Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Alu elements”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,315 records · Page 73Linked to original sources
PubMed1992

Alu insertion polymorphism: a new type of marker for human population studies.

A PCR-based method was used to screen 462 individuals from Japan, Papua New Guinea, Indonesia, and Australia for an Alu family insertion polymorphism. The frequency of this Alu insertion shows significant heterogeneity among island subgroups of the Indonesian sample and between the Japanese-Indonesian populations and the Australian-New Guinean populations. The simple, rapid PCR-based screening technique and the significant frequency differences among populations demonstrate that Alu insertion polymorphisms are potentially valuable markers for studies of the evolutionary history and migration patterns of modern humans.

Australia↗
PubMed1997

The evolution of an intron: analysis of a long, deletion-prone intron in the human dystrophin gene.

The sequence of a 112-kb region of the human dystrophin (DMD/BMD) gene encompassing the deletion prone intron 7 (110 kb) and the much shorter intron 8 (1.1 kb) has been determined. Recognizable insertion sequences account for approximately 40% of intron 7. LINE-1 and THE-1/LTR sequences occur in intron 7 with significantly higher frequency than would be expected statistically while Alu sequences are underrepresented. Intron 7 also contains numerous mammalian-wide interspersed repeats, a diverse range of medium reiteration repeats of unknown origin, and a sequence derived from a mariner transposon. By contrast, the shorter intron 8 contains no detectable insertion sequences. Dating of the LI and Alu sequences suggests that intron 7 has approximately doubled in size within the past 130 million years, and comparison with the corresponding intron from the pufferfish (Fugu rubripes) suggests that the intron has expanded some 44-fold over a period of 400 million years. The possible contribution of the insertion elements to the instability of intron 7 is discussed.

Base Composition↗
PubMed1986

The LDL receptor in familial hypercholesterolemia: use of human mutations to dissect a membrane protein.

Since the discovery of the LDL receptor 13 years ago, a multidisciplinary approach to its study has revealed much about this important cell-surface protein. Most recently, we have developed tools in the form of full-length cDNAs and cloned genomic DNAs necessary to understand the molecular genetics of this locus. The frequent occurrence of mutations in the LDL receptor gene in patients with FH provides a fertile ground on which to explore the parts of the receptor that are necessary for its function. The analysis of four large deletions has revealed an unexpectedly universal involvement of Alu repeats in their generation. These studies indicate that repetitive DNAs can destabilize a gene through homologous recombination. Inasmuch as the LDL receptor gene is a mosaic of exons shared with at least five other proteins, it is possible that early exon-shuffling events involved recombination between these repetitive elements. Is it possible that the very plasticity that permitted evolution of the LDL receptor also accounts for its frequent disruption by mutation? Further study may help to answer this question. Mutations that disrupt the structure of the protein have been identified. The biochemical and cellular consequences of these mutations reveal crucial aspects of receptor structure. The receptor is clearly divided into quasi-independent domains with discrete functions. Mutations that disrupt the cytoplasmic domain alter the ability of the LDL receptor to cluster in coated pits, but they do not disrupt ligand binding or produce major effects on intracellular transport. Some of the mutations in the external domain disrupt binding but do not affect transport or internalization.(ABSTRACT TRUNCATED AT 250 WORDS)

Alleles↗
PubMed1985

Recombination and deletion of sequences in shuttle vector plasmids in mammalian cells.

Shuttle vector plasmids were constructed with directly repeated sequences flanking a marker gene. African green monkey kidney (AGMK) cells were infected with the constructions, and after a period of replication, the progeny plasmids were recovered and introduced into bacteria. Those colonies with plasmids that had lost the marker gene were identified, and the individual plasmids were purified and characterized by restriction enzyme digestion. Recombination between the repeated elements generated a plasmid with a precise deletion and a characteristic restriction pattern, which distinguished the recombined molecules from those with other defects in the marker gene. Recombination among the following different sequences was measured in this assay: (i) the simian virus 40 origin and enhancer region, (ii) the AGMK Alu sequence, and (iii) a sequence from plasmid pBR322. Similar frequencies of recombination among these sequences were found. Recombination occurred more frequently in Cos1 cells than in CV1 cells. In these experiments, the plasmid population with defective marker genes consisted of the recombined molecules and of the spontaneous deletion-insertion mutants described earlier. The frequency of the latter class was unaffected by the presence of the option for recombination represented by the direct repeats. Both recombination and deletion-insertion mutagenesis were stimulated by double-strand cleavage between the repeated sequences and adjacent to the marker, and the frequency of the deletion-insertion mutants in this experiment was again independent of the presence of the direct repeats. We concluded that although recombination and deletion-insertion mutagenesis were both stimulated by double-strand cleavage, the molecules which underwent the two types of change were drawn from separate pools.

Animals↗
PubMed1987

Repeated DNA of the human Y chromosome.

A significant fraction of the human Y chromosome is composed of DNA sequences which have homologues on the X chromosome or autosomes in humans and non-human primates. However, most human Y-chromosome sequences so far examined do not have homologues on the Y chromosomes of other primates. This observation suggests that a significant proportion of the human Y chromosome is composed of sequences that have acquired their Y-chromosome association since humans diverged from other primates. More than 50% of the human Y chromosome is composed of a variety of repeated DNAs which, with one known exception, can be distinguished from homologues elsewhere in the genome. These include the alphoid repeats, the major human SINE (Alu repeats) and several additional families of repeats which account for the majority of Y-chromosome repeated DNA. The alphoid sequences tandemly clustered near the centromere on the Y chromosome can be distinguished from those on other chromosomes by both sequence and repeat organization, while the majority of Y-chromosome Alu repeats have little homology with genomic consensus Alu sequences. In contrast, the Y-chromosome LINE repeats cannot be distinguished from LINEs found on other chromosomes. It has been proposed that both SINE and LINE repeats have been dispersed throughout the genome by mechanisms that involve RNA intermediates. The difference in the relationship of the Y-chromosome Alu and LINE repeats to their respective family members elsewhere in the genome makes it possible that their dispersal to the Y chromosome has occurred by different mechanisms or at different rates. In addition to the SINE and LINE repeats, the human Y chromosome contains a group of repeated DNA elements originally identified as 3.4 and 2.1 kb fragments in HaeIII digests of male genomic DNA. Although the 3.4 and 2.1 kb Y repeats do not cross-react, both exist as tandem clusters of alternating Y-specific and non-Y-specific sequences. The 3.4 kb Y repeats contain at least three distinct sequences with autosomal homologies interspersed in various ways with a collection of several different Y-specific repeat sequences. Individual recombinant clones derived from isolated 3.4 kb HaeIII Y fragments have been identified which do not cross-react. Thus, the 3.4 kb HaeIII Y fragments are a heterogeneous mixture of sequences which have in common the regular occurrence of HaeIII restriction sites at 3.4 kb intervals and an organization as tandem clusters at various sites along the Y-long arm.(ABSTRACT TRUNCATED AT 400 WORDS)

Animals↗
PubMed1998

Structure and expression of the human Na,K-ATPase beta 2-subunit gene.

We cloned and characterized the human Na,K-ATPase beta 2-subunit gene. The gene encompasses over 8 kb at chromosome 17 in the human genome and is composed of seven exons. Primer extension analysis identified a major transcription initiation site 529 bases upstream of the translation start site. The 5'-flanking region of the gene harbors a potential TATA sequence, located 94 bases upstream of the transcription initiation site and a number of potential promoter and regulatory elements, among them a Sp1 site, at position -120. A functional Sp1 site has also been found in the rat Na,K-ATPase beta 2-subunit gene (Kawakami, K., Watanabe, Y., Araki, M., Nagano, K., 1993). Sp1 binds to the adhesion molecule on glia regulatory element that functions as a positive transcription regulatory element in astrocytes. (J. Neurosci. Res. 35, 138-146). Putative AATAAA and TG sequences were found at positions 7018 and 7068, respectively. These signals delimit the origin of the the poly(A) tail and mark the end of the sequence that completes the 3'-UT downstream sequence of the human cDNA. An Alu repetitive sequence is located between positions 5961 and 6274. The gene is expressed as a single mRNA species, of 3.36 kb, which is present in cerebrum, cerebellum, kidney and heart, being more abundant in neural tissues. Structural analyses of this and other of the P-type ATPase beta subunit genes reveal that they evolved from a common ancestor.

Animals↗
PubMed1997

Structural and functional analysis of the promoter of the hepatic lipase gene.

Hepatic lipase (HL) gene transcription is almost exclusively limited to hepatocytes. Here we have studied sequences and transcription factors regulating basal and hepatocyte-restricted HL promoter activity. Sequencing of a cloned 3.4-kb HL promoter fragment revealed three Alu repeat sequences and a consensus hepatocyte-enriched nuclear transcription factor 1 (HNF1) binding site located upstream of one major and one minor transcription initiation site. By transfection of cell lines of hepatic and non-hepatic origin and of primary hepatocyte cultures, sequences controlling basic HL promoter activity and negative elements located downstream and upstream thereof which extinguish or enhance this activity were defined. Some HL-promoter fragments with internal deletions were active only in primary hepatocyte cultures. Human HNF1 protein was shown to bind to the HL-specific HNF1 response element and the activity of a heterologous promoter was enhanced by HL-HNF1 in rat primary hepatocyte cultures but not in the context of the authentic 3.4-kb HL promoter sequences. In cell lines the presence of HNF4 but not of HNF1 and vHNF1 mRNA was found to correlate with HL gene expression although no perfect consensus HNF4 binding motif was detected in the promoter region tested. Taken together, these data indicate that hepatocyte-specific HL gene transcription is controlled by positive and negative transcription regulatory proteins which bind to sequence motifs within and outside of the proximal 3.4-kb promoter fragment studied. For the elucidation of the control of HL promoter activity in vivo the use of primary hepatocyte cultures is essential.

Animals↗
PubMed1995

Bovine Alu-like sequences mediate transposition of a new site-specific retroelement.

We describe a new family of 3.1-kb repetitive sequences which is present in the bovine genome. The 5' and 3' ends of the unit are flanked with sequences homologous to the 5' and 3' halves of the bovine Alu-like monomer (BM), respectively. Distribution of the 5' ends of the family members in the genome is not random. They are close to the truncated bovine Alu-like dimer (BD) which, in some cases, is followed by 40-bp repeated sequences containing block A of the RNA polymerase III promoter. The ORFs found within the unit code for peptides homologous to amino-acid sequences characteristic for reverse transcriptases (RT). The family members may be considered as mutant mobile elements whose propagation in the genomes was accomplished by means of a process including site-specific recognition with BD. Because of this, we call this family the bovine dimer-driven family (BDDF).

Amino Acid Sequence↗
PubMed2004

The changing tails of a novel short interspersed element in Aedes aegypti: genomic evidence for slippage retrotransposition and the relationship between 3' tandem repeats and the poly(dA) tail.

A novel family of tRNA-related SINEs named gecko was discovered in the yellow fever mosquito, Aedes aegypti. Approximately 7200 copies of gecko were distributed in the A. aegypti genome with a significant bias toward A + T-rich regions. The 3' end of gecko is similar in sequence and identical in secondary structure to the 3' end of MosquI, a non-LTR retrotransposon in A. aegypti. Nine conserved substitutions and a deletion separate gecko into two groups. Group I includes all gecko that end with poly(dA) and a copy that ends with AGAT repeats. Group II comprises gecko elements that end with CCAA or CAAT repeats. Members within each group cannot be differentiated when the 3' repeats are excluded in phylogenetic and sequence analyses, suggesting that the alterations of 3' tails are recent. Imperfect poly(dA) tail was recorded in group I and partial replication of the 3' tandem repeats was frequently observed in group II. Genomic evidence underscores the importance of slippage retrotransposition in the alteration and expansion of the tandem repeat during the evolution of gecko sequences, although we do not rule out postinsertion mechanisms that were previously invoked to explain the evolution of Alu-associated microsatellites. We propose that the 3' tandem repeats and the poly(dA) tail may be generated by similar mechanisms during retrotransposition of both SINEs and non-LTR retrotransposons and thus the distinction between poly(dA) retrotransposons such as L1 and non-poly(dA) retrotransposons such as I factor may not be informative.

Aedes↗
PubMed1999

Phylogenetic signals from point mutations and polymorphic Alu insertions.

Allelic frequency data derived from five polymorphic Alu insertion loci and five point mutation polymorphic loci were compared to determine their ability to infer phylogenetic relationships among human populations. While point mutation polymorphisms inferred a monophyletic Caucasian clade that is corroborated by other studies, these data failed to support the generally accepted monophyly of Orientals with native Americans. In addition, there is less statistical bootstrap support for the maximum-likelihood tree derived from the point mutation polymorphisms as compared to those generated from either the Alu insertion data or the combined Alu insertion + point mutation data. The Alu data and the combined Alu insertion + point mutation data inferred a monophyletic relationship among the Oriental and native American populations. The Alu insertion data and the combined Alu insertion + point mutation data also displayed two separate, well defined, tight clusters of the Caucasian and the Oriental + native American populations which was not inferred from the point mutation data. These findings indicate greater phylogenetic information contained in Alu insertion frequencies than in allelic frequencies derived from point-mutations.

Alleles↗
PubMed1985

The human alpha-fetoprotein gene. Sequence organization and the 5' flanking region.

The human alpha-fetoprotein (AFP) gene was isolated into three overlapping clones in bacteriophage lambda vectors and its sequence organization analyzed by restriction endonuclease mapping and nucleotide sequencing. The human AFP gene is about 20 kilobase pairs long and contains 15 exons and 14 introns. The overall organization of the human AFP gene is similar to that of the mouse AFP gene, with all but two exons showing identical sizes. Nucleotide sequences at all exon/intron junctions display similarity to the consensus boundary sequence (Breathnach, R., and Chambon, P. (1981) Annu. Rev. Biochem. 50, 349-383), with the GT-AG rule applied to the splicing point. The cap site maps 44 nucleotides upstream from the translation initiation site. The "TATA box" is located 27 nucleotides upstream from the putative cap site and is flanked by sequences with dyad symmetry. The TATA box can thus be placed in the loop portion of a possible stem-loop structure formed by intrastrand base-pairing. Other characteristic nucleotide sequences in the 5' flanking region include a CCAAC pentamer, a 14-base pair (bp) enhancer-like sequence, and a 9-bp sequence homologous to the glucocorticoid responsive element. A long (90 bp) direct repeat and several alternating purine/pyrimidine sequences are also present in the 5' flanking region. A 736-bp sequence of the 5' flanking region adjacent to the cap site of the human AFP gene shows a 61% similarity with the corresponding region of the mouse AFP gene. There are two Alu family sequences and two poly(dT-dG) repeats in the human AFP gene that show different distribution patterns from those in the mouse AFP gene.

Amino Acid Sequence↗
PubMed1991

Amplification dynamics of human-specific (HS) Alu family members.

We have investigated the distribution of several recently inserted Alu family members within representatives of diverse human groups. Human population studies using 65 unrelated human DNA samples, as well as a familial study to test inheritance, showed that individual Alu family members could be divided into three groups. The first group consisted of relatively older Alu family members which were monomorphic (homozygous) throughout the population tested (HS C3N1 and C4N6). The second group (HS C4N2, C4N5 and C4N8), apparently inserted into other repetitive regions of the genome, resulting in inconclusive results in the PCR test used. However, it is clear that these particular Alu insertions were present in a majority if not all of the loci tested. The third group was comprised of three dimorphic Alu family members (HS C2N4, C4N4 and TPA 25). Only a single Alu family member (TPA 25) displayed a high degree of dimorphism within the human population. This latter example also showed different allele frequencies in different human groups. The isolation and characterization of additional highly dimorphic Alu family members should provide a useful tool for human population genetics.

Alleles↗
PubMed1992

Functional analysis of the human adenosine deaminase gene thymic regulatory region and its ability to generate position-independent transgene expression.

We previously observed that human ADA gene expression, required for the intrathymic maturation of T cells, is controlled by first-intron sequences. Used as a cis activator, the intron generates copy-dependent reporter expression in transgenic thymocytes, and we here dissect its critical determinants. Of six DNase I-hypersensitive sites (HS sites) in the intron, only HS III was a transfection-active classic enhancer in T cells. The enhancer contains a critical core region, ACATGGCAGTTGGTGGTGGAGGGGAACA, that interacts with at least two factors, ADA-NF1 and ADA-NF2. Activity of the core is strongly augmented by adjacent elements contained within a 200-bp domain corresponding to the limits of HS III hypersensitivity. These core-adjacent sequences include consensus matches for recognition by the AP-1, TCF-1 alpha, mu E, and Ets transcription factor families. In contrast, considerably more extensive sequences flanking the enhancer domain were required for position-independent and copy-proportional expression in transgenic mouse thymocytes. The additionally required upstream segment encompassed the nonenhancer HS II site. The required downstream segment, composed largely of Alu-repetitive DNA, was non-DNase I hypersensitive. Transgenes that lacked either segment were subject to strong positional effects. Among these variably expressing lines, the expression level correlated with the degree of hypersensitivity at HS III. This finding suggests that formation of hypersensitivity is normally facilitated by the flanking segments. These results delineate a complex thymic regulatory region within the intron and indicate that a series of interactions is necessary for the enhancer domain to function consistently within chromatin.

Adenosine Deaminase↗
PubMed1992

Distribution of Alu and L1 repeats in human YAC recombinants.

Evidence is accumulating that the two major families of interspersed repeated human DNA sequences, Alu and L1, are not randomly distributed. However, only limited information is available on their relative long-range distribution. We have analyzed a set of randomly selected, human Chromosome (Chr) 11-specific YAC recombinants constituting a total length of about 2 Mbp for the local and global distribution of Alu and L1 repeats: the data show a strong asymmetry in the distribution of these two repeat classes and give weight, at the long-range molecular level, to previous studies indicating their partition in the human genome; they also suggest a strong tendency for L1 repeats to cluster, with a higher proportion of full-length elements than expected.

Base Sequence↗
PubMed1990

Structural features of transposed human VK genes and implications for the mechanism of their transpositions.

The genes encoding the variable, joining and constant regions of human immunoglobulin light chains have been localized to the short arm of chromosome 2. However, several VK genes lie outside of the locus: a single copy cluster of five VK genes is located on chromosome 22; an isolated but amplified VkI gene is found on chromosome 1; and several isolated VkI genes are on as-yet-unidentified chromosomes other than chromosome 2. Vk genes not contained within the kappa locus are termed orphons. We have attempted to gain insight into the mechanism of transposition of both the chromosome 22 cluster and the several amplified VkI genes by searching in the kappa locus for a parent copy of the former, and by analyzing the junctions between transposed VKI-containing segments and adjacent non-amplified regions. The chromosome 22 orphon cluster must have been non-duplicatively transposed. Sequence features at the junctions of this and other orphon regions are direct and inverted repeats, and, in one case, an Alu repeat. These unusual features may have predisposed the orphon regions to transposition by serving as target sites for enzymes involved in recombination.

Base Sequence↗
PubMed1983

Molecular evolution of the human adult alpha-globin-like gene region: insertion and deletion of Alu family repeats and non-Alu DNA sequences.

Previous heteroduplex studies have revealed extensive sequence homology between the two human adult alpha-globin-like genes (alpha 2 and alpha 1) and their flanking regions. These homologous regions, which are interrupted by two blocks of nonhomology, each span approximately 4 kilobases [Lauer, J., Shen, C.-K. J. & Maniatis, T. (1980) Cell 20, 119-130]. We have determined 3 kilobases of DNA sequences within and flanking the nonhomologous blocks of these two tandem duplication units. A total of three Alu family repeats has been identified. Two of them are approximately 300 base pairs long and define the 3' ends of the first homology blocks. The third Alu family member is a 600-base-pair-long sequence consisting of two monomeric Alu members arranged in a head-to-tail fashion. It is located in the 3' portion of the first block of nonhomology in alpha 2-gene-containing unit. We present direct evidence that this dimeric Alu sequence was inserted at a staggered break. The second nonhomology block is the result of insertion or deletion of a 224-base-pair sequence. From these data and the calculation of sequence divergence, we propose a history for the evolution of the human adult alpha-globin-like gene region. We also suggest that DNA insertion elements may disrupt gene correction processes in the two duplication units containing alpha 2- and alpha 1-globin genes.

Adult↗
PubMed2004

Natural genetic variation caused by transposable elements in humans.

Transposons and transposon-like repetitive elements collectively occupy 44% of the human genome sequence. In an effort to measure the levels of genetic variation that are caused by human transposons, we have developed a new method to broadly detect transposon insertion polymorphisms of all kinds in humans. We began by identifying 606,093 insertion and deletion (indel) polymorphisms in the genomes of diverse humans. We then screened these polymorphisms to detect indels that were caused by de novo transposon insertions. Our method was highly efficient and led to the identification of 605 nonredundant transposon insertion polymorphisms in 36 diverse humans. We estimate that this represents 25-35% of approximately 2075 common transposon polymorphisms in human populations. Because we identified all transposon insertion polymorphisms with a single method, we could evaluate the relative levels of variation that were caused by each transposon class. The average human in our study was estimated to harbor 1283 Alu insertion polymorphisms, 180 L1 polymorphisms, 56 SVA polymorphisms, and 17 polymorphisms related to other forms of mobilized DNA. Overall, our study provides significant steps toward (i) measuring the genetic variation that is caused by transposon insertions in humans and (ii) identifying the transposon copies that produce this variation.

DNA Transposable Elements↗
PubMed1982

The Alu family of dispersed repetitive sequences.

A family of related sequences that includes approximately 500,000 members is the most prominent short dispersed repeat family in primate and rodent DNA's. The primate sequence is approximately 300 base pairs in length and is composed of two imperfectly repeated monomer units, whereas the rodent repeat consists of only a single monomer. Properties of this repeat sequence, its flanking sequences in chromosomal DNA, and RNA's transcribed from it suggest that it may be a mobile DNA element inserted at hundreds of thousands of different chromosomal locations.

Animals↗