SEARCH · Search PubMed

Results for “Target sequencing”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

SourceResearch connectionFrom yearThrough year

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,279 records · Page 71Linked to original sources

PubMed2004

Metal-responsive transcription factor-1 (MTF-1) selects different types of metal response elements at low vs. high zinc concentration.

Metal-responsive transcription factor-1 (MTF-1) is a zinc finger protein with a central role in heavy metal homeostasis/detoxification. MTF-1 binds to DNA sequence motifs known as metal response elements (MREs) with a core consensus TGCRCNC. Since MTF-1 is also involved in other stress responses, we tested whether it is able to recognize different types of DNA sequence motifs. To this end we selected MTF-1-binding oligonucleotides from a collection of random sequences. Since MTF-1 binds to known target sequences at relatively high zinc concentrations, oligonucleotide selection was performed in a mammalian cell nuclear extract both at high and low zinc concentrations. Irrespective of zinc concentration, we find a robust representation of MRE consensus sequences, however with specific features. Selection was most efficient at 100 microM zinc, yielding many oligonucleotides with two MRE motifs in divergent orientation of the sequence GTGTGCATCACTTTGCGCAC (core consensus underlined). Oligonucleotides selected without zinc supplement contain a single high-affinity MRE with an extended flanking sequence of consensus TTTTGCGCACGGCACTAAAT (core consensus underlined). This low-zinc MRE motif can bind MTF-1 and induce transcription in vivo, and is less dependent on zinc than the classical MREd motif from the mouse metallothionein-I promoter. At low zinc, we also found evidence for a negative role of nuclear factor-I (NF-I/CTF-I) in MTF-1-dependent transcription. Finally, a selection in the presence of cadmium yielded no specific binding site for MTF-1, strongly supporting the concept of an indirect activation of MTF-1 by cadmium within a living cell.

Base Sequence↗

PubMed2003

Imbalancing the DNA base excision repair pathway in the mitochondria; targeting and overexpressing N-methylpurine DNA glycosylase in mitochondria leads to enhanced cell killing.

The DNA base excision repair (BER) pathway is responsible for the repair of alkylation and oxidative DNA damage. The short-patch BER pathway, beginning with the simple glycosylase N-methylpurine DNA glycosylase (MPG), is responsible for the removal of damaged bases such as 3-methyladenine and 1,N(6)-ethenoadenine from the DNA after alkylation or oxidative DNA damage. The resulting apurinic site is further processed by the other members in the pathway, resulting in the insertion of the correct nucleotide. If apurinic sites accumulate, they are mutagenic and cytotoxic to the cell. To evaluate its efficacy in sensitizing breast cancer cells to chemotherapy, MPG has been overexpressed in the breast cancer cell line, MDA-MB231. With MPG overexpression, an increase in DNA damage and increased cytotoxicity to methyl methanesulfonate as well as increased apoptosis levels was observed in these cells. Because mitochondrial DNA has been shown to be more sensitive to DNA damage than nuclear DNA, a construct containing mitochondrial-targeted MPG using the human manganese superoxide dismutase mitochondrial-targeting sequence was made. Overexpression of the mitochondrially targeted MPG dramatically increased the breast cancer cells' sensitivity to methyl methanesulfonate. In conclusion, we believe that the increase in sensitivity to DNA damage by overexpression of nuclear MPG is because of an imbalance in the BER pathway, and an even greater increase in cell sensitivity is observed when mitochondrial DNA is targeted.

Annexin A5↗

PubMed1985

The sequence specificity of bleomycin-induced DNA damage in intact cells.

Bleomycin causes lesions to DNA in intact cells and in purified DNA under appropriate conditions. Using a middle repetitive DNA sequence called alpha-DNA as a target sequence, we have compared the sequence specificity of bleomycin-induced DNA cleavage in intact human cells and in purified human DNA. Bleomycin induces numerous cleavage sites in alpha-DNA which vary widely in intensity and give rise to a complex pattern of bands on a DNA sequencing gel. Unexpectedly, the intensity and position of bleomycin-induced DNA cleavage sites are very similar in intact human cells and in purified human DNA.

Base Sequence↗

PubMed1999

Absolute quantitation of specific mRNAs in cell and tissue samples by comparative PCR.

A comparative PCR assay, for the absolute quantitation of specific mRNAs in cell and tissue samples, has been designed to overcome problems with previous techniques. cDNAs made from the RNAs are co-amplified with "competitor" plasmid templates under conditions in which reagents are not limiting at the equivalence point, thereby preventing competition between target and competitor templates and distinguishing the assay from competitive PCR assays. The cDNAs are serially diluted, and competitor templates concentrations are kept constant, rather than vice versa, as occurs in competitive PCR assays. Products from target and competitor templates are resolved by electrophoresis and measured by phosphorescent or fluorescent imagery. Both products are measured to minimize errors in the competitor:target ratio. A synthetic external standard RNA is included in the tissue lysis solution and co-purified with endogenous mRNAs, thereby being subjected to identical losses of yield during subsequent procedures. The determination of the number of copies of external standard cDNA allows inefficiencies of RNA extraction and cDNA synthesis to be taken into account. Standard concentrations of plasmids containing the endogenous target sequences are also measured, so that corrections can be made for discrepancies due to unequal amplification of target and competitor sequences. These corrections, together with the use of an external standard and the PCR conditions chosen, allow for the accurate, specific and sensitive determination of the absolute number of mRNA copies in a sample.

Animals↗

PubMed2004

ROLL: a method of preparation of gene-specific oligonucleotide libraries.

The selection of nucleic acid sequences capable of specifically and efficiently hybridizing to target sequences is crucial to the success of many applications, including microarrays, PCR and other amplification procedures, antisense inhibition, ribozyme-mediated cleavage, and RNA interference (RNAi). Methods of selection using nucleotide sequence libraries have several advantages over rational approaches using defined sequences. However, the high complexity of completely random (degenerate) libraries and their high toxicity in cell-based assays make their use in many applications impractical. Gene-specific oligonucleotide libraries, which contain all possible sequences of a certain length occurring within a given gene, have much lower complexity and, thus, can significantly simplify and accelerate sequence screening. Here, we describe a new method for the preparation of gene-specific libraries using the ligation of randomized oligonucleotide probes hybridized adjacently on target polynucleotide templates followed by PCR amplification. We call this method random oligonucleotide ligated libraries (ROLL).

Base Sequence↗

PubMed2006

RiboSubstrates: a web application addressing the cleavage specificities of ribozymes in designated genomes.

BACKGROUND: RNA-dependent gene silencing is becoming a routine tool used in laboratories worldwide. One of the important remaining hurdles in the selection of the target sequence, if not the most important one, is the designing of tools that have minimal off-target effects (i.e. cleaves only the desired sequence). Increasingly, in the current dawn of the post-genomic era, there is a heavy reliance on tools that are suitable for high-throughput functional genomics, consequently more and more bioinformatic software is becoming available. However, to date none have been designed to satisfy the ever-increasing need for the accurate selection of targets for a specific silencing reagent. RESULTS: In order to overcome this hurdle we have developed RiboSubstrates http://www.riboclub.org/ribosubstrates. This integrated bioinformatic software permits the searching of a cDNA database for all potential substrates for a given ribozyme. This includes the mRNAs that perfectly match the specific requirements of a given ribozyme, as well those including Wobble base pairs and mismatches. The results generated allow rapid selection of sequences suitable as targets for RNA degradation. The current web-based RiboSubstrates version permits the identification of potential gene targets for both SOFA-HDV ribozymes and for hammerhead ribozymes. Moreover, a minimal template for the search of siRNAs is also available. This flexible and reliable tool is easily adaptable for use with any RNA tool (i.e. other ribozymes, deoxyribozymes and antisense), and may use the information present in any cDNA bank. CONCLUSION: RiboSubstrates should become an essential step for all, even including "non-RNA biologists", who endeavor to develop a gene-inactivation system.

Animals↗

PubMed1997

Alteration of NF-kappa B p50 DNA binding kinetics by S-nitrosylation.

Nitric oxide (NO) regulates a wide variety of cellular functions, in part, by formation of S-NO bonds at critical active site thiol groups within proteins, including transcription factors. Previous studies have qualitatively demonstrated that S-nitrosothiol formation can alter transcription factor binding to the DNA recognition site. To more precisely define the effect of S-nitrosylation on transcription factor binding, the equilibrium binding constant was derived for S-nitrosylated NF-kappa B p50 (S-NO-p50) in a cell free system utilizing gel shift assays. Binding of NF-kappa B p50 subjected to the nitrosylation conditions in the absence of NaNO2 (C-p50-2) was not different from that of wild type NF-kappa B (C-p50-1). The extent of S-NO-p50 binding to its DNA target sequence was significantly decreased in comparison to that noted with C-p50-1 and C-p50-2. The binding constant was derived for each of the NF-kappa B variants: C-p50-1 = 1.01 x 10(10) M(-1); C-p50-2 = 0.92 x 10(10) M(-1); and S-NO-p50 = 0.28 x 10(10) M(-1). These data indicate that S-nitrosylation of p50 decreases its affinity for the target DNA sequence by four-fold.

Binding Sites↗

PubMed2000

N-acyl homoserine lactone binding to the CarR receptor determines quorum-sensing specificity in Erwinia.

Quorum sensing via an N-acyl homoserine lactone (HSL) pheromone controls the biosynthesis of a carbapenem antibiotic in Erwinia carotovora. Transcription of the carbapenem biosynthetic genes is dependent on the LuxR-type activator protein, CarR. Equilibrium binding of a range of HSL molecules, which are thought to activate CarR to bind to its DNA target sequence, was examined using fluorescence quenching, DNA bandshift analysis, limited proteolysis and reporter gene assays. CarR bound the most physiologically relevant ligand, N-(3-oxohexanoyl)-L-homoserine lactone, with a stoichiometry of two molecules of ligand per dimer of protein and a dissociation constant of 1.8 microM, in good agreement with the concentration of HSL required to activate carbapenem production in vivo. In the presence of HSL, CarR formed a very high molecular weight complex with its target DNA, indicating that the ligand causes the protein to multimerize. Chemical cross-linking analysis supported this interpretation. Our data show that the ability of a given HSL to facilitate CarR binding to its target DNA sequence is directly proportional to the affinity of the HSL for the protein.

Bacterial Proteins↗

PubMed2005

Evidence implying only unprimed RdRP activity during transitive gene silencing in plants.

RNA silencing is a sequence-specific RNA degradation mechanism found in most eukaryotes, where small cleavage products (siRNAs) of double stranded RNA (dsRNA) mediate silencing of genes with sequence identity to the dsRNA inducer. In several systems, silencing has been found to spread from the dsRNA inducer sequence into upstream or downstream regions of the target RNA, a phenomenon termed transitive silencing. In nematodes, silencing spreads only in the 3'-5' direction along the target mRNA by siRNAs serving as primers for cRNA synthesis by RNA-dependent RNA polymerase. In plants, transitive silencing is seen in both directions suggesting that at least some cRNA synthesis occurs by un-primed initiation at the 3' end of mRNAs. Replicating plant viruses trigger an RNA silencing defence response that degrades the viral RNA, thus tempering the virus infection. Likewise, fragments of plant genes inserted into a virus will become targets for degradation, leading to virus-induced gene silencing (VIGS) of the homologous plant mRNAs. We have analyzed the spreading of gene silencing in VIGS experiments using a transgene and two endogenous genes as targets. In Nicotiana benthamiana plants expressing a beta-glucuronidase (GUS) transgene, a Potato virus X vector carrying a 5' fragment of the GUS gene induced silencing which spread to downstream regions of the transgene mRNA including the 3'-untranslated region. Conversely, silencing induced by a 3' fragment spread only for a limited distance in the 3'-5' direction. Silencing induced by a central GUS gene fragment spread only into downstream regions. Similar analyses using the endogenous plant genes, magnesium chelatase subunit I (ChlI) and an RNase L inhibitor homologue (RLIh), revealed no spreading along target sequences. This implies that transitive silencing in plants occurs by un-primed cRNA synthesis from the 3' end of targeted (transgene) transcripts, and not by siRNA-primed cRNA synthesis.

3' Untranslated Regions↗

PubMed1988

Fluorescence in situ hybridization to interphase cell nuclei in suspension allows flow cytometric analysis of chromosome content and microscopic analysis of nuclear organization.

Fluorescence hybridization to interphase nuclei in liquid suspension allows quantification of chromosome-specific DNA sequences using flow cytometry and the analysis of the three-dimensional positions of these sequences in the nucleus using fluorescence microscopy. The three-dimensional structure of nuclei is substantially intact after fluorescence hybridization in suspension, permitting the study of nuclear organization by optical sectioning. Images of the distribution of probe and total DNA fluorescence within a nucleus are collected at several focal planes by quantitative fluorescence microscopy and image processing. These images can be used to reconstruct the three-dimensional organization of the target sequences in the nucleus. We demonstrate here the simultaneous localization of two human chromosomes in an interphase nucleus using two probe labeling schemes (AAF and biotin). Alternatively, dual-beam flow cytometry is used to quantify the amount of bound probe and total DNA content. We demonstrate that the intensity of probe-linked fluorescence following hybridization is proportional to the amount of target DNA over a 100-fold range in target content. This was shown using four human/hamster somatic cell hybrids carrying different numbers of human chromosomes and diploid and tetraploid human cell lines hybridized with human genomic DNA. We also show that populations of male, female, and XYY nuclei can be discriminated by measuring their fluorescence intensity following hybridization with a Y-chromosome-specific repetitive probe. The delay in the increase in Y-specific fluorescence until the end of S-phase in consistent with the results recorded in previous studies indicating that these sequences are among the last to replicate in the genome. A chromosome-17-specific repetitive probe is used to demonstrate that target sequences as small as one megabase (Mb) can be detected using fluorescence hybridization and flow cytometry.(ABSTRACT TRUNCATED AT 250 WORDS)

Cell Line↗

PubMed2025

Analysis of targeted and whole genome sequencing of PacBio HiFi reads for a comprehensive genotyping of gene-proximal and phenotype-associated Variable Number Tandem Repeats.

Variable Number Tandem repeats (VNTRs) refer to repeating motifs of size greater than five bp. VNTRs are an important source of genetic variation, and have been associated with multiple Mendelian and complex phenotypes. However, the highly repetitive structures require reads to span the region for accurate genotyping. Pacific Biosciences HiFi sequencing spans large regions and is highly accurate but relatively expensive. Therefore, targeted sequencing approaches coupled with long-read sequencing have been proposed to improve efficiency and throughput. In this paper, we systematically explored the trade-off between targeted and whole genome HiFi sequencing for genotyping VNTRs. We curated a set of 10 , 787 gene-proximal (G-)VNTRs, and 48 phenotype-associated (P-)VNTRs of interest. Illumina reads only spanned 46% of the G-VNTRs and 71% of P-VNTRs, motivating the use of HiFi sequencing. We performed targeted sequencing with hybridization by designing custom probes for 9,999 VNTRs and sequenced 8 samples using HiFi and Illumina sequencing, followed by adVNTR genotyping. We compared these results against HiFi whole genome sequencing (WGS) data from 28 samples in the Human Pangenome Reference Consortium (HPRC). With the targeted approach only 4,091 (41%) G-VNTRs and only 4 (8%) of P-VNTRs were spanned with at least 15 reads. A smaller subset of 3,579 (36%) G-VNTRs had higher median coverage of at least 63 spanning reads. The spanning behavior was consistent across all 8 samples. Among 5,638 VNTRs with low-coverage ( < 15), 67% were located within GC-rich regions ( > 60%). In contrast, the 40X WGS HiFi dataset spanned 98% of all VNTRs and 49 (98%) of P-VNTRs with at least 15 spanning reads, albeit with lower coverage. Spanning reads were sufficient for accurate genotyping in both cases. Our findings demonstrate that targeted sequencing provides consistently high coverage for a small subset of low-GC VNTRs, but WGS is more effective for broad and sufficient sampling of a large number of VNTRs.

Minisatellite Repeats↗

PubMed1995

Distribution of a genetically-engineered Escherichia coli population introduced into soil.

The spatial localization of the cells and the DNA of a genetically-engineered Escherichia coli population introduced into soil was investigated. Inoculated soils were size fractioned and bacterial numbers and E. coli EL1003 specific chromosomal DNA target sequences were enumerated in each fraction using plate-counting and MPN-PCR, respectively. Different numbers of either indigenous or introduced bacteria were found in each fraction indicating that their distribution in the soil was non-uniform. The distributions of the indigenous bacteria and the E. coli cells within the size fractions were significantly different: the E. coli population was mainly associated with the dispersible clay fraction (79.0%) from which only 10.7% of the indigenous bacteria were recovered. The distribution of the E. coli target DNA sequences was in agreement with the location of the cells. The different distribution of the two populations is likely to restrict genetic interactions. These results are relevant to potential interactions between native soil microflora and populations introduced into soil for competitive purposes.

Bacteria↗

PubMed2002

Anchoring hairpin ribozymes to long target RNAs by loop-loop RNA interactions.

Efficient ribozyme-mediated gene silencing requires the effective binding of a ribozyme to its specific target sequence. Stable stem-loop domains are key elements for efficiency of natural antisense RNAs. This work tests the possibility of using such naturally existing structural motifs for anchoring hairpin ribozymes when targeting long RNAs. Assays were performed with four catalytic antisense RNAs, based on the hairpin ribozyme (HP), that carried a stable stem-loop motif at their 3' end. Extensions consisted of one of the following motifs: the stem-loop II of the natural antisense RNA-CopA, its natural target in CopT, the TAR-RNA motif, or its complementary sequence alphaTAR. Interestingly, the presence of any of these antisense motifs resulted in an enhancement of catalytic performance against the ribozyme's 14-nucleotide-long target RNA (Swt). A series of artificial, long RNA substrates containing the Swt sequence and the natural TAR-RNA stem-loop were constructed and challenged with a catalytic antisense RNA carrying the TAR-complementary stem-loop. This cleaves each of these substrates significantly more efficiently than HP. The deletion of the TAR domain in the substrate, or its substitution by its complementary counterpart alphaTAR, abolishes the positive effect. These results suggest that the enhancement is owed to the interaction of both complementary stem-loop domains. Moreover, they demonstrate that the TAR domain can be used as an anchoring site to facilitate the access of hairpin ribozymes to their specific target sequences within TAR-containing RNAs.

Base Sequence↗

PubMed2006

The SWISS-MODEL Repository: new features and functionalities.

The SWISS-MODEL Repository is a database of annotated 3D protein structure models generated by the SWISS-MODEL homology-modelling pipeline. As of September 2005, the repository contained 675,000 models for 604,000 different protein sequences of the UniProt database. Regular updates ensure that the content of the repository reflects the current state of sequence and structure databases, integrating new or modified target sequences, and making use of new template structures. Each Repository entry consists of one or more 3D models accompanied by detailed information about the target protein and the model building process: functional annotation, a detailed template selection log, target-template alignment, summary of the model building and model quality assessment. The SWISS-MODEL Repository is freely accessible at http://swissmodel.expasy.org/repository/.

Computer Graphics↗

PubMed1999

The stability of DNA triplexes inside cells as studied by iodine-125 radioprinting.

We studied the stability of a DNA triplex resulting from the binding of a 38 nt long purine motif triplex-forming oligonucleotide (TFO) to a covalently closed plasmid containing a target sequence from the human HPRT gene. Our in vitro experiments showed that the triplex formed at plasmid and TFO concentrations as low as 10(-9)M. Once formed, the triplex was remarkably stable and could withstand 10 min incubation at 65 degrees C. We next delivered these TFO-plasmid complexes into cultured human cells. To monitor the TFO-plasmid complexes inside cells we applied a new technique that we call 'radioprinting'. Because the TFO was(125)I labeled, we could quantitatively monitor the triplexes by measuring(125)I-induced DNA strand breaks in the target plasmid sequence. We found that the triplexes remain stable inside the cells for at least 48 h. Based on these findings we propose using TFO for indirect labeling of intact plasmid DNA. As a demonstration, we show that the intracellular distribution of a fluorescein-labeled TFO was different when it was liposome-delivered into cultured human cells alone or in a complex with the plasmid. In the latter case, the fluorescence was detected in nearly all the cells while detection of the plasmid by use of a marker gene (beta-galactosidase) revealed expression of the gene in only half of the cells.

Base Sequence↗

PubMed2003

Chimeric RNA/DNA oligonucleotide-based site-specific modification of the tobacco acetolactate syntase gene.

Single amino acid substitutions at either of two crucial positions in acetolactate synthase (ALS) result in a chlorsulfuron-insensitive form of this enzyme and, as a consequence, a herbicide-resistant phenotype. Here, we describe the successful in vivo targeting of endogenous tobacco (Nicotiana tabacum) ALS genes using chimeric RNA/DNA and all-DNA oligonucleotides at two different locations. Similar number of conversion events with two different chimeras indicates the absence of restricting influence of genomic target sequence on the gene repair in tobacco. Chlorsulfuron-resistant plants were regenerated from calli after mesophyll protoplast electroporation or leaf tissue particle bombardment with these specifically constructed chimeras. Sequence analysis and enzyme assays proved the resulting alterations to ALS at both DNA and protein levels. Furthermore, foliar application of chlorsulfuron confirmed the development of resistant phenotypes. Lines with proline-196-alanine, threonine, glutamine, or serine substitutions or with tryptophan-573-leucine substitutions were highly resistant at both cellular and whole plant levels, whereas lines with proline-196-leucine substitutions were less resistant. The stability of these modifications was demonstrated by the continuous growth of calli on chlorsulfuron-containing medium and by the transmission of herbicide resistance to progeny in a Mendelian manner. Ability of haploid state to promote chimera-mediated conversions is discussed.

Acetolactate Synthase↗

PubMed2004

Insertion of a classical nuclear import signal into the matrix domain of the Rous sarcoma virus Gag protein interferes with virus replication.

The Rous sarcoma virus Gag protein undergoes transient nuclear trafficking during virus assembly. Nuclear import is mediated by a nuclear targeting sequence within the MA domain. To gain insight into the role of nuclear transport in replication, we investigated whether addition of a "classical " nuclear localization signal (NLS) in Gag would affect virus assembly or infectivity. A bipartite NLS derived from nucleoplasmin was inserted into a region of the MA domain of Gag that is dispensable for budding and infectivity. Gag proteins bearing the nucleoplasmin NLS insertion displayed an assembly defect. Mutant virus particles (RC.V8.NLS) were not infectious, although they were indistinguishable from wild-type virions in Gag, Gag-Pol, Env, and genomic RNA incorporation and Gag protein processing. Unexpectedly, postinfection viral DNA synthesis was also normal, as similar amounts of two-long-terminal-repeat junction molecules were detected for RC.V8.NLS and wild type, suggesting that the replication block occurred after nuclear entry of proviral DNA. Phenotypically revertant viruses arose after continued passage in culture, and sequence analysis revealed that the nucleoplasmin NLS coding sequence was deleted from the gag gene. To determine whether the nuclear targeting activity of the nucleoplasmin sequence was responsible for the infectivity defect, two critical basic amino acids in the NLS were altered. This virus (RC.V8.KR/AA) had restored infectivity, and the MA.KR/AA protein showed reduced nuclear localization, comparable to the wild-type MA protein. These data demonstrate that addition of a second NLS, which might direct MA and/or Gag into the nucleus by an alternate import pathway, is not compatible with productive virus infection.

Active Transport, Cell Nucleus↗

PubMed2003

Genomic characterization of Rim2/Hipa elements reveals a CACTA-like transposon superfamily with unique features in the rice genome.

The availability of huge amounts of rice genome sequence now permits large-scale analysis of the structure and molecular characteristics of the previously identified transposase-encoding Rim2 (also called Hipa) element, which is transcriptionally activated by infection with the fungal pathogen Magnaporthe grisea and by treatment with the corresponding fungal elicitor. Based on genomic cloning and data mining from 230 Mb of rice genome sequence, 347 Rim2 elements, with an average size of 5.8 kb, were identified. This indicates that an estimated total of 600-700 Rim2 elements are present in the whole genome. Rim2 insertions occur non-randomly on the chromosomes, as visualized by fluorescence in situ hybridization. The elements harbor 16-bp terminal inverted repeats with the core sequence CACTG, 16-bp sub-terminal repeats, internal variable regions, 3-bp target sequence duplications in the flanking regions, and genes coding for Rim2 proteins (the putative transposase) and hydroxyproline-rich glycoproteins. High levels of insertion into genic regions are observed for members of this family, and the transposition history of the family can be deduced from the high level of shared sequences and analysis of repeat target sites of the elements. Phylogenetic analysis indicates that the putative RIM2 proteins fall into a subgroup distinct from the TNP2-like subgroup of transposases. Southern hybridization with genomic DNA from monocotyledonous and dicotyledonous plants demonstrates that the RIM2-coding sequence is unique to the Oryza genome. Our results demonstrate that the Rim2 elements from rice belong to a distinct superfamily of CACTA-like elements with evolutionary diversity.

Amino Acid Sequence↗