Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “inverted terminal repeat”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,261 records · Page 70Linked to original sources
PubMed2001

Organization and transcriptional analysis of a six-gene cluster around the rplK-rplA operon of Corynebacterium glutamicum encoding the ribosomal proteins L11 and L1.

A cluster of six genes, tRNA(Trp)-secE-nusG-rplK-rplA-pkwR, was cloned and sequenced from a Corynebacterium glutamicum cosmid library and shown to be contiguous in the C. glutamicum genome. These genes encode a tryptophanyl tRNA, the protein translocase component SecE, the antiterminator protein NusG, and the ribosomal proteins L11 and L1 in addition to PkwR, a putative regulatory protein of the LacI-GalR family. S1 nuclease mapping analysis revealed that nusG and rplK are expressed as separate transcriptional units and rplK and rplA are cotranscribed as a single mRNA. A 19-nucleotide inverted repeat that appears to correspond to a transcriptional terminator was located in the 3' region downstream from nusG. Northern analysis with different probes confirmed the S1 mapping results and showed that the secE-rplA four-gene region gives rise to four transcripts. secE was transcribed as a 0.5-kb monocistronic mRNA, nusG formed two transcripts of 1.4 and 1.0 kb from different initiation sites, and the two ribosomal protein genes rplK and rplA were cotranscribed as a single mRNA of 1.6 kb. A consensus L1 protein binding sequence was identified in the leader region of the rplK-rplA transcript, suggesting that expression of the rplK-rplA cluster was regulated by autogenous regulation exerted by the L1 protein at the translation level. The promoters of the nusG and rplK-rplA genes were subcloned in a novel corynebacterial promoter-probe vector and shown to confer strong expression of the reporter gene.

Base Sequence↗
PubMed2006

Plasticity of the P junc promoter of ISEc11, a new insertion sequence of the IS1111 family.

We describe identification and functional characterization of ISEc11, a new insertion sequence that is widespread in enteroinvasive E. coli (EIEC), in which it is always present on the virulence plasmid (pINV) and very frequently also present on the chromosome. ISEc11 is flanked by subterminal 13-bp inverted repeats (IRs) and is bounded by 3-bp terminal sequences, and it transposes with target specificity without generating duplication of the target site. ISEc11 is characterized by an atypical transposase containing the DEDD motif of the Piv/MooV family of DNA recombinases, and it is closely related to the IS1111 family. Transposition occurs by formation of minicircles through joining of the abutted ends and results in assembly of a junction promoter (P juncC) containing a -10 box in the interstitial sequence and a -35 box upstream of the right IR. A natural variant of ISEc11 (ISEc11p), found on EIEC pINV plasmids, contains a perfect duplication of the outermost 39 bp of the right end. Upon circularization, ISEc11p forms a junction promoter (P juncP) which, despite carrying -10 and -35 boxes identical to those of P juncC, exhibits 30-fold-greater strength in vivo. The discovery of only one starting point in primer extension experiments rules out the possibility that there are alternative promoter sites within the 39-bp duplication. Analysis of in vitro-generated transcripts confirmed that at limiting RNA polymerase concentrations, the activity of P juncP is 20-fold higher than the activity of P juncC. These observations suggest that the 39-bp duplication might host cis-acting elements that facilitate the binding of RNA polymerase to the promoter.

Base Sequence↗
PubMed1980

Human cytomegalovirus DNA: physical maps for restriction endonucleases BglII, hindIII and XbaI.

It is proposed that the genome of human cytomegalovirus (HCMV) consists of two unique sequences, L and S, bounded by two sets of redundant sequences (P. Sheldrick et al. unpublished data). In this arrangement the terminal sequences (TR1 and TR8) are repeated in an intenal inverted form (IR1 and IR8) and delimit L and S. After restriction endonuclease cleavage of the DNA, four o.5 M and four 0.25 M fragments are found, indicating that HCMV DNA preparations consist of four equimolar populations differing only in the relative orientation of the L and S components. Cleavage of the CMV DNA with the restriction endonucleases BglII, HindIII and XbaI results in 32, 27 and 21 fragments, respectively. The arrangement of these fragments has been determined using molecular hybridization techniques, identification of terminal fragments and the identification of linkage groups by double-digestion. In this report the physical maps for the restriction endonucleases BglII, HindIII and XbaI are presented.

Base Sequence↗
PubMed1990

Cloning of the human parvovirus B19 genome and structural analysis of its palindromic termini.

We describe the molecular cloning of the entire 5.6-kb single-stranded DNA genome of the human parvovirus B19 in bacterial plasmids. Stable amplification of the recombinant plasmid DNA was achieved in Escherichia coli JC8111 but not in HB101 cells. Sequence analysis of the cloned DNA shows that the terminal 383 nucleotides at each end of the genome are identical inverted repeats. The distal 365 nucleotides of the repeat represent an imperfect palindrome which presumably folds over to form a hairpin structure. The sequence of the hairpin occurs in two distinct configurations which are related in that one is the inverted complement of the other. Such alternative configurations of the terminal hairpins have been found for all parvoviruses analyzed so far and are referred to as flip and flop.

Base Sequence↗
PubMed1980

Terminal nucleotide sequences of Tn551, a transposon specifying erythromycin resistance in Staphylococcus aureus: homology with Tn3.

The erythromycin resistance determinant of Staphylococcus aureus plasmid pI258 resides on a 5.3 kb transposon, Tn551. We have determined DNA sequences surrounding the junctions between the transposon and the flanking DNA in the wild-type plasmid, in an insertion into a second plasmid, and in two transposon-related deletions. The ends of the transposon consist of an inverted repeat of 40 base pairs flanked by a direct repeat of 5, thus placing the transposon in the same class as Tn3, IS2, Tn501, gamma delta, and bacteriophage Mu. Interestingly, we find that the terminal sequences of the 40 base pairs inverted repeat are very similar to the ends of Tn3, a transposon which one would not have expected to show any relation to Tn551. This result suggests common ancestry for Tn3 and Tn551. The inverted repeat sequence of Tn551 also contains (with one additional inserted base) the internal heptanucleotide sequence which has been found to be common to most of the transposable elements that generate 5-base pair direct repeat sequences.

Base Sequence↗
PubMed1998

Regulation of the bacteriophage Mu gem operon.

The gem operon of bacteriophage Mu, responsible for the complex phenomenon of phage conversion, is included in the so called "semiessential early" region of phage DNA. Unlike the other early genes of the phage which are transcribed from the pe promoter, expression of the gem operon is driven by its own promoter, which escapes the control of the repressor. In fact, the transcript corresponding to gem was detected in immune lysogens by using a combined reverse transcription and a subsequent amplification of the resulting cDNA. The transcription initiation site from pgem was determined by primer extension mapping experiments and localized at 8217 bp from the left end of phage DNA. Two elements which could perform the negative control of gem were also identified. The first is a phage product, GemB, which presumably interferes with gem expression at a posttranscriptional level, whereas the second is a structural element, an inverted repeat immediately downstream of pgem, which acts as a terminator for the transcripts starting from pe. These transcripts could regulate gem expression by interfering with the initiation of transcription from pgem.

Bacteriophage mu↗
PubMed1999

Genetic characterization of plasmids containing genes encoding enzymes of leucine biosynthesis in endosymbionts (Buchnera) of aphids.

The prokaryotic endosymbionts (Buchnera) of aphids are known to provision their hosts with amino acids that are limiting in the aphid diet. Buchnera from the aphids Schizaphis graminum and Diuraphis noxia have plasmids containing leuABCD, genes that encode enzymes of the leucine biosynthetic pathway, as well as genes encoding proteins probably involved in plasmid replication (repA1 and repA2) and an open reading frame (ORF1) of unknown function. The newly reported plasmids closely resemble a plasmid previously described in Buchnera of the aphid Rhopalosiphum padi [Bracho AM, Martínez-Torres D, Moya A, Latorre A (1995) J Mol Evol 41:67-73]. Nucleotide sequence comparisons indicate conserved regions which may correspond to an origin of replication and two promoters, as well as inverted repeats, one of which resembles a rho-independent terminator. Phylogenetic analyses based on amino acid sequences of leu gene products and ORF1 resulted in trees identical to those obtained from endosymbiont chromosomal genes and the plasmid-borne trpEG. These results are consistent with a single evolutionary origin of the leuABCD-containing plasmid in a common ancestor of Aphididae and the lack of plasmid exchange between endosymbionts of different aphid species. Trees for ORF1 and repA (based on both nucleotides and amino acids) are used to examine the basis for leu plasmid differences between Buchnera of Thelaxes suberi and Aphididae. The most plausible explanation is that a single transfer of the leu genes to an ancestral replicon was followed by rearrangements. The related replicon in Buchnera of Pemphigidae, which lacks leuABCD, appears to represent the ancestral condition, implying that the plasmid location of the leu genes arose after the Pemphigidae diverged from other aphid families. This conclusion parallels previously published observations for the unrelated trpEG plasmid, which is present in Aphididae and absent in Pemphigidae. Recruitment of amino acid biosynthetic genes to plasmids has been ongoing in Buchnera lineages after the infection of aphid hosts.

Animals↗
PubMed1999

Cis requirements for transposition of Tc1-like transposons in C. elegans.

The Caenorhabditis elegans transposons Tc1 and Tc3 are able to transpose in heterologous systems such as human cell lines and zebrafish. Because these transposons might be useful vectors for transgenesis and mutagenesis of diverse species, we determined the minimal cis requirements for transposition. Deletion mapping of the transposon ends shows that fewer than 100 bp are sufficient for transposition of Tc3. Unlike Tc1, Tc3 has a second, internal transposase binding site at each transposon end. We found that these binding sites play no major role in the transposition reaction, since they can be deleted without reduction of the transposition frequency. Site-directed mutagenesis was performed on the conserved terminal base pairs at the Tc3 ends. The four terminal base pairs at the ends of the Tc3 inverted repeats were shown to be required for efficient transposition. Finally, increasing the length of the transposon from 1.9 kb to 12.5 kb reduced the transposition frequency by 20-fold, both in vivo and in vitro.

Animals↗
PubMed2003

Characterization of two rice DNA methyltransferase genes and RNAi-mediated reactivation of a silenced transgene in rice callus.

Two genomic clones ( OsMET1-1, AF 462029 and OsMET1-2, TPA BK001405), each encoding a cytosine-5 DNA methyltransferase (MTase), were isolated from rice ( Oryza sativa L.) BAC libraries. OsMET1-1 has an open reading frame of 4,566 nucleotides with 12 exons and 11 introns while OsMET1-2 has an open reading frame of 4,491 nucleotides with 11 exons and 10 introns. Although OsMET1-1 and OsMET1-2 have high sequence similarity overall, they share only 24% identity in exon 1, and intron 3 of OsMET1-1 is absent from OsMET1-2. As for other eukaryotic DNA MTases of the Dnmt1/MET l class, the derived amino acid sequences of OsMET1-1 and OsMET1-2 suggest that they are comprised of two-thirds regulatory domain and one-third catalytic domain. Most functional domains identified for other MTases were present in the rice MET1 sequences. Amino acid sequence comparison indicated high similarity (56-75% identity) of rice MET1 proteins to other plant MET1 sequences but limited similarity (approx. 24% identity) to animal Dnmt1 proteins. Genomic blot and database analysis indicated the presence of a single copy of OsMET1-1 (on chromosome 3) and single copy of OsMET1-2 (on chromosome 7). Ribonuclease protection assays revealed expression of both OsMET1-1 and OsMET1-2 in highly dividing cells, but the steady-state level of OsMET1-2 was 7- to 12-fold higher than that for OsMET1-1 in callus, root and inflorescence. The functional involvement of the rice DNA MTases in gene silencing was investigated using an RNAi strategy. Inverted repeat constructs of either the N- or C-terminal regions of OsMET1-1 were supertransformed into calli derived from a rice line bearing a silenced 35S-uidA-nos transgene. Restoration of uidA expression in the bombarded calli was consistent with the inactivation of maintenance methylation and with previous evidence for the involvement of methylation in silencing of this line.

Base Sequence↗
PubMed1992

Small single-copy region of plastid DNA in the non-photosynthetic angiosperm Epifagus virginiana contains only two genes. Differences among dicots, monocots and bryophytes in gene organization at a non-bioenergetic locus.

We have determined the nucleotide sequence of a 7 kb (1 kb = 10(3) base-pairs) region that includes the entire small single-copy region (SSC) of the plastid genome of Epifagus virginiana, a non-photosynthetic, parasitic flowering plant. The SSC (4.8 kb) is considerably smaller than those of photosynthetic plants due to the complete deletion of all photosynthetic, chlororespiratory and ribosomal protein genes. This leaves only two genes: a protein gene of 1738 codons whose product is unlikely to be involved in bioenergetic processes and a leucine tRNA gene (trn(LUAG)). Both genes span junctions between the inverted repeat and the SSC, with the consequence that the terminal 20 base-pairs of the repeat is transcribed in both directions and functions both as the 3' end of the tRNA gene and as an internal segment of orf1738. We find that the region of tobacco plastid DNA homologous to Epifagus orf1738 contains a single open reading frame (ORF) of 1901 codons rather than the three ORFs of 1244, 273 and 228 codons originally reported. However, we confirm that the equivalent region of the bryophyte Marchantia contains two genes (1068 and 464 codons) corresponding to the N and C-terminal portions of the dicot protein. In contrast, rice plastid DNA contains a severely truncated pseudogene at this locus.

Amino Acid Sequence↗
PubMed1986

Nucleotide sequence of the pepN gene encoding aminopeptidase N of Escherichia coli.

We have sequenced a 3.3-kb fragment of the Escherichia coli chromosome that contains pepN gene encoding aminopeptidase N. This gene codes for a protein of 870 amino acid residues. From the size of the pepN transcript and the presence of inverted repeats in the nucleotide (nt) sequence, a putative transcription terminator has been identified. The N-terminal amino acid sequence deduced from the pepN nt sequence corresponds to the N-terminal sequence of the purified protein; the amino acid composition of the protein is also in good agreement with that deduced from the gene sequence. No obvious homology with previously sequenced peptidases has been detected.

Amino Acid Sequence↗
PubMed2005

A suppressor mutation in the alpha-phycocyanin gene in the light/glucose-sensitive phenotype of the psbK-disruptant of the cyanobacterium Synechocystis sp. PCC 6803.

psbK encodes a small transmembrane component of PSII. Here we report that the psbK-disruptant of Synechocystis sp. PCC 6803 cannot survive under photomixotrophic conditions of light and glucose after transient growth, while the wild type is able to grow. A spontaneous yellow-green mutant that recovered the sustained growth under the same conditions was isolated from the psbK-disruptant. Instead of recovery, the mutant largely lost photoautotrophic growth. By phenotype complementation, the mutation was identified in cpcA as a sequence replacement with a close downstream segment, generating an inverted repeat of 23 bp. The mutant phenotype was characterized by (i) the complete loss of alpha- and beta-phycocyanin; (ii) increased accumulation of PSII; and (iii) greatly reduced transcripts harboring cpcA in abundance and in size. The inverted repeat generated in cpcA probably led to the early termination of transcription. A possible mechanism for such a mutation is discussed.

Amino Acid Sequence↗
PubMed1991

Molecular analysis of rice dwarf phytoreovirus segment S11 corresponding to wound tumour phytoreovirus segment S12.

The complete nucleotide sequence of rice dwarf phytoreovirus (RDV) genome segment S11 was determined. S11 is 1067 nucleotides long. There is an inverted repeat of 10 bp adjacent to the conserved 5'-terminal hexanucleotide (5' GGUAAA 3') and 3'-terminal tetranucleotide (5' UAGU 3') sequences. A single large open reading frame found in the plus strand of S11 begins with the first AUG codon (bases 6 to 8) and extends for 567 bases. Evolutionary relatedness between RDV S11 and wound tumour phytoreovirus S12 based on amino acid sequence similarity (25.8%) was found. In addition to the first AUG triplet, RDV S11 possesses a second in-phase AUG triplet (positions 30 to 32) nearby, which conforms to the Kozak consensus sequence. Two forms of the protein were identified by using an in vitro transcription and translation system in which a tailored full-length cDNA was the initial template. The abolition of the first AUG codon by site-directed mutagenesis resulted in disappearance of the larger translation product. These results strongly suggest that the two products are translated from the first and second AUG codons. Whether the two proteins are expressed in vivo is at present unclear.

Amino Acid Sequence↗
PubMed1987

Regulation, initiation, and termination of the cenA and cex transcripts of Cellulomonas fimi.

We characterized the in vivo transcripts of two Cellulomonas fimi genes, the cenA gene, which encodes an extracellular endo-beta-1,4-glucanase (EC 3.2.1.4) and the cex gene, which encodes an extracellular exo-beta-1,4-glucanase (EC 3.2.1.91). By Northern blot analysis, cenA mRNA was detected in C. fimi RNA preparations from glycerol- and carboxymethyl cellulose-grown cells but not from glucose-grown cells. In contrast, cex mRNA was detected only in the preparations from carboxymethyl cellulose-grown cells. Therefore, the transcription of these genes is subject to regulation by the carbon source provided to C. fimi. By nuclease S1 protection studies with unique 5'-labeled DNA probes and C. fimi RNA isolated in vivo, 5' termini were found 51 and 62 bases before the cenA translational initiation codon and 28 bases before the cex translational initiation codon. S1 mapping with unlabeled DNA probes and C. fimi RNA which had been isolated in vivo but which had been 5' labeled in vitro with guanylyltransferase and [alpha-32P]GTP confirmed that true transcription initiation sites for cenA and cex mRNA had been identified. Comparative analysis of the DNA sequences immediately upstream of the initiation sites of the cenA and cex mRNAs revealed a 30-base-pair region where these two sequences display at least 66% homology. S1 mapping was also used to locate the 3' termini of the cenA and cex transcripts. Three 3' termini were found for cenA messages, whereas only one 3' terminus was identified for cex mRNA. The transcripts of both genes terminate in regions where their corresponding DNA sequences contain inverted repeats.

Bacteria, Anaerobic↗
PubMed1993

RepR protein expression on plasmid pIP501 is controlled by an antisense RNA-mediated transcription attenuation mechanism.

Expression of the rate-limiting initiator protein RepR of plasmid pIP501 is controlled by the antisense RNAIII. Mutational alteration of individual G residues within the single-stranded loops of RNAIII led to an increase in copy number. In contrast to the G-rich single-stranded loops, two smaller AT-rich loops of RNAIII were found to be dispensable for its inhibitory function. Reciprocal mutations in the same loop compensated for each other's effect, and a destabilization of the major stem structure of RNAIII also resulted in an increased copy number. These data were consistent with the idea that the interaction of RNAIII with its target starts with the formation of a kissing complex between the single-stranded loops of both molecules. The repR mRNA leader sequence, which includes the target of RNAIII, is able to assume two alternative structures due to the presence of two inverted repeats the individual sequences of which are mutually complementary. In the presence of the antisense RNAIII, one of these inverted repeats (IR2) is forced to fold into a transcriptional terminator structure that prevents transcription of the repR gene. In the absence of RNAIII, formation of the transcriptional terminator is prevented and expression of the essential repR gene can proceed normally. This antisense RNA-driven transcriptional attenuation mechanism was supported by extensive deletional analysis and direct evidence that IR2 functions as a transcriptional terminator.

Bacterial Proteins↗
PubMed1997

Mutational analysis of the R64 oriT region: requirement for precise location of the NikA-binding sequence.

Conjugative DNA transfer of IncI1 plasmid R64 is initiated by the introduction of a site- and strand-specific nick into the origin of transfer (oriT). In R64 oriT, 17-bp (repeat A and B) and 8-bp inverted-repeat sequences with mismatches are located 8 bp away from the nick site. The nicking is mediated by R64 NikA and NikB proteins. To analyze the functional organization of the R64 oriT region, various deletion, insertion, and substitution mutations were introduced into a 92-bp minimal R64 oriT sequence and their effects on oriT function were investigated. This detailed analysis confirms our previous prediction that the R64 oriT region consists of an oriT core sequence and additional sequences necessary for full oriT activity. The oriT core sequence consists of the repeat A sequence, which is recognized by R64 NikA protein, and the nick region sequence, which is conserved among various origins of transfer and is most probably recognized by NikB protein. The oriT core sequence is sufficient for NikAB-mediated oriT-specific nicking. Furthermore, it was shown that the repeat A sequence is essential for localization to a precise position relative to the nick site for oriT function. This seems to be required for the formation of a functional ternary complex consisting of NikA and NikB proteins and oriT DNA. The repeat B sequence and 8-bp inverted repeat sequences are suggested to be required for the termination of DNA transfer.

Bacterial Proteins↗
PubMed1976

Physical maps for Herpes simplex virus type 1 DNA for restriction endonucleases Hind III, Hpa-1, and X. bad.

It has been proposed that the genome of herpes simplex virus type 1 (HSV-1) consists of two internal unique sequences, S and L, bounded by two sets of redundant sequences (P. Sheldrick and N. Berthelot, 1974). In this arrangement, terminal sequences (TRs and TRl) are repeated in an internal inverted form (IRs and IRl) and delimit S and L. Furthermore, a body of evidence has accumulated that suggests that S and L themselves are inverted, giving rise to four related forms of the HSV genome. In this study the ordering of restruction endonuclease fragments of HSV-1 DNA for physical maps has been studied using molecular hybridization techniques and the cleavage of isolated restriction endonuclease fragments with further restriction endonucleases. Physical maps for the fragments produced by Hind III, Hpa-1, and X. bad have been constructed for the four related forms of the HSV-1 genome. TRs and IRs were found to be between 3.5 x 10(6) and 4.5 x 10(6) daltons, TRl and IRl about 6 x 10(6) daltons, S about 8 x 10(6) to 9 x 10(6) daltons, and L about 6.8 x 10(6) daltons.

Base Sequence↗
PubMed1985

Fine mapping and sequencing of a variable segment in the inverted repeat region of varicella-zoster virus DNA.

A strain variation in the internal and terminal repeats which bind the short unique sequence of varicella-zoster virus (VZV) DNA was found to be due to an insertion or deletion of DNA sequences at a single site. DNA sequence analysis showed that the nucleotide sequence CCGCCGATGGGGAGGGGGCGCGGTACC is tandemly duplicated a variable number of times in different VZV strains and is responsible for the observed variation in mobilities of restriction fragments from this region of VZV DNA. The variable region sequence shares some homology with tandemly repeated regions in the a and c sequences of herpes simplex virus type 1 and probably exists in a noncoding region of the VZV genome.

DNA, Viral↗