Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “inverted terminal repeat”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,279 records · Page 71Linked to original sources
PubMed1987

Regulation, initiation, and termination of the cenA and cex transcripts of Cellulomonas fimi.

We characterized the in vivo transcripts of two Cellulomonas fimi genes, the cenA gene, which encodes an extracellular endo-beta-1,4-glucanase (EC 3.2.1.4) and the cex gene, which encodes an extracellular exo-beta-1,4-glucanase (EC 3.2.1.91). By Northern blot analysis, cenA mRNA was detected in C. fimi RNA preparations from glycerol- and carboxymethyl cellulose-grown cells but not from glucose-grown cells. In contrast, cex mRNA was detected only in the preparations from carboxymethyl cellulose-grown cells. Therefore, the transcription of these genes is subject to regulation by the carbon source provided to C. fimi. By nuclease S1 protection studies with unique 5'-labeled DNA probes and C. fimi RNA isolated in vivo, 5' termini were found 51 and 62 bases before the cenA translational initiation codon and 28 bases before the cex translational initiation codon. S1 mapping with unlabeled DNA probes and C. fimi RNA which had been isolated in vivo but which had been 5' labeled in vitro with guanylyltransferase and [alpha-32P]GTP confirmed that true transcription initiation sites for cenA and cex mRNA had been identified. Comparative analysis of the DNA sequences immediately upstream of the initiation sites of the cenA and cex mRNAs revealed a 30-base-pair region where these two sequences display at least 66% homology. S1 mapping was also used to locate the 3' termini of the cenA and cex transcripts. Three 3' termini were found for cenA messages, whereas only one 3' terminus was identified for cex mRNA. The transcripts of both genes terminate in regions where their corresponding DNA sequences contain inverted repeats.

Bacteria, Anaerobic↗
PubMed1993

RepR protein expression on plasmid pIP501 is controlled by an antisense RNA-mediated transcription attenuation mechanism.

Expression of the rate-limiting initiator protein RepR of plasmid pIP501 is controlled by the antisense RNAIII. Mutational alteration of individual G residues within the single-stranded loops of RNAIII led to an increase in copy number. In contrast to the G-rich single-stranded loops, two smaller AT-rich loops of RNAIII were found to be dispensable for its inhibitory function. Reciprocal mutations in the same loop compensated for each other's effect, and a destabilization of the major stem structure of RNAIII also resulted in an increased copy number. These data were consistent with the idea that the interaction of RNAIII with its target starts with the formation of a kissing complex between the single-stranded loops of both molecules. The repR mRNA leader sequence, which includes the target of RNAIII, is able to assume two alternative structures due to the presence of two inverted repeats the individual sequences of which are mutually complementary. In the presence of the antisense RNAIII, one of these inverted repeats (IR2) is forced to fold into a transcriptional terminator structure that prevents transcription of the repR gene. In the absence of RNAIII, formation of the transcriptional terminator is prevented and expression of the essential repR gene can proceed normally. This antisense RNA-driven transcriptional attenuation mechanism was supported by extensive deletional analysis and direct evidence that IR2 functions as a transcriptional terminator.

Bacterial Proteins↗
PubMed1997

Mutational analysis of the R64 oriT region: requirement for precise location of the NikA-binding sequence.

Conjugative DNA transfer of IncI1 plasmid R64 is initiated by the introduction of a site- and strand-specific nick into the origin of transfer (oriT). In R64 oriT, 17-bp (repeat A and B) and 8-bp inverted-repeat sequences with mismatches are located 8 bp away from the nick site. The nicking is mediated by R64 NikA and NikB proteins. To analyze the functional organization of the R64 oriT region, various deletion, insertion, and substitution mutations were introduced into a 92-bp minimal R64 oriT sequence and their effects on oriT function were investigated. This detailed analysis confirms our previous prediction that the R64 oriT region consists of an oriT core sequence and additional sequences necessary for full oriT activity. The oriT core sequence consists of the repeat A sequence, which is recognized by R64 NikA protein, and the nick region sequence, which is conserved among various origins of transfer and is most probably recognized by NikB protein. The oriT core sequence is sufficient for NikAB-mediated oriT-specific nicking. Furthermore, it was shown that the repeat A sequence is essential for localization to a precise position relative to the nick site for oriT function. This seems to be required for the formation of a functional ternary complex consisting of NikA and NikB proteins and oriT DNA. The repeat B sequence and 8-bp inverted repeat sequences are suggested to be required for the termination of DNA transfer.

Bacterial Proteins↗
PubMed1976

Physical maps for Herpes simplex virus type 1 DNA for restriction endonucleases Hind III, Hpa-1, and X. bad.

It has been proposed that the genome of herpes simplex virus type 1 (HSV-1) consists of two internal unique sequences, S and L, bounded by two sets of redundant sequences (P. Sheldrick and N. Berthelot, 1974). In this arrangement, terminal sequences (TRs and TRl) are repeated in an internal inverted form (IRs and IRl) and delimit S and L. Furthermore, a body of evidence has accumulated that suggests that S and L themselves are inverted, giving rise to four related forms of the HSV genome. In this study the ordering of restruction endonuclease fragments of HSV-1 DNA for physical maps has been studied using molecular hybridization techniques and the cleavage of isolated restriction endonuclease fragments with further restriction endonucleases. Physical maps for the fragments produced by Hind III, Hpa-1, and X. bad have been constructed for the four related forms of the HSV-1 genome. TRs and IRs were found to be between 3.5 x 10(6) and 4.5 x 10(6) daltons, TRl and IRl about 6 x 10(6) daltons, S about 8 x 10(6) to 9 x 10(6) daltons, and L about 6.8 x 10(6) daltons.

Base Sequence↗
PubMed1985

Fine mapping and sequencing of a variable segment in the inverted repeat region of varicella-zoster virus DNA.

A strain variation in the internal and terminal repeats which bind the short unique sequence of varicella-zoster virus (VZV) DNA was found to be due to an insertion or deletion of DNA sequences at a single site. DNA sequence analysis showed that the nucleotide sequence CCGCCGATGGGGAGGGGGCGCGGTACC is tandemly duplicated a variable number of times in different VZV strains and is responsible for the observed variation in mobilities of restriction fragments from this region of VZV DNA. The variable region sequence shares some homology with tandemly repeated regions in the a and c sequences of herpes simplex virus type 1 and probably exists in a noncoding region of the VZV genome.

DNA, Viral↗
PubMed2002

Comparison of orthologous and paralogous DNA flanking the wheat high molecular weight glutenin genes: sequence conservation and divergence, transposon distribution, and matrix-attachment regions.

Extended flanking DNA sequences were characterized for five members of the wheat high molecular weight (HMW) glutenin gene family to understand more of the structure, control, and evolution of these genes. Analysis revealed more sequence conservation among orthologous regions than between paralogous regions, with differences mainly owing to transposition events involving putative retrotransposons and several miniature inverted transposable elements (MITEs). Both gyspy-like long terminal repeat (LTR) and non-LTR retrotransposon sequences are represented in the flanking DNAs. One of the MITEs is a novel class, but another MITE is related to the maize Stowaway family and is widely represented in Triticeae express sequence tags (ESTs). Flanking DNA of the longest sequence, a 20 425-bp fragment including and surrounding the HMW-glutenin Bx7 gene, showed additional cereal gene-like sequences both immediately 5' and 3' to the HMW-glutenin coding region. The transcriptional activities of sequences related to these flanking putative genes and the retrotransposon-related regions were indicated by matches to wheat and other Triticeae ESTs. Predictive analysis of matrix-attachment regions (MARs) of the HMW glutenin and several alpha-, gamma-, and omega-gliadin flanking DNAs indicate potential MARs immediately flanking each of the genes. Matrix binding activity in the predicted regions was confirmed for two of the HMW-glutenin genes.

3' Flanking Region↗
PubMed1985

Comparison of the DNA sequence and secondary structure of the herpes simplex virus L/S junction and the adeno-associated virus terminal repeat.

The defective parvovirus Adeno-associated virus (AAV) is absolutely dependent upon coinfection with either Adenovirus or Herpes Simplex Virus (HSV) for its multiplication. We have compared the terminal repeats of HSV-1F strain DNA with the terminal 200 nucleotides of AAV DNA. Our findings demonstrate similarities between portions of the HSV inverted repeats found at the L/S junction and the termini of AAV. By computer analysis we have determined potential secondary folding patterns for both genomes. The following points can be made about the a, b, and c repeats in HSV: (1) Regions b and c are complementary over a significant portion of their length. (2) The ends of a can fold back on themselves to form large secondary structures. Moreover, when the b and c homology is used to align the ends of a, the b/a and c/a junctions are within 1 base of each other. (3) The short direct repeats within a are essentially a large loop with little secondary structure. The potential implications of this structure are discussed and a model for HSV DNA replication is presented.

Base Sequence↗
PubMed2006

New functional identity for the DNA uptake sequence in transformation and its presence in transcriptional terminators.

The frequently occurring DNA uptake sequence (DUS), recognized as a 10-bp repeat, is required for efficient genetic transformation in the human pathogens Neisseria meningitidis and Neisseria gonorrhoeae. Genome scanning for DUS occurrences in three different species of Neisseria demonstrated that 76% of the nearly 2,000 neisserial DUS were found to have two semiconserved base pairs extending from the 5' end of DUS to constitute a 12-mer repeat. Plasmids containing sequential variants of the neisserial DUS were tested for their ability to transform N. meningitidis and N. gonorrhoeae, and the 12-mer was found to outperform the 10-mer DUS in transformation efficiency. Assessment of meningococcal uptake of DNA confirmed the enhanced performance of the 12-mer compared to the 10-mer DUS. An inverted repeat DUS was not more efficient in transformation than DNA species containing a single or direct repeat DUS. Genome-wide analysis revealed that half of the nearly 1,500 12-mer DUS are arranged as inverted repeats predicted to be involved in rho-independent transcriptional termination or attenuation. The distribution of the uptake signal sequence required for transformation in the Pasteurellaceae was also biased towards transcriptional terminators, although to a lesser extent. In addition to assessing the intergenic location of DUS, we propose that the 10-mer identity of DUS should be extended and recognized as a 12-mer DUS. The dual role of DUS in transformation and as a structural component on RNA affecting transcription makes this a relevant model system for assessing significant roles of repeat sequences in biology.

Conserved Sequence↗
PubMed1976

Sequence arrangement in herpes simplex virus type 1 DNA: identification of terminal fragments in restriction endonuclease digests and evidence for inversions in redundant and unique sequences.

It has been proposed by Sheldrick and Berthelot (1974) that the terminal sequences of herpes simplex virus type 1 (HSV-1) DNA are repeated in an internal inverted form and that the inverted redundant sequences delimit and separate two unique sequences, S and L. In this study the sequence arrangement in HSV-1 DNA has been investigated with restriction endonuclease cleavage, end-labeling studies, and molecular hybridization experiments. The terminal fragments in digests with restriction endonucleases Hind III, Hpa-1, EcoRI and Bum were identified and shown to be consistent with the Sheldrick and Berthelot model. Inverted fragments which contain unique sequences as well as redundant sequences, and which the model predicts, were identified by DNA-DNA hybridization studies. Further cleavage of Bum fragments with Hpa-1 also revealed inversions of the terminal sequences that contained unique sequences. The results obtained showed that the unique sequences S and L are relatively inverted in different DNA molecules in the population, resulting in the presence of four related genomes with rearranged sequences in apparently equal amounts. The redundant sequences bounding S do not share complete sequence homology with those bounding L, but hybridization studies are presented which show that the terminal 0.3% of the genome is repeated in every redundant sequence.

Base Sequence↗
PubMed1990

Organization and expression of the 16S, 23S and 5S ribosomal RNA genes from the archaebacterium Thermoplasma acidophilum.

To elucidate the organization of the transcription units encoding the 16S, 23S and 5S rRNAs in the archaebacterium Thermoplasma acidophilum, the nucleotide sequences flanking the three rRNA genes were determined, and the 5' and 3' termini of the rRNA transcripts were mapped by primer extension and nuclease S1 protection. The results show that each of the rRNAs is transcribed separately, consistent with the lack of physical proximity among them in the T. acidophilum genome. The transcription initiation sites are preceded at an interval of approximately 25 base pairs by conserved A + T-rich sequences of the form CTTATATA, which strongly resemble the archaebacterial promoter consensus, TTTAT/AATA. In all three cases, transcription termination occurs within T-rich tracts just downstream from inverted repeats which can be folded into relatively stable stem-loop structures. While no partially processed intermediates of the 16S or 5S rRNA transcripts were detected, the 23S rRNA transcript appears to be processed by a RNase III-like activity prior to final maturation. This is the only organism known in the prokaryotic world in which the 16S, 23S and 5S rRNAs are all expressed from separate transcription units.

Base Sequence↗
PubMed1997

Nucleotide sequence of the left-terminus of infectious laryngotracheitis virus (Gallid herpesvirus 1) SA-2 strain.

The nucleotide sequence of 10.6 kilobase pairs (kbp) at the leftterminus of infectious laryngotracheitis virus (ILTV) SA-2 vaccine strain was determined. Several features were elucidated, including, 102 base pair (bp) inverted repeats separated by 750 bp of unique sequence which contains an NF-1 binding site indicating that the terminal may be a site for an origin of replication. Other direct repeats were also found in this region. To the right of the inverted repeat region, a 2130 bp region was found to contain small open reading frames (ORFs) of less than 100 aa. Another potential ORF was found to the right of the region containing the small ORFs which consisted of two 184 bp direct repeats inserted into the reading frame, which would truncate the putative product. Only one copy of this repeat was found in the corresponding homologue of the wild type strain SA-0. Six other ORFs were found, which shared little or no identity to homologues of other alphaherpesviruses, suggesting that these putative genes are unique to ILTV.

Base Sequence↗
PubMed1997

Insertion of tandem direct repeats consisting of avian leukosis virus LTR sequences into the inverted repeat region of Marek's disease virus type 1 DNA.

The BC-1 strain DNA of Marek's disease virus type 1 (MDV1) at high-passage in culture was found to contain tandem direct repeats of the complete long terminal repeat (LTR) sequence of avian leukosis virus RAV0 strain as the repeat unit within the short inverted repeats of the MDV1 DNA. Since the attenuated BC-1 strain grows well in cultured cells, the insertion site for retroviral DNA sequence within the short inverted repeat of MDV1 DNA is not essential for viral growth in culture.

Animals↗
PubMed1995

Athila, a new retroelement from Arabidopsis thaliana.

An analysis of Arabidopsis thaliana heterochromatic regions allowed the identification of a new family of retroelements called Athila. These 10.5 kb elements, representing ca. 0.3% of the genome, present several features of retrotransposons and retroviruses. Athila elements are flanked by 1.5 kb long terminal repeats (LTR) that are themselves bounded by 5 bp perfect inverted repeats. These LTRs start and end with the retroviral consensus 5'TG...CA3' nucleotides. A putative tRNA-binding site and a polypurine tract are found adjacent to the 5' and 3' LTR respectively. The central domain is composed of two long open reading frames (ORFs) of 935 and 694 amino acids. Despite several indications of recent transposition activity, the translation of these ORFs failed to reveal significant homology with proteins associated to retrotransposition. We suggest that the Athila family could result from the transduction and dispersion of a cellular gene by a retrotransposon.

Amino Acid Sequence↗
PubMedDate not supplied

Characterization and nucleotide sequence of a colicin-release gene in the hic region of plasmid ColE3-CA38.

Downstream from its colicin and immunity genes (col. imm), Escherichia coli plasmid ColE3-CA38 contains a 0.81-kb DNA segment, the hic region, which is required for high colicin production. Characterization of derived plasmids, carrying the col-imm operon but varying in the hic region, showed that the latter functions in lacuna production, colicin release, cell death, and lysis. The hic gene expression after induction was shown to be dependent on the col gene promoter. The nucleotide sequence of the 0.81-kb region was determined and the hic gene localized to its imm-distal portion following an open reading frame (ORF) with no known function. There are two overlapping ORFs in that portion of the sequence, one of which was identified as the hic gene by its partial homology to lysis gene H of CloDF13. The 3' half of the hic gene is non-essential and contains a terminator-like DNA sequence. Preceding the gene, there are also inverted repeats which may attenuate its transcription.

Amino Acid Sequence↗
PubMed2003

Sequence analysis of the complete genome of rice black-streaked dwarf virus isolated from maize with rough dwarf disease.

The complete nucleotide sequences of 10 genomic segments (S1-S10) from an isolate of rice black-streaked dwarf virus causing rough dwarf disease on maize (RBSDV-Hbm) in China were determined, a total of 29,142 base pairs (bp). Each segment possessed the genus-specific termini with conserved nucleotide sequences of (+) 5'-AAGUUUUU......CAGCUNNNGUC-3' and a perfect or imperfect inverted repeat of seven to eleven nucleotides immediately adjacent to the terminal conserved sequence. While the coding strand of most RBSDV-Hbm segments contained one open reading frame (ORF), there were two non-overlapping ORFs in S7 and S9, and one small overlapping ORF downstream of the major ORF in S5. Homology comparisons suggest that S1 encodes a RNA-dependent RNA polymerase (RdRp), with 63.5% and 32.6% identity to the putative RdRp encoded by Fiji disease virus (FDV) and Nilaparvata lugens reovirus (NLRV), respectively. The proteins encoded by S2, S3, and S4 showed various degrees of similarity to those encoded by the corresponding segments of FDV or NLRV. In S5 and S6, low identities were found to those of FDV only, but not to NLRV. Sequence analyses showed that RBSDV-Hbm had the most similarities in the genome organizations and the coding assignments with a RBSDV isolated from rice in China, in which each pair of the corresponding segments shared sequence identities of 93.8-98.9% and 93.5-100% at nucleotide or amino acid levels, respectively. In addition, phylogenetic analyses suggested that RBSDV-Hbm had the closest evolutionary relationship to RBSDV in Fijivirus.

Conserved Sequence↗
PubMed1989

Detection and cloning of new HTLV-related endogenous sequences in man.

Human T-cell leukemia virus (HTLV) type I-related endogenous sequences (HRES) have been cloned from a human genomic library. HRES-1/1 is present in DNA of all normal donors examined. By nucleotide sequence analysis, HRES-1/1 contains two potential open reading frames capable of encoding a p25 and a p15. A 684 bp flanking region 5' from the first ATG codon of p25 contains a TATA-box, a poly-adenylation signal, a putative tRNA primer binding site, and inverted repeats at locations which are typical of a retroviral long terminal repeat. Phylogenetic analysis suggests that HRES-1/1 entered the genome in primates, presumably as an exogenous retrovirus. From the deduced amino acid sequence of HRES-1/1 p25, residues 6-36 show a sequence homology of 32% and 39% to gag region segments of HTLV-I and HTLV-II, while residues 104-139 display a sequence homology of 33% and 28% to the gag regions of human immunodeficiency virus type 2 (HIV-2) and feline sarcoma virus (FSV), respectively. This suggests that the original exogenous virus infecting primate may be chimeric in structure. The HRES-1/1 genomic locus is transcriptionally active in lymphoid cells, melanoma cells, and embryonic tissues.

Amino Acid Sequence↗
PubMed1991

Cloning and nucleic acid sequence of the Salmonella typhimurium pncB gene and structure of nicotinate phosphoribosyltransferase.

The pncB gene of Salmonella typhimurium, encoding nicotinate phosphoribosyltransferase (NAPRTase), was cloned on a 4.7-kb Sau3A fragment. The gene contains a 1,200-bp open reading frame coding for a 400-residue protein. Amino acid sequencing of the amino-terminal and two interior peptides of the purified protein confirmed the deduced sequence and revealed that the amino-terminal methionine residue was removed, giving a 399-residue mature protein of Mr 45,512. No signal sequence was observed in the predicted NAPRTase primary structure, suggesting that the enzyme is not periplasmic. The protein does not demonstrate clear sequence similarity to the other seven phosphoribosyltransferases of known primary structure and frustrates attempts to define a consensus 5-phosphoribosyl-1-pyrophosphate-binding region. The NAPRTase reaction is ATP stimulated, and the protein contains a carboxy-terminal sequence diagnostic of an ATP-binding site. An inverted repeat of the sequence TAAACAA observed in the proposed promoter region of pncB is also present in the promoter of nadA, which, like pncB, is also regulated by the NadR (NadI) repressor. The sequence may thus define an NadR repressor-binding site.

Amino Acid Sequence↗
PubMed1996

[Studies on midecamycin 4"-O-propionyltransferase gene structure].

A BamHI-BamHI 8.0 kb DNA fragment which contains midecamycin propionyltransferase (mpt) gene was digested with different restriction enzymes and the restriction map was made. The mpt gene was localized in a EcoRI-EcoRI-PstI3.0 kb DNA fragment by Southern blot analysis using a 2.4 kb DNA fragment of the CarE gene as a probe. The 3.0 kb DNA fragment of mpt gene was cloned into E. coli/Streptomyces shuttle vector pWHM3 and a recombinant plasmid pWFPE was obtained. S. ambofaciens(pWFPE) and S. lividans(pWFPE) can convert endogenously synthesized or exogenously added spiramycin into 4"-O-propionylspiramycin, respectively. Sequence analysis of mpt gene demonstrated an open reading frame in the EcoRI-EcoRI-PstI3.0 kb DNA fragment, which starts with ATG and ends with TGA. Mpt gene encodes a product of 388 aa. G+C mol% of mpt is 68.0 and G+C mol% of 3rd codon position is 91.5. The putative product of mpt has a identity of 67.6% and a similarity of 86.4% with CarE product. A consensus RBS GAGGT in the 6bp upstream from ATG and a promoter region were found. An inverted repeat sequence in the downstream from TGA acts as transcriptional terminator.

Acyltransferases↗