Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Genotypes”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,261 records · Page 70Linked to original sources
PubMed1994

Significance of specific antibody assay for genotyping of hepatitis C virus.

Group I and II hepatitis C virus genotypes were determined by a newly developed serological genotyping assay. This assay detected antibodies against group-specific recombinant proteins in the putative NS4 protein region (amino acid no. 1676-1760) by an enzyme-linked immunosorbent assay. This region of the hepatitis C virus peptide has many group-specific amino acids; fewer than 50% of these amino acids are identical between groups I and II. Genotypes determined by the serological genotyping assay were compared with those determined by a method in which the polymerase chain reaction was used in 91 chronic hepatitis patients. The group-specific polymerase chain reaction was performed within the genome region corresponding to the putative NS5 protein, where the group II hepatitis C virus genome is 57 nucleotides longer than that of group I. Among 91 chronic hepatitis C patients who had positive results in the second-generation hepatitis C virus antibody (core and NS3 region) assay, hepatitis C virus RNA was detected in 80 patients by polymerase chain reaction in the 5' untranslated region and in 78 patients by this group-specific polymerase chain reaction. As a result, in 76 of 91 patients (84%) genotypes determined by the serological genotyping assay showed complete agreement with those determined by the group-specific polymerase chain reaction, and none of the patients revealed a group opposite to that of hepatitis C virus genotype. The detection rate of the serological genotyping assay (89 of 91; 98%) was even higher than that of the polymerase chain reaction assay (78 of 91; 86%).(ABSTRACT TRUNCATED AT 250 WORDS)

Adult↗
PubMed1995

Characterization of the third most common genotype of hepatitis C virus in France.

We have previously identified the two major hepatitis C virus (HCV) genotypes prevalent in France (type I and type II). We report here the identification and partial characterization of a new HCV genotype with a highly divergent 5' noncoding (NC) region and a structural protein region. This genotype showed only 93-94% sequence identity with either type I or type II HCV in the 5' NC region. Sequence analysis of the structural protein region revealed extremely low sequence homology with all the four major HCV genotypes: 86-89% for the core protein and 56-69% for the envelope protein. However, further analysis revealed that this new genotype was very similar to the genotype 3a described most recently. Screening of 150 clinical samples with genotype-specific oligoprobes revealed prevalence of this genotype in 12% of the French samples with a significant association with drug addiction and a good response to interferon therapy. These results may have implications for the diagnosis of HCV infection and the design of HCV vaccines.

Amino Acid Sequence↗
PubMed1995

Angiotensin-I converting enzyme genotype DD is a risk factor for coronary artery disease.

BACKGROUND: Coronary artery disease (CAD) is a polygenic disease whose phenotypic manifestation is due to interaction of a number of environmental factors with an underlying genetic background. A number of genes, including the angiotensin-I converting enzyme (ACE) gene, have been implicated in the pathogenesis of CAD. ACE can affect oxidation of LDL, endothelial cell function, and smooth muscle cell migration and proliferation: all important components of atherosclerosis. A variant of ACE gene, genotype DD is associated with a higher plasma level of ACE and an increased risk of myocardial infarction, and cardiomyopathies. In this study, we sought to determine the distribution of ACE genotypes and the frequency of allele D in patients with CAD undergoing coronary angioplasty. METHODS: DNA from 182 white patients undergoing coronary angioplasty and 338 apparently healthy white individuals was amplified by polymerase chain reaction (PCR) in the region of the polymorphism using the previously published protocol. RESULTS: PCR amplification of alleles I and D resulted in 490 bp and 190 bp products, respectively. ACE genotype DD was present in 47% of patients with CAD as compared to 30% in the general population (p = 0.0002, Odds ratio 2.7). The frequency of allele D was 0.68 in patients with CAD and 0.55 in general population, respectively (p < 0.0001). Genotype DD was associated with CAD only in males (54% vs. 30%, p = 0.0001, Odds ratio 2.0), but not in female patients. There was no association between the frequency of ACE genotype DD and the prior history of myocardial infarction, or the extent of CAD. The frequency of ACE genotype DD was the highest among patients with restenosis following angioplasty (55%), however, the difference was not significantly changed as compared to those without restenosis (40%). CONCLUSIONS: ACE genotype DD is more common in patients with CAD as compared to the general population, indicating that genotype DD is a genetic risk factor for CAD.

Base Sequence↗
PubMed1994

The role of genotype, genomic imprinting, and sex hormones in platelet and megakaryocyte production.

Our previous data suggested that the higher average ploidy of C3H mouse megakaryocytes is the result of interaction of multiple alleles that act in an additive fashion. Average megakaryocyte DNA content increased with the proportion of C3H genotype. Other factors also influence megakaryocyte ploidy; male mice had megakaryocytes of higher ploidy than did female mice, and the genes that determine megakaryocyte ploidy had a differential expression, depending on the sex of the parent, a finding that suggests genomic imprinting. The role of genotype (and, thus, megakaryocyte DNA content) on other parameters of platelet production and megakaryocytopoiesis has not been examined. Therefore, we report the effects of genotype on platelet counts, platelet sizes, percent 35S incorporation into platelets, total circulating platelet counts (TCPC), total circulating platelet masses (TCPM), megakaryocyte size and number, and total megakaryocyte masses (TMM). Platelet counts of male mice were inversely related to the proportion of C3H genotype. In other words, male mice with a higher proportion of C3H genotype had lower platelet counts than did male mice with predominantly C57BL genotype (p = 0.04). None of the other platelet production indices were significantly correlated with the C3H genotype content of the offspring. However, a significantly positive correlation (p < 0.0001 for males and p < 0.003 for females) was found between megakaryocyte size and megakaryocyte ploidy. Although no significant difference in megakaryocyte numbers was noted, TMM of male mice was positively correlated (p < 0.05) with megakaryocyte ploidy. Male mice had higher platelet counts, percent 35S incorporation into platelet values, TCPC, and TCPM than did female mice, but platelet sizes were the same for both sexes. Megakaryocyte sizes, numbers, and TMM were higher in male than female offspring of some matings, but in several cases, sex did not appear to affect these parameters. Previous work has shown that this difference in platelet production capabilities due to sex of the mouse is most likely caused by male sex hormones. Evidence of different genetic expression (genomic imprinting), depending on the sex of the parent, was found in platelet counts and TCPC of certain backcrosses of female mice and in platelet sizes of male mice (p < 0.05). Therefore, we show that genotype, male sex hormones, and genomic imprinting influence platelet production in mice, but platelet counts of male mice were negatively correlated with size and DNA content of megakaryocytes.

Animals↗
PubMed1993

[ABO genotyping by polymerase chain reaction (PCR) and its application to paternity testing].

The authors describe the usefulness of ABO genotyping by polymerase chain reaction (PCR) in paternity testing. Blood samples were obtained from 80 unrelated Japanese (20 samples in each of phenotypes of the ABO blood group system) and 13 cases of disputed paternity. PCR amplification of DNA extracted from blood by a conventional extraction procedure was carried out using the primers (primer 1: CACCGTGGAAGGATGTCCTC; primer 2: AATGTCCACAGTCACTCGCC; primer 3: TGGAGATCCTGACTCCGCTG; primer 4: GTAGAAATCGCCCTCGTCCTT) described by Lee and Chang (J Forensic Sci, Vol. 37). The amplified DNA products using primer 1 and 2 and the amplified DNA products using primer 3 and 4 were digested with Kpn I and Alu I, respectively. The amplified and digested DNA products were then analysed by electrophoresis on polyacrylamide gels. The bands on gels stained with ethidium bromide were observed with UV light and with silver staining. In 20 samples of phenotype A, genotype AA was recognized in five samples and the others were genotype AO. In 20 samples of phenotype B, three samples were genotype BB and the others were genotype BO. According to this procedure, genotypes of phenotype AB and O were clearly and consistently confirmed. In 13 cases of disputed paternity, the paternity of six cases was excluded with some of red cell, serum protein, enzyme genetic markers and HLA systems except ABO phenotype. However, the paternity of three cases out of these six cases was excluded with ABO genotype. This study seems to support the usefulness of ABO genotyping by PCR in paternity testing.

ABO Blood-Group System↗
PubMed1996

A genotype study of the c-Ha-ras-1 locus in human bladder tumors.

PURPOSE: To clarify the role of the c-Ha-ras-1 gene in bladder cancer predisposition and prognosis. MATERIALS AND METHODS: The c-Ha-ras-1 locus was studied by Southern blotting in white blood cells and tumor samples obtained from 126 patients with bladder cancer (74 Ta-T1 and 52 T2-T4). A comparison with 84 unaffected patients and a survival analysis were performed. RESULTS: The patients with bladder cancer presented 7 different c-Ha-ras-1 alleles, 12 different genotypes, heterozygosity in 49% of cases and a loss of heterozygosity (in the tumor) in 13 cases. The most frequent allele (a1, 6.6 kb) was present in 83% of patients. Heterozygosity correlated with vascular invasion in the tumor (p < 0.0001). In the small subgroup of 11 patients with rare alleles and genotypes, these alleles and genotypes occurred more often in patients with T2-T4 tumors (p < 0.01 for alleles and genotypes), aneuploid tumors (p < 0.001, p < 0.005) and tumors with vascular invasion (p < 0.01, p < 0.005). However, in this study, the majority of patients with high risk tumors possessed common alleles and genotypes. Survival analysis showed that neither the c-Ha-ras-1 genotype nor allelomorphism was an independent prognostic factor. Elsewhere, no rare allele occurred more frequently in bladder cancer affected patients than in unaffected patients. CONCLUSION: This study confirms c-Ha-ras-1 gene polymorphism in a bladder cancer affected population and, in some cases, a loss of genetic material in the vicinity of this locus. No specific genotype can be implicated in the predisposition to bladder carcinoma, and c-Ha-ras-1 genotyping appears of limited value in the clinical management of these patients.

Chromosome Mapping↗
PubMed1996

Genotypes of alcohol-metabolizing enzymes and the risk for alcoholic chronic pancreatitis in Japanese alcoholics.

Genetic predisposition to alcoholism and alcoholic liver disease has been reported. However, genetic susceptibility to alcoholic pancreatitis is still a matter of debate. To determine it, we examined genotype patterns of aldehyde dehydrogenase (ALDH2), alcohol dehydrogenase (ADH2 and ADH3), and cytochrome P-4502E1 (CYP2E1) in alcoholic pancreatitis patients. In 296 alcoholic patients, 52 cases showed findings of chronic pancreatitis by ultrasonography and x-ray computed tomography and/or had a history of pancreatitis (P+). The remaining 244 patients had neither abnormal findings of the image examinations nor a history of pancreatitis (P-). As for the ADH2 genotype, distribution of 2(1)/2(1), 2(1)/2(2), and 2(2)/2(2) was 22, 37, and 42% in P+ patients, whereas 34, 35, and 30% in P- patients, respectively. The frequency of ADH2(2)/2(2) genotype was significantly higher in P+ patients, compared with that in P- patients. There were no significant differences in the distribution of ADH3, ALDH2, and CYP2E1 genotypes between P+ and P- patients. In 14 alcoholic patients who showed low contents of fecal chymotrypsin, which suggests dysfunction of pancreatic exocrine, the rate of ADH2(2)/2(2) genotype also tended to be higher (50%) than in 74 controls who showed normal contents of the fecal chymotrypsin (28%). No differences were observed in genotypes of ADH3, ALDH2, and CYP2E1. Moreover, the frequency of ADH2(2)/2(2) genotype was significantly higher in autopsy cases with interlobular fibrosis in the pancreas, which suggests alcoholic pancreatic damage, than in cases with only intralobular pancreatic fibrosis. These data suggest that the risk of alcoholic pancreatitis seems to be associated with the presence of ADH2(2)/2(2) genotype.

Adult↗
PubMed1997

Elevated levels of hemoglobin-associated acetaldehyde related to alcohol drinking in the atypical genotype of low Km aldehyde dehydrogenase.

Acetaldehyde is suspected to be the ultimate carcinogen in alcohol-related carcinogenesis. The atypical genotypes of low Km aldehyde dehydrogenase (ALDH2) have higher blood concentrations of free acetaldehyde after drinking alcohol. We measured levels of acetaldehyde reversibly bound to hemoglobin (HbAA) after drinking 0.4 ml/kg ethanol using fluorigenic high performance liquid chromatography method in volunteers with the two major ALDH2 genotypes. In the ALDH2*1/*1 genotype with high ALDH2 activity, the increase of HbAA was small. By contrast, in the ALDH2*1/*2 genotype with low ALDH2 activity, HbAA increased considerably at 1-6 h after the drink, and the elevated levels persisted up to 48 h. We also measured HbAA in 81 male workers. Although HbAA levels were significantly correlated with alcohol consumption levels in both of the ALDH2 genotypes, the slope was significantly steeper in the ALDH2*1/*2 genotype than in the ALDH2*1/*1 genotype. In summary, we demonstrated for the first time a significant difference in the increase of HbAA levels after drinking alcohol, depending on the ALDH2 genotype. The HbAA levels are not only a good biomarker for increased internal exposure levels to acetaldehyde but may also be a predictive biomarker for acetaldehyde-mediated carcinogenesis.

Acetaldehyde↗
PubMed1996

Improved amplification system for detection of hepatitis C virus genome that simultaneously differentiates viral genotypes.

An improved system for amplification of hepatitis C virus genome (HCV) was developed based on a multiplex nested polymerase chain reaction format. Two sets of oligonucleotide primers were used simultaneously. One was derived from the conserved sequences in the 5' non-coding region of the viral genome which can bind to the viral genome of all genotypes. The other set of primers was designed from a sequence in the nonstructural-5 region of HCV. HCV genotypes 1 and 3 can be differentiated by the banding patterns of amplified DNA products. All of 39 samples containing the HCV genotype 1 could be amplified with primers in the 5' non-coding region only, whereas 92% of those with genotype 3 could be amplified by both primer sets. In addition, HCV RNA can be detected in 81% of 84 anti-HCV-positive blood donors and in 0% of 34 anti-HCV-negative cases. Of the HCV RNA-positive specimens, 69% showed genotype 1-like patterns while 31% showed genotype 3-like patterns. The detection rate of HCV RNA in this study was much higher than that in our previous report due to the improvement of new primers which can detect all genotypes of the virus. In conclusion, this improved amplification system is a sensitive method for rapid identification of HCV RNA in clinical specimens that can simultaneously differentiate the two most common genotypes of HCV found in Thailand.

Blood Donors↗
PubMed1997

The immunoreactivity profile of different HCV genotypes on immunoblot assay and its implications in the development of diagnostic assays.

The immunoreactivity profiles of plasma samples obtained from patients infected with different hepatitis C virus (HCV) genotypes were studied using immunoblot assay containing multiple HCV antigens. The immunoblot assay was found to be positive in 81.5% of 195 blood donors who had anti-HCV antibodies as detected by second generation enzyme immunoassays. The samples reacted preferentially with the viral core, NS3-1 and NS5 antigens, and these reactivities were not influenced by HCV genotype. However, the reactivities with NS3-2 and NS4 antigens varied depending on HCV genotypes. The samples from patients infected with HCV genotype 1 reacted well with NS3-2 and NS4 antigens whereas those with other genotypes did not. In addition, samples with the unclassified HCV genotype reacted poorly with all antigens, except NS3-1. This study demonstrates the importance of the core, NS3-1 and NS5 antigens in the detection of antibodies against HCV, especially in areas where more than one genotypes of HCV are present. It also demonstrates that there is a need for further improvement of the currently used assays as new HCV genotypes are recently discovered.

Genotype↗
PubMed1998

[Variants of hepatitis C virus in different risk groups. Comparative study of a method for genotyping and another for serotyping].

AIMS: The aim of this study was to know the prevalence of the different variants of HCV in the Health Care area of Monforte de Lemos (Lugo, Spain) and its distribution according to risk factors and to compare the results obtained with one genotyping and one serotyping technique. PATIENTS AND METHODS: Eighty-four patients with hepatitis C were studied, 25 of whom were IVDA, 14 had received blood transfusions, 4 hemodialysis and the risk factor was unknown in 41. The antibodies against HCV were studied by second generation EIA and confirmed by an immunoblot technique. Serotyping was carried out by an ELISA test. Genotyping was undertaken with a reverse hybridation test of the amplification obtained by polymerase chain reaction prior to reverse transcription (RT-PCR). RESULTS AND CONCLUSIONS: The genotypes most frequently observed were 1b (47.6%), 1a (20.2%) and 3 (14.3%). In the IVDA patients the genotypes 1a (40%) and 3 (24%) predominated. The 1b genotype was the most prevalent in the patients of unknown risk (68.3%) and patients with a history of blood transfusion (50%). The prevalence of the different serotypes was similar to that of the corresponding genotypes, with nearly 100% agreement. The number of untypable cases was greater in the serotyping technique (20.2%) than in the genotyping (2.4%). A greater number of mixed infections was detected with serotyping (7 cases, 8.3%) than with genotyping (1 case, 1.2%). Lesser sensitivity of the serotyping test was observed in the patients lacking anti-NS4 antibodies.

Blood Transfusion↗
PubMed1998

CYP2E1 genotyping in renal cell/urothelial cancer patients in comparison with control populations.

OBJECTIVE: Genetic polymorphisms in enzymes involved in carcinogen metabolism have been found to influence susceptibility to cancer. Ethanol-inducible CYP2E1 is an enzyme of major toxicological interest because it metabolizes several drugs, precarcinogens, and solvents to reactive metabolites. In the present investigation, we studied the cytochrome P450 2E1 genetic polymorphism in renal cell/urothelial cancer patients in comparison with healthy control populations in the regions of Jena and Halle in Germany. PATIENTS AND MATERIAL: DNA of peripheral white blood cells was isolated both from 273 renal cell/urothelial cancer patients and 298 controls from the regions of Jena and Halle. METHOD: We focused on polymorphisms in the promoter region and intron 6 of the CYP2E1 gene. The polymorphims were identified as restriction fragment length polymorphisms (RFLPs) by polymerase chain reaction (PCR) and subsequently applying the restriction enzymes PstI/RsaI and DraI. RESULTS: In the region of Jena as well as of Halle, the frequency distributions of the PstI/RsaI, DraI, and combined DraI + PstI/RsaI genotypes showed no significant differences between controls and renal cell/urothelial cancer patients. We did not find significant differences between Jena and Halle. 86.7% of all subjects with a homozygote PstI/RsaI genotype also carried a homozygote DraI genotype, whereas 5.2% of all subjects with a heterozygote PstI/RsaI genotype also carried a heterozygote DraI genotype. The heterozygote genotype of PstI/RsaI polymorphism always determines the heterozygote genotype of DraI polymorphism. Our results failed to demonstrate any differences in the distribution of CYP2E1 polymorphisms between renal cell/urothelial cancer patients and controls. CONCLUSION: Summing up, our results show that CYP2E1 genotype cannot predict risk for renal cell/urothelial cancer in the population from 2 different regions in Germany. The results demonstrate a lack of association between CYP2E1 genetic polymorphism and renal cell cancer/urothelial cancer.

Carcinoma, Renal Cell↗
PubMed1998

Relationship of hepatitis C virus genotypes and viremia levels with development of hepatocellular carcinoma among Japanese.

The roles of hepatitis C virus (HCV) genotypes and viremia levels in the pathogenesis of hepatocellular carcinoma (HCC) were examined in case-control analyses of 69 patients with HCC, 55 patients with liver cirrhosis (LC) without HCC, and 30 controls undergoing health examinations. Major HCV genotypes (genotypes 1 and 2) were determined by both reverse transcription-polymerase chain reaction (RT-PCR)-based and serological assays, and the HCV-RNA level by a branched DNA assay. Genotype 1 was detected in 68-82% of HCCs, 71-73% of LCs, and 50-72% of controls. Based on RT-RCR, the relative risk for genotype 1 vs. 2 contrasting either HCC or LC patients with controls was estimated at 3.6 (95% confidence interval: 1.1-12.5) for HCC and 4.8 (1.1-20.4) for LC, whereas no risk excess was evident for the occurrence of HCC in LC (relative risk: 0.7). The corresponding association based on the serological assay was somewhat weaker and statistically insignificant. No significant difference in age or time lapse after blood transfusion was observed according to the genotype. The HCV-RNA titer for genotype 1 was significantly lower among HCC patients than among LC patients or controls. Genotype 1 HCV may be associated with HCC through affecting relatively early stages of liver diseases progression prior to the establishment of LC.

Adult↗
PubMed1997

Genotyping of the CYP1A1 and GSTM1 genes in esophageal carcinoma patients with special reference to smoking.

BACKGROUND: Aromatic hydrocarbons, including benzol[a]pyrene, in tobacco smoke first require metabolic activation by phase I enzymes, cytochrome P450s (CYP450s), and then are subjected to detoxification by phase II enzymes, the glutathione-S-transferases. A high risk lung carcinoma group has been reported to have specific polymorphisms of the cytochrome P450 (CYP1A1) gene and the glutathione-S-transferase (GSTM1) gene. In this study, the authors investigated whether such genotypes were also risk factors for esophageal carcinoma. METHODS: Subjects were comprised of 89 esophageal carcinoma patients and 137 noncancer controls. Forty-nine of the patients and 60 of the control subjects were smokers. Genotypic studies of both CYP1A1 and GSTM1 were performed in the cancer tissues of all 89 patients. Genotypes of peripheral blood leukocytes taken from the control subjects were also determined. Genotypes of the CYP1A1 and GSTM1 genes were determined by the polymerase chain reaction. RESULTS: Patients who were heavy smokers with the genotypes Val/Val (V/V) for CYPIAI and the combined genotype of V/V for CYP1A1 and GSTM1- were a statistically high risk group compared with control subjects (P < 0.01, chi-square = 10.6 vs. P < 0.01, chi-square = 11.0). The association of V/V for CYPIAI with a smoking index > or = 600 in esophageal carcinoma patients was estimated at 6.63 (95% confidence interval [CI], 1.86-23.7). The association of combined genotypes of V/V of CYP1A1 and GSTM1 with a smoking index > or = 600 in esophageal carcinoma patients was estimated at 12.7 (95% CI, 1.97-81.8) CONCLUSIONS: Specific genotypes of the CYP1A1 and GSTM1- genes are related to the incidence of esophageal carcinoma, especially in heavy smokers.

Adult↗
PubMed1999

Multiple infection of TT virus (TTV) with different genotypes in Japanese hemophiliacs.

To clarify the persistent TT virus (TTV) infection, we studied a possibility of multiple TTV infection by genotype analysis of isolated TTV obtained from seven Japanese hemophiliacs. The nucleotide sequences including 222 bp in the open reading frame 1 (ORF1) region of 10 TTV isolates from each patient were analyzed and classified into various TTV genotypes such as G1 to G6 by phylogenetic analysis using a N-J method. Multiple TTV genotypes were observed in all the hemophiliacs: three different TTV genotypes were found in three patients, whereas four different TTV genotypes were observed in the other three patients. The remaining patient was also infected with TTV of five different genotypes. Moreover, new TTV genotypes were found in these seven patients and tentatively designated as G7. The present findings indicate that multiple TTV infection with different TTV genotypes has occurred in Japanese hemophiliacs. They also provide valuable information to understand persistent TTV infection.

Adolescent↗
PubMed1994

Effects of sulphur dioxide (SO2) on growth and flowering of SO2-tolerant and non-tolerant genotypes of Phleum pratense.

The objective of this study was to compare the growth and interaction of clipping and sulphur dioxide (SO(2)) exposure on SO(2)-tolerant and non-tolerant genotypes of Phleum pratense at two field sites along an SO(2)-concentration gradient. Sulphur-dioxide-tolerant and non-tolerant genotypes of Phleum pratense were identified from indigenous populations that had been collected along the same SO(2)-concentration gradient in southern Alberta, Canada. Physiological differences between the two genotypes were confirmed by supplying leaves with (14)CO(2) and examining the assimilate partitioning between the genotypes. For the field experiment, clones of each genotype and seedlings grown from commercial seed were planted at two different field sites along an SO(2)-emission gradient. There were no differences in growth between the genotypes at the two field sites after the first year except that the SO(2)-tolerant clones had a greater percentage of root length colonised by vesicular-arbuscular (VA) mycorrhizal fungi. After the second growing season, there was a significant decrease in the number of inflorescences produced by plants exposed to SO(2), particularly by the non-tolerant genotype. The added stress of defoliation appeared to increase the sensitivity of flowering to SO(2), again particularly in the non-tolerant genotype. The results of the field study showed that flowering as opposed to vegetative plant growth was more sensitive to long-term low-concentration SO(2) exposure and that this sensitivity was compounded by the stress interaction of defoliation.

Journal Article↗
PubMed1996

The DD genotype of the angiotensin-converting enzyme gene is associated with increased mortality in idiopathic heart failure.

OBJECTIVES: The aim of the present study was to investigate the association between the homozygous DD (deletion) genotype of the angiotensin-converting enzyme gene and survival and cardiac function in patients with idiopathic congestive heart failure. BACKGROUND: The DD genotype gene is a linkage marker for an etiologic mutation at or near the angiotensin-converting enzyme gene and has been associated with increased risk for the development of coronary artery disease, left ventricular hypertrophy and left ventricular dilation after myocardial infarction. We investigated the association between this angiotensin-converting enzyme genotype and mortality in a population-based cohort of patients with idiopathic congestive heart failure. METHODS: The genotype was determined in 193 patients recruited from a large unselected population of patients with congestive heart failure (n = 2,711). The patients were studied with echocardiography, and survival data were obtained after 5 years of follow-up. A control group from the general population (n = 77) was studied by a similar procedure. RESULTS: The frequency of the D allele was not significantly different in the study and control groups (0.57 vs 0.56, p = NS). Long-term survival was significantly worse in the patients with the DD genotype than in the remaining patients (5-year survival rate 49% vs. 72%, p = 0.0011 as assessed by log rank test). The independent importance of the DD genotype for prognosis was verified by a multivariate Cox proportional hazards analysis, by which the odds ratio for mortality and the DD genotype was 1.69 (95% confidence interval 1.01 to 2.82). The only significant difference in cardiac function data between the two groups was an increase in left ventricular mass index in the DD group (153 +/- 57 vs 134 +/- 44 g/m2, p = 0.019). CONCLUSIONS: Angiotensin-converting enzyme gene DD polymorphism was associated with poorer survival and an increase in left ventricular mass in patients with idiopathic heart failure. The results suggest a possible pathophysiologic pathway between angiotensin-converting enzyme gene polymorphism, angiotensin-converting enzyme activity, myocardial hypertrophy and survival. Therefore, the DD genotype may be a marker of poor prognosis in patients with congestive heart failure.

Case-Control Studies↗
PubMed2006

Analysis of prion protein genotypes in relation to reproduction traits in local and cosmopolitan German sheep breeds.

Due to the genetic determination of susceptibility to scrapie and other forms of transmissible spongiform encephalopathy (TSE) in sheep breeding to the less susceptible prion protein (PrP) genotype ARR/ARR was advanced within EU. In 4961 ewes of nine German sheep breeds (Coburg Fox sheep, Gray Horned Heath sheep, Merinoland sheep, Rhoen sheep, German Blackheaded Mutton sheep, Shropshire, Suffolk, Texel and White East Friesian Milk sheep) representing local and cosmopolitan breeds the reproductive traits number of lambs born, dead (including abortion at the end of pregnancy, stillbirth and death during the first 56 days post natum), weaned and rearing rate at each lambing were recorded and in 1641 of these ewes the PrP genotype was determined. A linear model was used to evaluate associations between PrP genotype and reproduction traits including the effects of PrP genotype (four classes: ewes with two, one and no copy of the ARR allele and with unknown PrP genotype), breed, interaction of PrP genotype and breed, number of lambing, lambing season and stock. Significant associations were only observed between the PrP genotype and the number of dead lambs at each lambing in Shropshire and Merinoland sheep and the rearing rate at each lambing in Shropshire. These significant associations were mainly caused by differences between animals with unknown PrP genotype and animals of the other PrP classes. In conclusion, breeding for TSE resistant sheep will not lead to a reduction in economically important reproduction traits.

Alleles↗