
PubMed1992

Molecular dynamics simulations of the resting and hydrogen peroxide-bound states of cytochrome c peroxidase.

The current hypothesis for the formation of the catalytically active compound I of peroxidases from the resting state and peroxide involves formation of a reversible "inner-sphere" complex in which the peroxide is bound to the heme iron. It is this precursor that is postulated to then form compound I. However, this crucial putative transient intermediate has not yet been definitively detected or characterized by experimental methods. We report here the use of energy minimization and molecular dynamics simulation together with the known X-ray structure of cytochrome c peroxidase to investigate the nature of this complex and comparisons of it with the resting state in which a water is bound as a ligand. Among the properties monitored in these simulations are the mode of binding of the peroxide to the heme iron, its interactions with neighboring amino acid residues, and the extent to which the binding of the peroxide perturbs both the local environment around the heme unit and more distant regions. The results of this study indicate that solvated, full protein dynamics is required to obtain reliable results for the known resting-state complex and hence for the uncharacterized peroxide complex. In this complex, the peroxide binds to the heme iron in a dynamically averaged end-on fashion, rather than a bridged structure, with approximately equal probability of each oxygen serving as the ligand to the iron. Binding of the peroxide as a ligand disrupts the H-bonded network of waters in the distal binding pocket which are present in the resting state, but there is no dramatic perturbation of the nearby amino acid residues.(ABSTRACT TRUNCATED AT 250 WORDS)

Amino Acids↗
PubMed2006

Detailed mechanism for AmtB conducting NH4+/NH3: molecular dynamics simulations.

The mechanism by which the ammonium transporter, AmtB, conducts NH4+/NH3 into the cytoplasm was investigated using conventional molecular dynamics (MD) simulations. These simulations revealed that the neutral molecule, NH3, passes automatically through the channel upon its arrival at the Am2 site and that the function of the channel as a one-way valve for passage of NH3 is not determined by the cytoplasmic exit gate but, rather, by the periplasmic entrance gate of the channel. The NH3, produced by deprotonation of NH4+ at the entrance gate, is spontaneously conveyed to the central region of the channel via a hydrogen-bond network comprising His-168, His-318, Tyr-32, and the NH3 molecule. Finally, the NH3 molecule exits the channel through the exit gate formed by Phe-31, Ile-266, Val-314, and His-318. In addition, Ser-263 is shown to play a critical role in the final stages, acting as a pivoting arm to shunt the NH3 molecule from the cytoplasmic exit gate of the channel out into the cytoplasm. This finding is further supported by another simulation which shows that NH3 fails to be translocated through the channel formed by the Ser-263-Ala mutation. Thus, this study casts new insights on the mechanism of AmtB-mediated passage of NH3 across cellular membranes.

Cation Transport Proteins↗
PubMed2006

Aggregation of small peptides studied by molecular dynamics simulations.

Peptides and proteins tend to aggregate under appropriate conditions. The amyloid fibrils that are ubiquitously found among these structures are associated with major human diseases like Alzheimer's disease, type II diabetes, and various prion diseases. Lately, it has been observed that even very short peptides like tetra and pentapeptides can form ordered amyloid structures. Here, we present aggregation studies of three such small polypeptide systems, namely, the two amyloidogenic peptides DFNKF and FF, and a control (nonamyloidogenic) one, the AGAIL. The respective aggregation process is studied by all-atom Molecular Dynamics simulations, which allow to shed light on the fine details of the association and aggregation process. Our analysis suggests that naturally aggregating systems exhibit significantly diverse overall cluster shape properties and specific intermolecular interactions. Additional analysis was also performed on the previously studied NFGAIL system.

Computer Simulation↗
PubMed1997

Refinement of the NMR solution structure of the gamma-carboxyglutamic acid domain of coagulation factor IX using molecular dynamics simulation with initial Ca2+ positions determined by a genetic algorithm.

A genetic algorithm (GA) successfully identified the calcium positions in the crystal structure of bovine prothrombin fragment 1 bound with calcium ions (bf1/Ca). The same protocol was then used to determine the calcium positions in a closely related fragment, the Gla domain of coagulation factor IX, the structure of which had previously been determined by NMR spectroscopy in the presence of calcium ions. The most frequently occurring low-energy structure found by GA was used as the starting structure for a molecular dynamics refinement. The molecular dynamics simulation was performed using explicit water and the Particle-Mesh Ewald method to accommodate the long-range electrostatic forces. While the overall conformation of the NMR structure was preserved, significant refinement is apparent when comparing the simulation average structure with its NMR precursor in terms of the N-terminal (Tyr1-N) network, the total number of hydrogen bonds, the calcium ion coordinations, and the compactness of the structure. It is likely that the placement of calcium ions in the protein is critical for refinement. The calcium ions apparently induce structural changes during the course of the simulation that result in a more compact structure.

1-Carboxyglutamic Acid↗
PubMed1992

QSAR analysis of a set of benzothiopyranoindazole anti-cancer analogs based upon their DNA intercalation properties as determined by molecular dynamics simulation.

The global low-energy intercalation thermodynamic properties for a set of 14 benzothiopyranoindazole (BTPI) analogs, determined by molecular dynamics (MD) simulation, were used as descriptors in a quantitative structure-activity relationship (QSAR) analysis to describe their observed anti-cancer activities. The calculated free-space binding (intercalation) energies by themselves, or in combination with ligand lipophilicity, do not yield significant QSARs. However, the free-space binding energy combined with the aqueous desolvation energy of the intercalation complex leads to a highly significant QSAR. The optimum QSAR corresponds to both the ligand and DNA model being charged, and a molecular dielectric of 40 used in the force field. The desolvation energy is computed using a hydration-shell model. The QSAR suggests that anti-cancer activity can be enhanced by increasing the intercalating free-space binding energy and/or decreasing the loss in the favorable hydration energies of both the ligand and DNA when intercalation occurs.

Antineoplastic Agents↗
PubMed2006

Molecular dynamics simulations of human tRNA Lys,3 UUU: the role of modified bases in mRNA recognition.

Accuracy in translation of the genetic code into proteins depends upon correct tRNA-mRNA recognition in the context of the ribosome. In human tRNA(Lys,3)UUU three modified bases are present in the anticodon stem-loop--2-methylthio-N6-threonylcarbamoyladenosine at position 37 (ms2t6A37), 5-methoxycarbonylmethyl-2-thiouridine at position 34 (mcm5s2U34) and pseudouridine (psi) at position 39--two of which, ms2t6A37 and mcm5s2U34, are required to achieve wild-type binding activity of wild-type human tRNA(Lys,3)UUU [C. Yarian, M. Marszalek, E. Sochacka, A. Malkiewicz, R. Guenther, A. Miskiewicz and P. F. Agris (2000) Biochemistry, 39, 13390-13395]. Molecular dynamics simulations of nine tRNA anticodon stem-loops with different combinations of nonstandard bases were performed. The wild-type simulation exhibited a canonical anticodon stair-stepped conformation. The ms2t6 modification at position 37 is required for maintenance of this structure and reduces solvent accessibility of U36. Ms2t6A37 generally hydrogen bonds across the loop and may prevent U36 from rotating into solution. A water molecule does coordinate to psi39 most of the simulation time but weakly, as most of the residence lifetimes are <40 ps.

Adenosine↗
PubMed1992

Nuclear magnetic resonance studies and molecular dynamics simulations of the solution conformation of a 'designed', alpha-helical peptide.

The complete three-dimensional structure in methanol of an amphipathic alpha-helical peptide, that has been designed by taking into account the three-dimensional structures of small haemolytic peptides, secondary structure prediction algorithms and the well documented literature on alpha-helix stabilizing factors, has been elucidated by two-dimensional NMR spectroscopy. Initially various two-dimensional spectra (COSY, TOCSY, and NOESY) allowed the complete sequence specific assignment of all signals in the 1H spectrum. Consequently trial structures were generated which were then subjected to molecular dynamics simulations using 121 NOE-derived distances and 25 vicinal coupling constant values as structural restraints to give a final set of calculated structures. These structures are in complete agreement with the results of a circular dichroism study and reveal that the peptide adopted a highly ordered alpha-helical conformation. Details of the structure which throw light on future peptide/protein design are discussed.

Amino Acid Sequence↗
PubMed2002

Mechanical unfolding of a titin Ig domain: structure of unfolding intermediate revealed by combining AFM, molecular dynamics simulations, NMR and protein engineering.

The mechanical unfolding of an immunoglobulin domain from the human muscle protein titin (TI I27) has been shown to proceed via a metastable intermediate in which the A-strand is detached. The structure and properties of this intermediate are characterised in this study. A conservative destabilising mutation in the A-strand has no effect on the unfolding force, nor the dependence of the unfolding force on the pulling speed, indicating that the unfolding forces measured in an AFM experiment are those required for the unfolding of the intermediate and not the native state. A mutant of TI I27 with the A-strand deleted (TI I27-A) is studied by NMR and standard biophysical techniques, combined with protein engineering. Molecular dynamics simulations show TI I27-A to be a good model for the intermediate. It has a structure very similar to the native state, and is surprisingly stable. Comparison with a Phi-value analysis of the unfolding pathway clearly shows that the protein unfolds by a different pathway under an applied force than on addition of denaturant.

Computer Simulation↗
PubMed2005

Structure and IR spectrum of phenylalanyl-glycyl-glycine tripetide in the gas-phase: IR/UV experiments, ab initio quantum chemical calculations, and molecular dynamic simulations.

We investigated the potential-energy surface (PES) of the phenylalanyl-glycyl-glycine tripeptide in the gas phase by means of IR/UV double-resonance spectroscopy, and quantum chemical and statistical thermodynamic calculations. Experimentally, we observed four conformational structures and we recorded their IR spectra in the spectral region of 3000-4000 cm(-1). Computationally, we investigated the PES by a combination of molecular dynamics/quenching procedures with high-level correlated ab initio calculations. We found that neither empirical potentials nor various DFT functionals provide satisfactory results. On the other hand, the approximative DFT method covering the dispersion energy yields a reliable set of the most stable structures, which we subsequently investigated with an accurate, correlated ab initio treatment. The global minimum contains three moderately strong intramolecular hydrogen bonds and is mainly stabilized by London dispersion forces between the phenyl ring, the carboxylic acid group, and various peptide bonds. A proper description of the last type of interaction requires accurate correlated ab initio calculations, including the complete basis set limit of the MP2 method and CCSD(T) correction terms. Since in our beam experiments the conformations are frozen by cooling from a higher temperature, it is necessary to localize the most stable structures on the free-energy surface rather than on the PES. We used two different procedures (rigid rotor/harmonic oscillator/ideal gas approximation based on ab initio characteristics and evaluation of relative populations from the molecular dynamic simulations using the AMBER potential) and both yield four structures, the global minimum and three local minima. These four structures were among the 15 most energetically stable structures obtained from accurate ab initio optimization. The calculated IR spectra for these four structures agree well with the experimental frequencies, which validates the localization procedure.

Gases↗
PubMed2001

Role of salt bridges in homeodomains investigated by structural analyses and molecular dynamics simulations.

Homeodomains are a class of helix-turn-helix DNA-binding protein motifs that play an important role in the control of cellular development in eukaryotes. They fold in a three alpha-helix structural module, where the third helix is the recognition helix that fits into the major groove of DNA. Structural analysis of the members of the homeodomain family led to the identification of interactions likely to stabilize the protein domains. Linking the helices pairwise, three salt bridges were found to be well preserved within the family. Also well conserved were two cation-pi interactions between aromatic and positively charged side chains. To analyze the structural role of the salt bridges, molecular dynamics simulations (MD) were carried out on the wild-type homeodomain from the Drosophila paired protein (1fjl) and on three mutants, which lack one or two salt bridges and mimic natural mutations in other homeodomains. Analysis of the trajectories revealed only small structural rearrangements of the three helices in all MD simulations, thereby suggesting that the salt bridges have no essential stabilizing role at room temperature, but rather might be important for improving thermostability. The latter hypothesis is supported by a good correlation between the melting midpoint temperatures of several homeodomains and the number of salt bridges and cation-pi interactions that connect secondary structures.

Amino Acid Sequence↗
PubMed2004

Discriminating the helical forms of peptides by NMR and molecular dynamics simulation.

The HNCO NMR pulse sequence was applied to three selectively labeled (15)N and (13)C isotopic homologues of the peptide Ac-WAAAH(AAARA)(3)A-NH(2) to probe directly for hydrogen bonds between residues 8 and 11 (characteristic of a 3(10)-helix), 8 and 12 (alpha-helix), and 8 and 13 (pi-helix). The experiments demonstrate conclusively, and in agreement with circular dichroism studies, that the center of the peptide is alpha-helical; there is no discernible 3(10)- or pi-helix at these specific positions. Molecular dynamics simulations of the preceding peptide and Ac-(AAAAK)(3)A-NH(2) in water using the potential energy parameter set CHARMM22/CMAP correctly yield an alpha-helix, in contrast to simulations with the set CHARMM22, which result in a pi-helix.

Alanine↗
PubMed1998

Molecular dynamics simulations of an oligonucleotide duplex with adenine tracts phased by a full helix turn.

A theoretical model of a DNA oligonucleotide duplex featuring A-tracts phased by a full helix turn is developed based on molecular dynamics computer simulation. The extent to which this model agrees with relevant experimental data on axis bending and the relationship of A-tracts to bending and other aspects of helix morphology is investigated. Specifically, a series of nanosecond-level molecular dynamics (MD) simulations have been carried out for the 25 bp duplex d(ATAGGCAAAAAATAGGCAAAAATGG) at various concentrations of saline solution. A 30 base-pair sequence composed of three 10 bp repeats of the BamHI recognition sequence ligated together, d(CGGGATCCCG. CGGGATCCCG.CGGGATCCCG), was simulated as a control. The MD was carried out using the AMBER 4.1 suite of programs, and utilized the Cornell et al. force-field with the electrostatic boundary conditions treated by the particle-mesh Ewald summation protocol. The MD results show that at a concentration of 60 mM KCl, 10 mM MgCl2 added salt plus minimal neutralizing cations, the MD model exhibits concerted axis bending to the extent of 15.5 degrees per A-tract. This compares favorably with the bending per turn of 17 to 21 degrees inferred from cyclization experiments. The MD model also exhibits a progressive 5' to 3' narrowing of the minor-groove region of A-tracts, a feature inferred from DNA footprinting experiments. Analysis of the dynamic structure of the MD models shows that the origin of the bending follows a junction-type bending model with an admixture of mixed sequence effects, with A-tracts relatively straight, as in oligonucleotide crystal structures of sequences containing A-tracts. The results are shown to be sensitive to environmental conditions: MD on d(ATAGGCAAAAAATAGGCAAAAATGG) in neutralizing Na+ buffer results in markedly reduced curvature, and the removal of Mg2+ measurably affects bending. Carrying out the simulations at experimental salt conditions appears to be essential to obtain an accurate account of the experimentally observed bending.

Adenine↗
PubMed2000

Structural changes induced in p21Ras upon GAP-334 complexation as probed by ESEEM spectroscopy and molecular-dynamics simulation.

BACKGROUND: The means by which the protein GAP accelerates GTP hydrolysis, and thereby downregulates growth signaling by p21Ras, is of considerable interest, particularly inasmuch as p21 mutants are implicated in a number of human cancers. A GAP "arginine finger," identified by X-ray crystallography, has been suggested as playing the principal role in the GTP hydrolysis. Mutagenesis studies, however, have shown that the arginine can only partially account for the 10(5)-fold increase in the GAP-accelerated GTPase rate of p21. RESULTS: We report electron spin-echo envelope modulation (ESEEM) studies of GAP-334 complexed with GMPPNP bound p21 in frozen solution, together with molecular-dynamics simulations. Our results indicate that, in solution, the association of GAP-334 with GTP bound p21 induces a conformational change near the metal ion active site of p21. This change significantly reduces the distances from the amide groups of p21 glycine residues 60 and 13 to the divalent metal ion. CONCLUSIONS: The movement of glycine residues 60 and 13 upon the binding of GAP-334 in solution provides a physical basis to interpret prior mutagenesis studies, which indicated that Gly-60 and Gly-13 of p21 play important roles in the GAP-dependent GTPase reaction. Gly-60 and Gly-13 may play direct catalytic roles and stabilize the attacking water molecule and beta,gamma-bridging oxygen, respectively, in p21. The amide proton of Gly-60 could also play an indirect role in catalysis by supplying a crucial hydrogen bonding interaction that stabilizes loop L4 and therefore the position of other important catalytic residues.

Amino Acid Substitution↗
PubMed2003

Molecular dynamics simulations of the bacterial outer membrane protein FhuA: a comparative study of the ferrichrome-free and bound states.

FhuA is one of the more complex members of the superfamily of bacterial outer membrane proteins. Its primary function is to provide a binding site on the outer membrane surface for siderophores, such as ferrichrome, and subsequently to facilitate their energy-dependent transport across the membrane, presumably powered by the TonB-ExbBD protein complex that resides in the cytoplasmic membrane. Crystal structures of FhuA with and without a bound ferrichrome molecule have provided some clues as to the initial stages of the siderophore transport mechanism. In the current study, we have employed 10-ns duration molecular dynamics simulations of FhuA and of the FhuA-ferrichrome complex, both embedded in a phospholipid bilayer, to probe the short timescale dynamics of this integral membrane protein, and to explore possible mechanistic implications of this dynamic behavior. Analysis of the dynamics of the protein suggests that the extracellular loops move as relatively rigid entities relative to the transmembrane beta-barrel. Comparison of the two simulations (with and without bound ferrichrome) revealed some ligand-induced changes in loop mobility. Specifically, loop L8 appears to be involved in a mechanism whereby the binding site is gated closed upon ligand binding. Analysis of the dynamics of water molecules within the core of the FhuA protein provided no evidence for a water-permeable protopore through which the ferrichrome might pass without a major perturbation of the FhuA protein. Overall, these simulations support the proposal that binding of ferrichrome initiates a signaling mechanism that ultimately leads to the TonB-mediated partial or total removal of the core domain from the beta-barrel, thus opening up a permeable pore. These simulations are among the longest that have been performed on a complex membrane protein. However, a simple analysis of sampling reveals that the description of protein motions is far from complete.

Bacterial Outer Membrane Proteins↗
PubMed2006

Nonadiabatic molecular dynamics simulations of correlated electrons in solution. 2. A prediction for the observation of hydrated dielectrons with pump-probe spectroscopy.

The hydrated dielectron is a highly correlated, two-electron, solvent-supported state consisting of two spin-paired electrons confined to a single cavity in liquid water. Although dielectrons have been predicted to exist theoretically and have been used to explain the lack of ionic strength effect in the bimolecular reaction kinetics of hydrated electrons, they have not yet been observed directly. In this paper, we use the extensive nonadiabatic mixed quantum/classical excited-state molecular dynamics simulations from the previous paper to calculate the transient spectroscopy of hydrated dielectrons. Because our simulations use full configuration interaction (CI) to determine the ground and excited state two-electron wave functions at every instant, our nonequilibrium simulations allow us to compute the absorption, stimulated emission (SE), and bleach spectroscopic signals of both singlet and triplet dielectrons following excitation by ultraviolet light. Excited singlet dielectrons are predicted to display strong SE in the mid infrared and a transient absorption in the near-infrared. The near-infrared transient absorption of the singlet dielectron, which occurs near the peak of the (single) hydrated electron's equilibrium absorption, arises because the two electrons tend to separate in the excited state. In contrast, excitation of the hydrated electron gives a bleach signal in this wavelength region. Thus, our calculations suggest a clear pump-probe spectroscopic signature that may be used in the laboratory to distinguish hydrated singlet dielectrons from hydrated electrons: By choosing an excitation energy that is to the blue of the peak of the hydrated electron's absorption spectrum and probing near the maximum of the single electron's absorption, the single electron's transient bleach signal should shrink or even turn into a net absorption as sample conditions are varied to produce more dielectrons.

Journal Article↗
PubMed1998

Molecular dynamics simulations of HLA-DR4 (DRB1*0405) complexed with analogue peptide: conformational changes in the putative T-cell receptor binding regions.

The specific recognition of foreign peptide bound to the major histocompatibility complex (MHC) molecule by T-cell receptor (TCR) leads to T-cell activation. We found that analogue peptides containing single amino acid substitutions at the third amino acid position (p3), p5, p7 and p8 of the index peptide (YWALEAAAD) induced different response patterns of T cell clones specific for the index peptide in the context of the human MHC class II molecule HLA-DR4. Analogue peptides were classified into three types, agonists, antagonists or null peptides (non-agonistic and non-antagonistic peptides). A molecular basis for how these slight changes lead to such different consequences for T cells has not been described. To explore the mechanistic basis of these observations, molecular dynamics simulations at 300 K of 300 ps duration were carried out for the DR4-index peptide, DR4-agonist, and DR4-antagonist complexes. The simulations showed that the DR4-antagonist complexes were distinguished from the DR4-index peptide and DR4-agonist complexes by relatively higher deviations of C(alpha) atoms in proposed TCR-binding regions, suggesting that subtle changes of the exposed framework of the peptide binding groove by the antagonist peptides could induce the TCR antagonistic activities.

Amino Acid Sequence↗
PubMed2004

Molecular dynamics simulations of various coronavirus main proteinases.

In this study, two homology models (denoted as MproST and MproSH) of main proteinase (Mpro) from the novel coronavirus associated with severe acute respiratory syndrome (SARS-CoV) were constructed based on the crystal structures of Mpro from transmissible gastroenteritis coronavirus (TGEV) (MproT) and human coronavirus HcoV-229E (MproH), respectively. Both MproST and MproSH exhibit similar folds as their respective template proteins. These homology models reveal three distinct functional domains as well as an intervening loop connecting domains II and III as found in both template proteins. A catalytic cleft containing the substrate binding sites S1 and S2 between domains I and II are also observed. S2 undergoes more significant structural fluctuation than S1 during the 400 ps molecular dynamics simulations because it is located at the open mouth of the catalytic cleft, while S1 is situated in the very bottom of this cleft. The thermal unfolding of these proteins begins at domain III, where the structure is least conserved among these proteins. Mpro may still maintain its proteolytic activity while it is partially unfolded. The electrostatic interaction between Arg40 and Asp186 plays an important role in maintaining the structural integrity of both S1 and S2.

Amino Acid Sequence↗
PubMed2002

Structural analysis of the inhibition of Cdk4 and Cdk6 by p16(INK4a) through molecular dynamics simulations.

Cyclin-dependent kinases 4, 6 and 2 (Cdk4/6/2), are proteins that lead progression through the G1-S transition, a step strictly regulated in the process of cell proliferation. The p16(INK4a) tumor suppressor, whose expression is inhibited in a high number of cancers, binds to Cdk4/6 and inhibits phosphorylation of the retinoblastoma protein, forcing cells to remain in the G1 phase and therefore, arresting cell division. Accordingly, the design of small compounds mimicking the inhibition of p16(INK4a) appears to be a promising way to treat cancer. In order to get some insight into the key interactions governing recognition between different cyclin-dependent kinases and the p16(INK4a) tumor suppressor, the present work reports the results of molecular dynamics simulations of both, the Cdk6-p16(INK4a) complex and the Cdk4-p16(INK4a) complex, respectively at 300 K. Most of the key interactions observed, were already anticipated in the analysis of the crystal structure of Cdk6-p16(INK4a). However, a few different features found out from the analysis of these calculations provide a better understanding of the role of the T-loop conformation, a fragment of Cdks, and the way the ATP binding-site is distorted upon binding of p16(INK4a).

Amino Acid Sequence↗