Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “virtual screening”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,279 records · Page 71Linked to original sources
PubMed2002

Screening for carnitine palmitoyltransferase II deficiency by tandem mass spectrometry.

Mitochondrial carnitine palmitoyltransferase II (CPT II) deficiency is the most common inherited disorder of lipid metabolism in adults. Currently the routine diagnosis is based on the determination of CPT enzyme activity in muscle tissue. We have analysed the tandem mass spectra of serum acylcarnitines of nine CPT II-deficient patients. These spectra were compared to those of a cohort of 99 patients with other neuromuscular disorders and metabolic conditions supposed to cause alterations of the long-chain acylcarnitines. The spectra in CPT II deficiency showed characteristic elevations of C16:0 and C18:1 acylcarnitines while acetylcarnitine C2 was not elevated. In the present study, the ratio (C16:0+C18:1)/C2 has detected all CPT II deficiencies and discriminated them from unspecific alterations of serum acylcarnitines. The ratios of CPT II-deficient patients showed virtually no overlap with those observed in patients with other neuromuscular disorders. We suggest mass spectrometry of serum acylcarnitines as a rapid screening test that should be included early in the diagnostic work-up of patients with recurrent myoglobinuria, recurrent muscular weakness and myalgia.

Adolescent↗
PubMed1987

Detection of lung cancer: highlights of the Memorial Sloan-Kettering Study in New York City.

1. Patients with Stage 1 lung cancer detected by cytology or x-ray, and treated by complete resection, have a high probability of survival. 2. Sputum cytology is effective in early detection of slow growing squamous (epidermoid) carcinomas of lung, which in our population account for less than one-third of cases. Without cytologic screening these cancers would be identified by annual chest x-rays at a later date, though still while localized and resectable. Thus, in a program of annual chest x-rays, conscientiously carried out, the addition of cytologic screening has no statistically significant effect on mortality. 3. Nearly half of all lung cancers in our population are adenocarcinoma, and early detection of these tumors is virtually restricted to the chest x-ray. Fifteen percent of cases are oat cell (small cell anaplastic) carcinoma, and these rapidly developing tumors are almost all discovered in an advanced stage with symptoms. 4. All participants in our study were offered annual chest x-rays, and no direct evaluation of the effect of radiographic screening on lung cancer mortality was possible. However, 40% of all lung cancers were detected in Stage 1, and at least two-thirds of patients with Stage 1 lung cancer treated by complete resection do not die of that disease. The overall five-year survival of patients enrolled in this program who developed lung cancer is 35%, in contrast to 13% for lung cancer in the United States as a whole. Survival at 10 years for all lung cancer patients in this screening program is 25%, and for those with Stage 1 lung cancer it is approximately 65%. 5.(ABSTRACT TRUNCATED AT 250 WORDS)

Adenocarcinoma↗
PubMed1990

Mutational analysis of ligand binding activity of beta 2 adrenergic receptor expressed in Escherichia coli.

A novel in situ screening procedure was used to identify neutral mutations in the human beta 2 adrenergic receptor (beta 2AR). The coding region of the human beta 2AR gene was subcloned under transcriptional control of an inducible T7 promoter and used to transform Escherichia coli. Colonies expressing the beta 2AR bound the radiolabeled antagonist [125I]iodocyanopindolol and could be identified by autoradiography after transfer to nitrocellulose filters. The region of the beta 2AR between residues 76 and 83, in the second transmembrane helix, was mutagenized by a saturation mutagenesis technique, so that virtually all of the beta 2AR genes contained at least one mutation. Colonies retaining ligand binding activity were isolated using the in situ screen. Sequence analysis of the active mutant receptor genes allowed the identification of individual amino acid side chains which are essential for either ligand binding or structural integrity of the beta 2AR receptor.

Amino Acid Sequence↗
PubMedDate not supplied

Preschool vision screening: rationale, methodology and outcome.

Although population outcome studies support the utility of preschool screening for reducing the prevalence of amblyopia, fundamental questions remain about how best to do such screening. Infant photoscreening to detect refractive risk factors prior to onset of esotropia and amblyopia seems promising, but our current understanding of the natural history of these conditions is limited, thus limiting the prophylactic potential of early screening. Screening for strabismic, refractive and ocular disease conditions directly associated with amblyopia is more clearly proven, but the diversity of equipment, methods and subject populations studied make it difficult to draw precise summary conclusions at this point about the efficacy of photoscreening. Sensory-based testing of preschool-age children exhibits a similar combination of promise and limitations. The visual acuity tests most widely used for this purpose are prone to problems of testability and false negatives. Moreover, the utility of random-dot stereograms has been confused by misapplication, and new small-target binocularity tests, while attractive, are as yet inadequately field-proven. The evaluation standard for any screening modality is treatment outcome. However, variables in amblyopia classification and quantitative definition differences, timing of presentation, nonequivalent treatment comparisons, and compliance variability have been uncontrolled in virtually all extant studies of amblyopia treatment outcome, making it difficult or impossible to evaluate either the relative efficacy of different treatment regimens for amblyopia or the effects of age on treatment outcome within the preschool age range. The latter issue is a central one, since existence of such an age effect is the primary rationale for screening at younger rather than older preschool ages. The relatively low prevalence of amblyopia makes it difficult to achieve a high screening yield in terms of predictive value, but functionally increasing prevalence by selective screening of high risk populations causes further problems. Unless a "supertest" can be devised, with very high sensitivity and specificity, health policy decisions will be required to determine which of these two characteristics should be emphasized in screening programs. Performance of screening tests can be optimized, however, with adequate training, perhaps via instructional videotapes.

Amblyopia↗
PubMed1996

Prevalence of HIV in a largely indigent obstetric population of Tarrant County, Texas.

To establish the seroprevalence of the human immunodeficiency virus (HIV) in our county hospital obstetric patients, and to assess the predictive value of screening questionnaires for high-risk behaviors attributing to HIV infection, we conducted written surveys and blinded HIV testing over a 4-month period ending February 1993. Blinded HIV antibody testing was performed on 1348 patients upon admission to labor and delivery. The coded blood samples were matched to similarly coded surveys of patient demographics and behaviors implicated in HIV transmission. The overall HIV prevalence in our regional population remains virtually unchanged at a rate of 0.22% (2.2 per 1000 patients). Questionnaires regarding health history were not predictive for HIV infection in our patients. Universal screening questionnaires cannot predict HIV infection. Similarly, routine mandatory testing for HIV performed on obstetric patients on the day of delivery are not cost-effective and do not provide clinically meaningful information needed to alter management protocols.

Adult↗
PubMed2006

Virtual microscopy in prostate histopathology: simultaneous viewing of biopsies stained sequentially with hematoxylin and eosin, and alpha-methylacyl-coenzyme A racemase/p63 immunohistochemistry.

PURPOSE: Histopathological diagnosis of small focus carcinomas in prostatic needle biopsies is often assisted by IHC. To make a definitive diagnosis the pathologist must compare IHC findings with hematoxylin and eosin stained tissue morphology. We introduce what is to our knowledge a new application of virtual microscopy, in which hematoxylin and eosin, and IHC stains done sequentially on the same microscope slide can be simultaneously displayed and compared on a computer screen. MATERIALS AND METHODS: A total of 30 hematoxylin and eosin stained prostatic needle biopsies were scanned with a computer controlled microscope. The slides were destained and then immunostained with a cocktail of AMACR and p63 antibodies, which labels the nuclei of nonmalignant basal cells (p63) and the cytoplasm of neoplastic glandular cells suspicious for malignancy (AMACR). The slides were then scanned again and the pairs of virtual slides were aligned for synchronized viewing. RESULTS: The presented technique was found helpful when suspicious lesions were small and when examining the immunoprofile of specimens was warranted, in addition to examining hematoxylin and eosin stained tissue morphology. The usefulness of our approach based on virtual microscopy can be evaluated on the website , which also serves as an educational tool for self-learning the correlation between hematoxylin and eosin stained tissue morphology, and AMACR/p63 IHC in prostate biopsies. CONCLUSIONS: The technology for simultaneously viewing sequentially hematoxylin and eosin and IHC stained prostate biopsies can be readily used for educational purposes, as exemplified by our website, and along with the availability of rapid virtual slide scanners it can also be used for clinical diagnostics.

Biopsy, Needle↗
PubMed2005

Emerging technologies in colorectal cancer screening.

CRC is a preventable disease through early detection, yet screening rates remain low and mortality rates remain high. The discomfort associated with the preparation and performance of some of the currently available screening modalities and the lack of public awareness about CRC and screening procedures likely account for low rates of screening. CT colonography and stool DNA testing are new promising screening technologies that are less invasive, accurate, and suitable for the public more than the current screening procedures. Before both tests can be promoted for population-based screening programs, several issues that have been detailed in this article must be addressed further, including technical improvements for improving accuracy, development of virtual preparation, test availability, patient and provider acceptability and cost-effectiveness for CTC, and identifying the optimal combination of molecular targets for stool DNA testing. The year 2005 will tell us if the ideal technology from the public health point of view was achieved. A skill-independent, anesthesia-free, self-propelling, self-navigating miniaturized endoscopic device that may move along the entire length of the colon may change the natural history of CRC. We should aim to achieve a new definition of CRC--a rare disease occurring in a subset of the population who has not been screened for the disease.

Colonoscopy↗
PubMedDate not supplied

Potential effectiveness of comparative casemix-corrected adverse outcome rates as quality monitors in a simulated hospital system.

To facilitate outcome-based medical quality assurance, a screening technique was developed which corrected facility-specific data for casemix using mean outcome rates from pooled data to establish norms for "uniform-risk groups" of patients. A stimulated health care system (108 facilities treating over 500,000 annually) was created to evaluate this technique's ability to distinguish between systems whose adverse outcomes were determined solely by casemix and random variations and those with true differences in quality of care. Specificity and sensitivity of quality of care decisions for individual facilities also were assessed. The screening technique achieved excellent differentiation between "homogeneous" systems and those with facility-specific variations in quality of care. No more than 3% of facilities without quality of care problems were ever inaccurately labeled, unless systematic or random errors in patient risk classification were introduced. Sensitivity in detecting substandard facilities was 35% when true deviation from standard was 2.5%, and rose to virtually 100% when deviation was 25% or greater. Thus, simulation can serve as an efficient method of testing the potential performance of casemix-corrected quality assurance screening under a wide variety of circumstances.

Computer Simulation↗
PubMed2001

Live donor adult liver transplantation using right lobe grafts: donor evaluation and surgical outcome.

HYPOTHESIS: Live donor adult liver transplantation (LDALT) is a safe and efficacious treatment for patients with end-stage liver disease. DESIGN: Case-control study. SETTING: Hepatobiliary surgery and liver transplantation unit. PATIENTS: From December 10, 1998, through April 10, 2000, a single team performed 15 LDALT procedures with 2 simultaneous living donor kidney transplants. During this period, 66 potential donors were screened and evaluated. INTERVENTIONS: Potential donors were evaluated with 3-dimensional helical computed tomographic scan, including volume renderings for hepatic lobar volume, vascular anatomy, virtual resection planes, and morphologic features. Suitable donors undergo complete medical and psychiatric evaluation and preoperative arteriography. MAIN OUTCOME MEASURES: Donor demographics, evaluation data, operative data, hospital length of stay, and morbidity. RESULTS: A total of 38 men (58%) and 28 women (42%) were evaluated with 15 donors participating in LDALT. Two additional donors provided kidney grafts for simultaneous transplantation at the time of LDALT. Thirty-two donors (48%) were rejected for either donor or recipient reasons, and 10 patients (15%) elected not to participate after initial screening. Three-dimensional volume renderings by helical computed tomographic scan predicted right lobe liver volume within 92% of actual graft volume. Donor morbidity, including all complications, was 67% with no mortality. Residual liver regenerated to approximately 70% of initial volume within 1 week and 80% within 1 month after surgery. CONCLUSIONS: Donor evaluation is an important component of LDALT. Significant donor morbidity is encountered even with careful selection. To minimize donor morbidity, groups considering initiating living donor programs should have expertise in hepatic resection and vena cava preservation using the "piggyback" technique during liver transplantation.

Adolescent↗
PubMed1984

Pregnancy and tuberculosis.

There is no solid evidence that pregnancy has an adverse effect on tuberculosis. With early diagnosis and prompt, adequate chemotherapy, the outcome of pregnancy in a woman with tuberculosis is likely to be good. Routine therapeutic abortion is not indicated. Data in the literature do not support the notion that pregnancy is a major risk factor for the development of tuberculosis, although no well-designed studies have been conducted. Screening of pregnant patients for tuberculosis should be based on consideration of other proved risk factors not on the fact of pregnancy. Preventive therapy should be given during the second and third trimesters of pregnancy to selected patients at high risk of progressive disease developing. Treatment of disease should be instituted promptly when disease is detected. The preferred regimens are INH-EMB, INH-RIF, or INH-EMB-RIF, although other drugs may be needed if the disease is recurrent or if there is resistance to these primary drugs. Mothers taking antituberculosis drugs can nurse their infants with little risk. With proper medical management, both tuberculosis and pregnancy can be expected to reach a happy conclusion in virtually all cases.

Drug Therapy, Combination↗
PubMed2003

Multidetector CT of the colon.

Multidetector technology, enabling faster imaging, higher spatial resolution and reduction in radiation dose, increases the role of CT in colonic diagnostic. The higher spatial resolution in the z-direction also changes the way to analyze the images. Instead of reading axial sections, now the colon can be systematically assessed in 3D by scrolling through multiplanar reconstructions or in CT colonography by virtual endoscopy. With ongoing improvements in computer-aided diagnosis CT colonography becomes an alternative to fiberoptic colonocopy for screening (http://www. multiorganscreening.org). In this article we propose a CT examination protocol for the colon, describe the typical imaging findings of different colonic diseases, and summarize the current status of CT colonography.

Colonic Diseases↗
PubMed2004

Novel insertion and deletion mutations in the 5'-UTR of the folate receptor-alpha gene: an additional contributor to hyperhomocysteinemia?

OBJECTIVES: To search for mutations in the 5'-UTR and proximal promoter region of the folate receptor-alpha (FR-alpha) gene, whose exons are known to be virtually free of genetic variation in the population. DESIGN AND METHOD: Seven hundred seventy-eight patient samples were screened for mutations between nt -116 and nt +207 in the FR-alpha gene using single strand conformation polymorphism (SSCP) followed by DNA sequencing. RESULTS: Three patients were found to have a 25-bp deletion, c.109_133delCCACTAAACCACAGCTGTCCCCTGG, and three others had a 1-bp A insertion, c.-69dupA, so that 0.77% of the patient population showed genetic variation already in the 323 bp promoter sequence studied so far. CONCLUSIONS: The promoter region of FR-alpha may harbor much more genetic variation than its highly conserved exons, and not just isolated, unique mutations. This could be a new factor contributing to gene-food interaction explaining part of the hyperhomocysteinemia panorama. Extended searches for polymorphisms further upstream in the FR-alpha gene are warranted.

5' Untranslated Regions↗
PubMed1999

Retroviral vector-mediated gene transfer into umbilical cord blood CD34brCD38-CD33- cells.

In this report, we sought to optimize gene transfer into primitive human umbilical cord blood (UCB) cells. Initially, we found that fresh UCB isolated with the CD34brCD38 CD33 phenotype were highly enriched for hematopoietic progenitors detected in extended long-term cultures (8-week LTCs). In addition, following ex vivo gene transfer, this population possessed virtually all the 8-week LTC activity of the cultured cells. A multiparameter FACS assay was developed to efficiently screen the effects of alternative retroviral vector gene transfer procedures on the transduction efficiency and maintenance of CD34brCD38 CD33 cells. Proliferation of the CD34brCD38 CD33 cells was found to be a prerequisite for efficient transduction. However, in all conditions tested, proliferation of the CD34brCD38 CD33 cells was associated with a progressive loss of primitive cell properties including a reduction in CD34 expression, an increase in CD38/CD33 expression, and a decline in the ability to sustain 8-week LTCs. These observations indicate that it will be necessary to define conditions that more effectively support the self-renewal capacity of CD34brCD38 CD33 cells to optimize retroviral vector gene transfer in these cells. Evaluating these conditions and reagents will be facilitated by the multiparameter FACS assay described in this report.

ADP-ribosyl Cyclase↗
PubMed2005

Detection of urinary albumin.

Microalbuminuria is an important clinical marker in patients with diabetes and cardiovascular disease. The concentration of albumin in urine has traditionally been measured by semiquantitative dipsticks or by various quantitative immunochemical methods such as immunonephelometry, immunoturbidimetry, and radioimmunoassay. However, until recently, urinary albumin not reabsorbed by proximal tubular cells was assumed to be excreted intact. Studies have now revealed that the nature of urinary albumin is complex and is excreted as a mixture of intact albumin, albumin-derived peptides that are not detected by routine dipstick and antibody-based tests, and a species of intact albumin (immunounreactive albumin), also not detected by dipstick and antibody-based tests. A new test, Accumin, based on high-performance liquid chromatography analysis, is able to detect all the immunoreactive intact albumin and immunounreactive intact albumin (total intact albumin) in urine. The advantage in the use of Accumin over a conventional dipstick test or antibody-based laboratory method for detecting microalbuminuria is that false negatives are reduced and a relatively earlier diagnosis of incipient kidney disease can be achieved. The introduction of Accumin has, therefore, highlighted the need for a global standard in the detection and measurement of microalbuminuria. By detecting all of the immunoreactive and immunounreactive intact albumin in urine, Accumin has virtually invalidated the use of dye and immunologically-based dipstick tests and immunologically-based laboratory methods in screening for microalbuminuria in diabetic patients and in identifying microalbuminuria as a risk factor for cardiovascular disease.

Albuminuria↗
PubMed2002

Ethical considerations in gastroenterology and endoscopy.

Previously doctors decided what was right or wrong in medicine, today our individual freedom is more limited. External influences including the human rights act, government initiatives, management protocols, professional guidelines, multi-disciplinary decision-making and financial restrictions intervene between the doctor and the patient. Furthermore the move away from paternalism in the doctor-patient relationship to patient empowerment (informed consent) has put patients in charge of their medical destiny. Increased public expectations leading to health screening, genetic profiling and treatment of unwanted physiological changes mean that doctors now manage healthy patients for 'potential' or 'virtual' disease. This implies a greater ethical burden than treatment of the sick. Finally, death is no longer regarded by many as a physiological process, but a consequence of disease. The investigation and management of patients with incurable conditions can lead to difficult ethical dilemmas. Gastroenterology and endoscopy generate specific ethical problems which among others include training in endoscopy, percutaneous endoscopic gastrostomy placement, informed consent and live endoscopy demonstrations. This article addresses some of these issues in order to draw attention to potential difficulties in modern ethical practice. It should be read in conjunction with the other publications stemming from the 1st Symposium on Ethics in Gastroenterology and Endoscopy, Kos, June 2002.

Endoscopy, Gastrointestinal↗
PubMed1996

Identification of novel mRNAs in immature seeds of Arabidopsis thaliana.

Although most of the major discernible morphogenetic events in plants occur after germination, the overall architectural pattern of the mature plant is established during early events of embryogenesis. So far, few genes that are expressed specifically during embryogenesis have been identified. This is due primarily to technical difficulties associated with the mass ratios of the embryo and the surrounding maternal tissue and to the lack of molecular and cellular markers to direct screening efforts. We have developed a series of molecular approaches to study the early events of embryogenesis. These include 'virtual subtraction' of a cDNA library with high specific-activity cDNA probes generated from both seed and non-seed tissue, PCR amplification of gene family members from an immature seed cDNA library using primers specific to conserved domains, differential display analysis of mRNA populations and high throughput expressed sequence tag (EST) analysis. These techniques have led to the identification and isolation of several novel seed-specific cDNAs.

Amino Acid Sequence↗
PubMed1995

Molecular detection of hepatitis C virus: impact of detection methodology on clinical and laboratory correlations.

The clinical manifestations of hepatitis C virus (HCV) infection are generally indistinguishable from other causes of viral hepatitis. HCV infections are usually anicteric, asymptomatic, and rarely cause acute fulminant liver failure. Serological testing for HCV in conjunction with epidemiological studies have verified that HCV was the major cause of parenterally transmitted non-A, non-B hepatitis (NANBH). With the widespread introduction of serological screening of blood products for HCV antibody, the risk of transfusion-associated HCV infection has been dramatically reduced (to < 3 cases per 10,000 units transfused). Despite the virtual elimination of transfusion-associated infections, the diagnosis of HCV remains important because > 50% of infections are sporadic in origin, 50 to 70% of infected individuals develop chronic hepatitis, and these individuals are at risk of developing cirrhosis (> 20%) as well as hepatocellular carcinoma. Although currently available anti-HCV immunoassays function well as blood-donor screening assays, they are poor at detecting acute infection because of the prolonged lag time between infection and detection of seroconversion (approximately 10 to 26 weeks for second-generation immunoassays). In contrast, polymerase chain reaction (PCR)-based detection of HCV RNA in serum can detect infection in as little as 1 to 2 weeks after exposure. This review focuses on the impact of modern serologic and nucleic acid-based HCV detection methodology on the clinical understanding of HCV infection, its associated illnesses, and its transmissability. Quantitative and reproducible nucleic acid-based detection assays will be required to provide additional insights into the clinical spectrum of HCV infections as well as to assess the efficacy of antiviral agents.

Hepacivirus↗