SEARCH · Search PubMed

Results for “linear DNA”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

SourceResearch connectionFrom yearThrough year

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 127 records · Page 7Linked to original sources

PubMed1993

Complement-stabilized D-loop. RecA-catalyzed stable pairing of linear DNA molecules at internal sites.

The RecA protein (RecA) of Escherichia coli has the ability to pair a single-stranded DNA to a homologous sequence in a duplex DNA without requiring denaturation of the duplex. This ability has stimulated interest in the use of RecA for targeting probes to genomic DNA. However, because pairing generally requires that the double-stranded DNA either have a homologous end or be negatively supercoiled, the application of RecA to targeting has been very limited. Here, we show that if the sequence complementary to the probe is also included in the reaction, RecA can pair the two single strands to sites distant from any ends on linear DNA. The resulting structure, termed a complement-stabilized D-loop (csD-loop), is cleavable by restriction endonucleases and, upon removal of RecA, remains stable to temperatures up to the tm of the double-stranded probe. These results indicate that the csD-loop probably consists of two side-by-side Watson-Crick duplexes, much like a replication bubble. This novel reaction of RecA may be useful in gene mapping and isolation, as well as in sequence-specific cleavage of genomic DNA, and might have functions in vivo.

DNA Probes↗

PubMed2002

Mitochondrial genome of the colorless green alga Polytomella parva: two linear DNA molecules with homologous inverted repeat Termini.

Most of the well-characterized mitochondrial genomes from diverse green algal lineages are circular mapping DNA molecules; however, Chlamydomonas reinhardtii has a linear 15.8 kb unit mitochondrial genome with 580 or 581 bp inverted repeat ends. In mitochondrial-enriched fractions prepared from Polytomella parva (=P. agilis), a colorless, naturally wall-less relative of C. reinhardtii, we have detected two linear mitochondrial DNA (mtDNA) components with sizes of 13.5 and 3.5 kb. Sequences spanning 97% and 86% of the 13.5- and 3.5-kb mtDNAs, respectively, reveal that these molecules contain long, at least 1.3 kb, homologous inverted repeat sequences at their termini. The 3.5-kb mtDNA has only one coding region (nad6), the functionality of which is supported by both the relative rate at which it has accumulated nonsynonymous nucleotide substitutions and its absence from the 13.5-kb mtDNA which encodes nine genes (i.e., large and small subunit rRNA [LSU and SSU rRNA] genes, one tRNA gene, and six protein-coding genes). On the basis of DNA sequence data, we propose that a variant start codon, GTG, is utilized by the P. parva 13.5-kb mtDNA-encoded gene, nad5. Using the relative rate test with Chlamydomonas moewusii (=C. eugametos) as the outgroup, we conclude that the nonsynonymous nucleotide substitution rate in the mitochondrial protein-coding genes of P. parva is on an average about 3.3 times that of the C. reinhardtii counterparts.

Animals↗

PubMed1989

A facile duplex-hairpin interconversion through a cruciform intermediate in a linear DNA fragment.

The duplex of d(GGTACGCGCGTGCGCGATGG) and d(CCATCGCGCGTGCGCGTACC) containing an inverted repeat has been studied by spectroscopic and electrophoretic techniques. Prior to melting this DNA fragment, like many other palindromes, transforms into hairpin structures but with four non-self-complementary bases ("dangling ends") at their termini. Most surprisingly, it is found that these dangling ends promote an unusually facile hairpin-duplex interconversion in contrast to very slow ones found in all the "blunt end" palindromes studied so far. Kinetic studies provide evidence, for the first time in a linear DNA fragment, that a cruciform intermediate is involved in the hairpin to duplex interconversion.

Animals↗

PubMed2001

Tagging Hansenula polymorpha genes by random integration of linear DNA fragments (RALF).

We have investigated the feasibility of using gene tagging by restriction enzyme-mediated integration (REMI) to isolate mutants in Hansenula polymorpha. A plasmid that cannot replicate in H. polymorpha and contains a dominant zeocin resistance cassette, pREMI-Z, was used as the integrative/mutagenic plasmid. We observed that high transformation efficiency was primarily dependent on the use of linearised pREMI-Z, and that the addition of restriction endonuclease to linearised pREMI-Z prior to transformation increased the transformation frequency only slightly. Integration of linearised pREMI-Z occurred at random in the H. polymorpha genome. Therefore, we termed this method Random integration of Linear DNA Fragments (RALF). To explore the potential of RALF in H. polymorpha, we screened a collection of pREMI-Z transformants for mutants affected in peroxisome biogenesis (pex) or selective peroxisome degradation (pdd). Many previously described PEX genes were obtained from the mutant collection, as well as a number of new genes, including H. polymorpha PEX12 and genes whose function in peroxisome biogenesis is still unclear. These results demonstrate that RALF is a powerful tool for tagging genes in H. polymorpha that should make it possible to carry out genome-wide mutagenesis screens.

Base Sequence↗

PubMed1982

Linear DNA does not form chromatin containing regularly spaced nucleosomes.

The topological state of DNA may play a role in regulating chromatin structure and gene expression in eucaryotes. To test this hypothesis, the arrangements of nucleosomes on circular and unit-length linear simian virus 40 (SV40) DNAs incubated in nuclei of Xenopus oocytes were determined by (i) analyzing changes in the electrophoretic properties of the DNAs and (ii) examining the patterns of DNA fragments resulting from digestions with micrococcal nuclease. Whereas circular DNA became associated with nucleosomes that were arranged along the DNA at regular intervals of approximately 195 base pairs, linear DNA failed to reconstitute into chromatin containing regularly spaced nucleosomes. DNA that failed to form proper chromatin was gradually degraded, indicating that histone proteins in proper association with DNA may be the cellular component that normally protects chromosomal DNA from endonucleolytic attack. When either circular or linear DNA was incubated in an in vitro transcription system made from a whole-cell extract of HeLa cells, most of the molecules did not associate with histone proteins to form regularly spaced nucleosomes. Furthermore, linearization of mRNA-encoding DNAs, including SV40, reduces their transcriptional activity in Xenopus oocytes to a level comparable to that obtained with the in vitro transcription system employed here. Therefore, proper association of DNA with appropriate cellular chromosomal factors may be a prerequisite for proper transcription by RNA polymerase II.

Animals↗

PubMed1988

Telomere terminal transferase activity in the hypotrichous ciliate Oxytricha nova and a model for replication of the ends of linear DNA molecules.

We have found abundant telomere-specific terminal transferase activity in crude macronuclear extracts from vegetatively growing cells of the hypotrichous ciliate Oxytricha nova. This activity adds two to seven tandem repeats of the sequence GGGGTTTT (the Oxytricha telomeric repeat) to the 3' end of oligonucleotide primers ending in repeats of G4T4 and always adds the repeats in the proper phase. The activity requires the presence of micromolar amounts of dGTP and dTTP as well as single-stranded oligomer primers ending 3' with repeats of the Oxytricha telomeric sequence. A nuclease activity is present in the extracts which is closely balanced with telomere terminal transferase activity. We propose a simple model for replication of the ends of linear DNA molecules based on the telomere terminal transferase.

Animals↗

PubMed1999

Linear DNA plasmid pPK2 of Pichia kluyveri: distinction between cytoplasmic and mitochondrial linear plasmids in yeasts.

The linear plasmids frequently found in plants and filamentous fungi are associated with mitochondria or chloroplasts. In contrast, all the linear plasmids known in yeasts are cytoplasmic elements. From a strain of the yeast Pichia kluyveri, we have isolated a new linear plasmid, pPK2, which was found to be associated with mitochondria. This 7.1 kilobase pairs-long DNA contained only two genes, which code for DNA and RNA polymerases, as judged from their nucleotide sequences translated by a mitochondrial genetic code. When we examined several recently isolated yeast plasmids for their subcellular localization, we found that two linear plasmids, pPH1 from Pichia heedii, as well as pPK1 from another strain of P. kluyveri, were also localized in mitochondria. These plasmids are the first examples of mitochondria-associated linear plasmids in yeast. All other linear plasmids we examined were of cytoplasmic origin. Whilst the cytoplasmic type linear plasmids were efficiently eliminated by ultraviolet irradiation of host cells, the mitochondria-associated plasmids were highly resistant. The mitochondrial pPK2 plasmid was rapidly lost by treatment of the host cells with ethidum bromide.

Amino Acid Sequence↗

PubMed1998

Looping dynamics of linear DNA molecules and the effect of DNA curvature: a study by Brownian dynamics simulation.

A Brownian dynamics (BD) model described in the accompanying paper (Klenin, K., H. Merlitz, and J. Langowski. 1998. A Brownian dynamics program for the simulation of linear and circular DNA, and other wormlike chain polyelectrolytes. Biophys. J. 74:000-000) has been used for computing the end-to-end distance distribution function, the cyclization probability, and the cyclization kinetics of linear DNA fragments between 120 and 470 basepairs with optional insertion of DNA bends. Protein-mediated DNA loop formation was modeled by varying the reaction distance for cyclization between 0 and 10 nm. The low cyclization probability of DNA fragments shorter than the Kuhn length (300 bp) is enhanced by several orders of magnitude when the cyclization is mediated by a protein bridge of 10 nm diameter, and/or when the DNA is bent. From the BD trajectories, end-to-end collision frequencies were computed. Typical rates for loop formation of linear DNAs are 1.3 x 10(3) s(-1) (235 bp) and 4.8 x 10(2) s(-1) (470 bp), while the insertion of a 120 degree bend in the center increases this rate to 3.0 x 10(4) s(-1) (235 bp) and 5.5 x 10(3) s(-1) (470 bp), respectively. The duration of each encounter is between 0.05 and 0.5 micros for these DNAs. The results are discussed in the context of the interaction of transcription activator proteins.

Biophysics↗

PubMed1988

A novel yeast secretion signal isolated from 28K killer precursor protein encoded on the linear DNA plasmid pGKL1.

Saccharomyces cerevisiae harboring linear dsDNA plasmids, pGKL1 and pGKL2, secretes a killer toxin consisting of 97, 31 and 28 kilodalton subunits (Nucleic Acids Res., 15, 1031-1046, 1987). We isolated the DNA encoding the N-terminal pre-sequence of the 28K precursor protein and constructed a new secretion vector in S. cerevisiae. Mouse alpha-amylase fused to the 28K signal sequence was secreted into the culture medium with a high efficiency similar to those fused to the mating factor alpha and 97K-31K killer signal sequences. This data clearly indicates that 28K presequence functions as a secretion signal. Glycosylated and nonglycosylated alpha-amylase molecules were detected in the culture medium. The secretion of alpha-amylase was blocked by sec18-1 mutation. The secreted alpha-amylase recovered from the medium was found to migrate faster in SDS-polyacrylamide gel than the precursor form of alpha-amylase synthesized in vitro. These lines of evidence suggest that mouse alpha-amylase fused to 28K killer signal sequence was processed, glycosylated and secreted through the normal secretion pathway of the yeast.

Amino Acid Sequence↗

PubMed1992

Physical and genetic characterization of linear DNA plasmids from the heterothallic yeast Saccharomycopsis crataegensis.

Five strains of the heterothallic yeast Saccharomycopsis crataegensis have been previously shown to contain DNA and/or RNA plasmidlike molecules (Shepherd et al. 1987). Three DNA plasmids, designated pScrl-1, -2 and -3, were found in strain NRRL Y-5902, while two were identified in each of NRRL strains Y-5903 and Y-5904. DNA plasmids were not identified in S. crataegensis strains Y-5910 or YB-192. Four S. crataegensis strains (Y-5903, Y-5904, Y-5910 and YB-192) were also shown to possess double-stranded RNA (dsRNA) molecules not found in strain Y-5902 (Shepherd et al. 1987). Hybridization studies now demonstrate the DNA plasmids in Y-5903 and Y-5904 to be highly homologous to their respective size counterparts (pScrl-1 and pScrl-2) in Y-5902 and to show some homology to pScrl-3. Restriction endonuclease mapping studies confirm the linear nature of each plasmid and establish identical restriction maps for a 1.4 kilobase (kb) region in pScrl-2 and -3. This 1.4 kb region accounts for the hybridization homology of pScrl-2 and pScrl-3 noted by Shepherd et al. (1987) and for homology of the plasmids of Y-5903 and Y-5904 to pScrl-3 of Y-5902. The pScrl plasmids show no homology to the dsRNA molecules of S. crataegensis, the 2 microM circular DNA of Staccharomyces cerevisiae, the 'killer' plasmids of Kluyveromyces lactis, or the linear DNA plasmids of Pichia inositovora. In crosses between linear DNA plasmid-containing and dsRNA-containing strains, only progeny containing the pScrl plasmids were recovered. Poor spore viability and a lack of complete tetrad recovery limited the extent of the analysis, but the findings suggest a cytoplasmic mode of inheritance for these linear DNAs.

Blotting, Northern↗

PubMed1991

Heterologous gene expression on the linear DNA killer plasmid from Kluyveromyces lactis.

Linear hybrid plasmids based on the killer plasmid pGKL1 from Kluyveromyces lactis were obtained by in vivo recombination in Saccharomyces cerevisiae. Like pGKL1, the hybrids are located in the cytoplasm, have terminal inverted repeats (TIR) and possess covalently linked proteins at their 5' ends. The construction of cytoplasmic hybrid plasmids is based on the use of a pGKL1 promoter to control the marker gene used for recombination. Nuclear promoters are not recognised in the cytoplasm.

Base Sequence↗

PubMed1991

Estimation of polyacrylamide gel pore size from Ferguson plots of linear DNA fragments. II. Comparison of gels with different crosslinker concentrations, added agarose and added linear polyacrylamide.

The mobilities of various DNA fragments in two normally migrating molecular weight ladders were studied in polyacrylamide gels containing different concentrations of the crosslinker N,N'-methylenebisacrylamide (Bis). The acrylamide concentration ranged from 2.5-10.5%T (w/v); the Bis concentration ranged from 0.5-10%C (w/w), with respect to total acrylamide. Ferguson plots were constructed for each of the DNA fragments in gels of each composition. The Ferguson plots of the different multimers in each molecular weight ladder were nearly parallel in gels containing 0.5-3%C, converged close to a common intercept at zero gel concentration in gels containing 4%C, and crossed at approximately 1.5%T in gels containing 5 and 10%C. If the mobilities observed for the different DNA fragments at zero gel concentration were also extrapolated to zero DNA molecular weight, a common limiting mobility was observed in gels of all crosslinker concentrations. This limiting mobility was approximately equal to the free solution mobility of DNA. The effective pore radius of each gel was estimated from Ferguson plots based on relative mobilities, using the mobility of the smallest DNA fragment in each molecular weight ladder as the reference mobility. The calculated gel pore radii ranged from 142 nm to 19 nm, respectively, for gels containing 4.6%T, 1.5%C, and 10.5%T, 5 or 10%C. These pore radii are an order of magnitude larger than previously accepted values, but are consistent with scanning electron microscope measurements (Rüchel, R., et al., J. Chromatogr. 1978, 42, 77-90).(ABSTRACT TRUNCATED AT 250 WORDS)

Acrylamides↗

PubMed1977

Infectious linear DNA sequences replicating in simian virus 40-infected cells.

A new class of linear duplex DNA structures that contain simian virus 40 (SV40) DNA sequences and that are replicated during productive infection of cells with SV40 is described. These structures comprise up to 35% of the radioactively labeled DNA molecules that can be isolated by selective extraction. These molecules represent a unique size class corresponding to the length of an open SV40 DNA molecule (FO III), and they contain a heterogeneous population of DNA sequences either of host or of viral origin, as shown by restriction endonuclease analysis and nucleic acid hybridization. Part of the FO III DNA molecules contain viral-host DNA sequences covalently linked with each other. They start to replicate with the onset of SV40 superhelix replication 1 day after infection. Their rate of synthesis is most pronounced 3 days after infection when superhelix replication is already declining. Furthermore, they cannot be chased into other structures. At least a fraction of these molecules is infectious when administered together with DEAE-dextran to permissive cells. After intracellular circularization, superhelical DNA FO I with an aberrant cleavage pattern accumulates. In addition, tumor and viral capsid antigen are induced, and infectious viral progeny is obtained. Infection of cells with purified SV40 FO I DNA does not result in FO III DNA molecules in the infected cells or in the viral progeny. It is suggested, therefore, that these FO III DNA molecules are perpetuated within SV40 virus pools by encapsidation into pseudovirions.

Base Sequence↗

PubMed1981

[Quantity of exogenous linear DNA absorbed by E. coli cells treated with Ca2+ cations].

The amount of linear chromosomal DNA entering Ca2+-treated Escherichia coli K 12 cells was estimated from the degree of degradation of exogenous DNA by intracellular nucleases. At least 40% of DNA adsorbed by the cells in the nucleaso-resistant form (45 MD/cell) was discovered to be as intracellular. No significant difference was found between single- and double-stranded DNA.

Calcium↗

PubMed1986

Differences in the kinetic properties of BamHI endonuclease and methylase with linear DNA substrates.

BamHI endonuclease and methylase were found to exhibit a kinetic preference for linear pBR322 DNA substrates containing the recognition site in a central location. The Km values for substrates having the recognition site in a terminal location were approximately 3-fold greater than those with a centrally located site. This phenomenon may be partially due to facilitated transfer of the enzymes to the recognition site over nonspecific flanking sequences. The exploitation of facilitated transfer by these enzymes has been inferred from studies demonstrating kinetic preferences for longer DNA substrates. The reaction rates of the endonuclease were 9-fold greater with full-length pBR322 DNA than with a 74-base pair derivative. The methylase exhibits a kinetic preference for longer substrates but only under conditions of comparatively higher DNA concentrations. In addition, the methylase has the property of increasing long chain preference with increasing salt concentrations up to 120 mM. Increasing salt concentrations decreased the endonuclease's preference for longer substrates. Nonspecific inhibition studies revealed qualitative and quantitative differences between the two enzymes under catalytic conditions. These studies suggest that BamHI endonuclease and methylase interact with nonspecific DNA in different ways.

DNA (Cytosine-5-)-Methyltransferases↗

PubMed1993

Targeting in linear DNA duplexes with two complementary probe strands for hybrid stability.

A new in vitro hybridization reaction targets two short complementary RecA protein-coated DNA probes to homologous sequences at any position in a linear duplex DNA molecule. Stable hybrids are obtained after RecA protein removal when both complementary probe strands are present in a four-stranded hybrid, but not when one probe strand is present in a three-stranded hybrid. In four-stranded hybrids with one probe strand biotinylated and the other radiolabelled, the deproteinized hybrids can be isolated and detected by affinity capture on streptavidin-coated magnetic beads. RecA-mediated targeting of complementary biotinylated DNA probe strands allows the affinity capture of 48.5-kilobase duplex lambda genomic DNA. These reactions provide a means of isolating any desired duplex gene or chromosomal DNA fragment.

Adenosine Triphosphate↗

PubMed1983

In vivo ligation of linear DNA molecules to circular forms in the yeast Saccharomyces cerevisiae.

The yeast Saccharomyces cerevisiae was transformed with restriction endonuclease-digested (linear) DNAs containing the replication origin of the yeast 2 microns plasmid and selectable markers with efficiencies of 10(3) to 10(4), 10(3), and 10(2) to 10(3) transformants per microgram of DNA in the cases of transformations with linear DNAs containing the same cohesive ends, flush ends, and non-complementary cohesive ends, respectively. The results of a restriction analysis of the circular plasmids recovered from transformed cells suggested that the linear DNA molecules were ligated to produce circular forms in the recipient protoplasts.

DNA Restriction Enzymes↗

PubMedDate not supplied

No transgenic rainbow trout produced with sperm incubated with linear DNA.

We attempted to produce transgenic rainbow trout embryos by fertilizing eggs with sperm incubated with linearized plasmids. One experiment was conducted with the construct pBGH7 in the medium MMSF, with or without DMSO, at 2 concentrations of sperm cells and a relatively low concentration of DNA. The DNA was also in contact with the eggs during insemination and during the first minutes of egg activation. The second experiment was conducted with the construct CMVCAT in the medium MMSF, at 2 concentrations of sperm cells and a much higher concentration of DNA. The DNA was also present during the insemination. DNA analyses and dosages of CAT activity did not permit detection of any transgenic fry. However, one result suggests that sperm cells can capture part of the linear DNA in teh conditions tested.

Animals↗