Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Phaeophyceae”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 127 records · Page 7Linked to original sources
PubMed1991

Evolution of the Rubisco operon from prokaryotes to algae: structure and analysis of the rbcS gene of the brown alga Pylaiella littoralis.

The rbcS gene coding for the small subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) of the brown alga Pylaiella littoralis is located within the plastid genome and is transcribed as a single polycistronic mRNA with the gene for the large subunit of Rubisco, rbcL. The structure of the Rubisco operon from P. littoralis was determined. Molecular phylogenies for rbcS and rbcL with a wide range of prokaryotes and eukaryotes were constructed which are congruent with recent evidence for polyphyletic plastid origins. Both rbcL and rbcS of the beta-purple bacterium Alcaligenes eutrophus clearly cluster with the rhodophyte and chromophyte proteins. The data suggest that the Rubisco operons of red algal and chromophytic plastids derive from beta-purple eubacterial antecedents, rather than the cyanobacterial lineage of eubacteria from which other of their genes derive. This implies a lateral transfer of Rubisco genes from beta-purple eubacterial ancestors to the cyanobacterial ancestor of rhodophyte and chromophyte plastids.

Amino Acid Sequence↗
PubMed1991

Beta-tubulins are encoded by at least four genes in the brown alga Ectocarpus variabilis.

Complementary DNA clones of two mRNA species that encode beta-tubulin in the brown alga Ectocarpus variabilis have been isolated. Sequence analysis revealed that the encoded proteins are very similar in primary structure to homologues in other eukaryotes, and differ from each other at six of 447 amino acid residues. The beta 6 message shows a preference for C- or G-terminated codons, using only 49 codons. The beta 5 message has a lesser codon bias, and makes a minor contribution to the beta-tubulin mRNA pool. Southern analysis of E. variabilis DNA demonstrated a beta-tubulin gene family of at least four members.

Amino Acid Sequence↗
PubMed1992

Sequence, proposed secondary structure, and phylogenetic analysis of the chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm.

The chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm has been cloned and sequenced. The gene is located 23 bp downstream from the 3' end of the 23S rRNA gene. The sequence of the gene is as follows: GGTCTTG GTGTTTAAAGGATAGTGGAACCACATTGAT CCATATCGAACTCAATGGTGAAACATTATT ACAGTAACAATACTTAAGGAGGAGTCCTTTGGGAAGATAGCTTATGCCTAAGAC. A secondary structure model is proposed, and compared to those for the chloroplast 5S rRNAs of spinach and the red alga Porphyra umbilicalis. Cladograms based on chloroplast and bacterial 5S rRNA and rRNA gene sequences were constructed using the MacClade program with a user-defined character transformation in which transitions and transversions were assigned unequal step values. The topology of the resulting cladogram indicates a polyphyletic origin for photosynthetic organelles.

Amino Acid Sequence↗
PubMed1994

Sequence analysis of duplicated actin genes in Lagenidium giganteum and Pythium irregulare (Oomycota).

Southern analysis of genomic DNA identified multiple-copy actin gene families in Lagenidium giganteum and Pythium irregulare (Oomycota). Polymerase chain reaction (PCR) protocols were used to amplify members of these actin gene families. Sequence analysis of genomic coding regions demonstrated five unique actin sequences in L. giganteum (Lg-Ac1, 2, 3, 4, 5) and four unique actin sequences in P. irregulare (Pi-Ac1, 2, 3, 4); none were interrupted by introns. Maximum parsimony analysis of the coding regions demonstrated a close phylogenetic relationship between oomycetes and the chromophyte alga Costaria costata. Three types of actin coding regions were identified in the chromophyte/oomycete lineage. The type 1 actin is the single-copy coding region found in C. costata. The type 2 and type 3 actins are found in the oomycetes and are the result of a gene duplication which occurred soon after the divergence of the oomycetes from the chromophyte algae. The type 2 coding regions are the single-copy sequence of Phytophthora megasperma, the Phytophthora infestans actB gene, Lg-Ac5 and Pi-Ac2. The type 3 coding regions are the single-copy sequence of Achlya bisexualis, the P. infestans actA gene, Lg-Ac1, 2, 3, 4 and Pi-Ac1, 3, 4.

Actins↗
PubMed1990

Light-harvesting proteins of diatoms: their relationship to the chlorophyll a/b binding proteins of higher plants and their mode of transport into plastids.

We have cloned and characterized members of a gene family encoding polypeptide constituents of the fucoxanthin, chlorophyll a/c protein complex, a light-harvesting complex associated with photosystem II of diatoms and brown algae. Three cDNA clones encoding proteins associated with this complex in the diatom Phaeodactylum tricornutum have been isolated. As deduced from the nucleotide sequences, these light-harvesting proteins show homology to the chlorophyll a/b binding polypeptides of higher plants. Specifically, the N-terminal regions of the fucoxanthin, chlorophyll a/c-binding proteins are homologous to the chlorophyll a/b binding proteins in both the third membrane-spanning domain and the stroma-exposed region between membrane-spanning domains 2 and 3. Like the chlorophyll a/b-binding proteins, the mature fucoxanthin, chlorophyll a/c polypeptides have three hydrophobic alpha-helical domains which could span the membrane bilayer. The similarities between the two light-harvesting proteins might reflect the fact that both bind chlorophyll molecules and/or might be important for maintaining certain structural features of the complex. There is little similarity between the N-terminal sequences of the primary translation products of the fucoxanthin, chlorophyll a/c proteins and any transit sequences that have been characterized. Instead, the N-terminal sequences have features resembling those of signal sequences. Thus either transit peptides used in P. tricornutum show little resemblance to those of higher plants and green algae or the nuclear-encoded plastid proteins enter the organelle via a mechanism different from that used in higher plants.

Amino Acid Sequence↗
PubMed1995

The gene family encoding the fucoxanthin chlorophyll proteins from the brown alga Macrocystis pyrifera.

Six members of a multigene family encoding polypeptide constituents of the fucoxanthin, chlorophyll a/c protein complex from female gametophytes of the brown alga Macrocystis pyrifera have been cloned and characterized. The deduced amino acid sequences are very similar to those of fucoxanthin chlorophyll binding proteins (Fcp) from the diatom Phaeodactylum tricornutum and exhibit limited homology to chlorophyll a/b binding (Cab) polypeptides from higher plants. The primary translation products from the M. pyrifera fcp genes are synthesized as higher molecular weight precursors that are processed prior to their assembly into the Fcp complex. The presumed N-terminal 40-amino acid presequence of the Fcp precursor polypeptide has features resembling that of a signal sequence. This presequence may be required for the protein to transverse the endoplasmic reticulum that surrounds the plastid in brown algae. A subsequent targeting step would be required for the protein to cross the double membrane of the plastid envelope. M. pyrifera fcp transcripts are of two sizes, 1.2 and 1.6 kb. The size difference is accounted for by the length of the 3' untranslated region, which can be up to 1000 bases. Transcript abundance's of members of the fcp gene family are dependent on light quantity, light quality, or both. Transcript levels of one gene increased approximately five- to tenfold in thalli grown in low intensity relative to high intensity white or blue light. Transcripts from this gene also significantly increase in red light relative to blue light at equivalent light intensities.

Amino Acid Sequence↗
PubMed1991

Structural similarities between psbA genes from red and brown algae.

The single copy psbA genes from the multicellular red alga Antithamnion spec. and the brown alga Ectocarpus siliculosus have been cloned and sequenced and monocistronic transcripts have been detected. Both genes contain an insertion of 21 bp at the 3' end which was also found in cyanobacteria and which is absent in chloroplasts and the chlorophyll b-containing prochlorophyte Prochlorothrix hollandica. These findings are in agreement with the hypothesis of a polyphyletic origin of plastids. Plastids of red and brown algae appear to be closely related.

Amino Acid Sequence↗
PubMed1988

Presence of a 16S rRNA pseudogene in the bi-molecular plastid genome of the primitive brown alga Pylaiella littoralis. Evolutionary implications.

The plastid genome of the brown alga Pylaiella littoralis (L.) Kjellm. is composed of two different circular DNA molecules: the largest carries two rrn operons, and the smallest, only one copy of both 16S and 23S rDNAs. 16S rDNA copies located on both molecules have been cloned and their nucleotide sequences determined: they are 65% homologous to one another. The expression of these genes was assayed by hybridizing in vivo labelled P. littoralis rRNAs to both clones, and specific oligonucleotides to total RNA from P. littoralis. Results indicate that the 16S rDNA copy located on the small molecule is a pseudogene. Comparisons of the functional gene with other 16S rRNA genes shows that chloroplasts from green plants emerged earlier from the cyanobacterial lineage than Euglena gracilis and Pylaiella littoralis plastids.

Base Sequence↗