Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Hippocampus”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 127 records · Page 7Linked to original sources
PubMed1994

Computational analysis of the role of the hippocampus in memory.

The authors draw together the results of a series of detailed computational studies and show how they are contributing to the development of a theory of hippocampal function. A new part of the theory introduced here is a quantitative analysis of how backprojections from the hippocampus to the neocortex could lead to the recall of recent memories. The theory is then compared with other theories of hippocampal function. First, what is computed by the hippocampus is considered. The hypothesis the authors advocate, on the basis of the effects of damage to the hippocampus and neuronal activity recorded in it, is that it is involved in the formation of new memories by acting as an intermediate-term buffer store for information about episodes, particularly for spatial, but probably also for some nonspatial, information. The authors analyze how the hippocampus could perform this function, by producing a computational theory of how it operates, based on neuroanatomical and neurophysiological information about the different neuronal systems contained within the hippocampus. Key hypotheses are that the CA3 pyramidal cells operate as a single autoassociation network to store new episodic information as it arrives via a number of specialized preprocessing stages from many association areas of the cerebral cortex, and that the dentate granule cell/mossy fiber system is important, particularly during learning, to help to produce a new pattern of firing in the CA3 cells for each episode. The computational analysis shows how many memories could be stored in the hippocampus and how quickly the CA3 autoassociation system would operate during recall. The analysis is then extended to show how the CA3 system could be used to recall a whole episodic memory when only a fragment of it is presented. It is shown how this recall could operate using modified synapses in backprojection pathways from the hippocampus to the cerebral neocortex, resulting in reinstatement of neuronal activity in association areas of the cerebral neocortex similar to that present during the original episode. The recalled information in the cerebral neocortex could then be used by the neocortex in the formation of long-term memories.

Animals↗
PubMed2002

Gene expression profiling in developing human hippocampus.

The gene expression profile of developing human hippocampus is of particular interest and importance to neurobiologists devoted to development of the human brain and related diseases. To gain further molecular insight into the developmental and functional characteristics, we analyzed the expression profile of active genes in developing human hippocampus. Expressed sequence tags (ESTs) were selected by sequencing randomly selected clones from an original 3'-directed cDNA library of 150-day human fetal hippocampus, and a digital expression profile of 946 known genes that could be divided into 16 categories was generated. We also used for comparison 14 other expression profiles of related human neural cells/tissues, including human adult hippocampus. To yield more confidence regarding differential expression, a method was applied to attach normalized expression data to genes with a low false-positive rate (<0.05). Finally, hierarchical cluster analysis was used to exhibit related gene expression patterns. Our results are in accordance with anatomical and physiological observations made during the developmental process of the human hippocampus. Furthermore, some novel findings appeared to be unique to our results. The abundant expression of genes for cell surface components and disease-related genes drew our attention. Twenty-four genes are significantly different from adult, and 13 genes might be developing hippocampus-specific candidate genes, including wnt2b and some Alzheimer's disease-related genes. Our results could provide useful information on the ontogeny, development, and function of cells in the human hippocampus at the molecular level and underscore the utility of large-scale, parallel gene expression analyses in the study of complex biological phenomena.

Adult↗
PubMed2001

Domoic acid-induced neuronal damage in the rat hippocampus: changes in apoptosis related genes (bcl-2, bax, caspase-3) and microglial response.

Domoic acid (DA), a potent neurotoxin, administered intravenously (0.75 mg/kg body weight) in adult rats evoked seizures accompanied by nerve cell damage in the present study. Neuronal degeneration and microglial reaction in the hippocampus were investigated, and the temporal profile of bcl-2, bax, and caspase-3 genes in cell death or survival was assessed following the administration of DA. Nissl staining showed darkly stained degenerating neurons in the hippocampus following the administration of DA at 1-21 days, the degeneration being most severe at 5 days. Ultrastructural study in CA1 and CA3 regions of hippocampus revealed two types of neuronal degeneration, cells that exhibited swollen morphology and shrunken electron-dense cells. Immunoreactivity of Bcl-2 and Bax was increased considerably at 16 hr and 24 hr in the neurons of the hippocampus following DA administration. No significant change was observed in the immunoreactivity of caspase-3 in the controls and DA-treated rats at any time interval. Microglial cells in the hippocampus showed intense immunoreaction with the antibodies OX-42 and OX-6 at 1-21 days after DA administration, indicating the up-regulation of complement type 3 receptors and major histocompatibility complex type II antigens for increased phagocytic activity and antigen presentation, respectively. Terminal deoxynucleotidyl-transferase-mediated dUTP nick end labeling (TUNEL) showed occasional positive neurons in the CA1 and CA3 regions at 5 days after DA administration, with no positive cells in the controls. RT-PCR analysis revealed that bcl-2 and bax mRNA transcripts in the hippocampus were significantly increased at 16 hr and gradually decreased at 24 hr following the administration of DA. Although bax and bcl-2 mRNA expression is rapidly induced at early stages, in situ hybridization analysis revealed complete loss of bcl-2, bax, and caspase-3 mRNA at 24 hr after DA administration in the region of neuronal degeneration in the hippocampus. These results indicate that the pattern of neuronal degeneration observed during DA-induced excitotoxic damage is mostly necrotic.

Animals↗
PubMed2002

Cocaine increases serotonergic activity in the hippocampus and nucleus accumbens in vivo: 5-HT1a-receptor antagonism blocks behavioral but potentiates serotonergic activation.

The hippocampus is an important mediator of learning and reinforcement, but its role in cocaine effects has received little attention. Neuronal activity in the hippocampus and the nucleus accumbens (Nac) depend on serotonergic (5-HT) transmission. Here we describe for the first time a cocaine-induced increase in 5-HT concentration in the hippocampus and the Nac parallel to behavioral activation. In addition, pretreatment with the 5-HT(1A)-receptor antagonist WAY 100635 blocked the behavioral activation after cocaine while potentiating the 5-HT increase in the hippocampus and the Nac. In vivo microdialysis was used in behaving rats to measure extracellular concentration of 5-HT in the hippocampus and the Nac. Four groups of animals received one of the following drug combinations: WAY 100635 (0.4 mg/kg) and cocaine (10 mg/kg), saline and cocaine (10 mg/kg), WAY 100635 (0.4 mg/kg) and saline, or saline and saline. The injections were administered i.p. and spaced 30 min apart. It was found that 1.) cocaine, at a dose that activates behavior, increases 5-HT levels in the hippocampus and in the Nac, and 2.) 5-HT(1A)-receptor antagonism can cause a dissociation of the hippocampal and Nac 5-HT activity from behavioral activation after cocaine. These results are discussed within the framework of the hippocampal-accumbens projection and its contribution to behavioral activity. They suggest that the hippocampus may have a role in mediating the behavioral and neurochemical effects of cocaine.

Animals↗
PubMed2001

N-methyl-D-aspartate receptor mRNA levels change during reproductive senescence in the hippocampus of female rats.

Estrogen interacts with N-methyl-d-aspartate (NMDA) receptors to regulate multiple aspects of morphological and functional plasticity. In the hippocampus, estrogens increase both dendritic spine density and synapse number, and NMDA antagonists block these effects. This plasticity in the hippocampus mediated by estrogen may be of particular importance in the context of aging when estrogen levels change and cognitive function is often impaired. Therefore, the present study was designed to investigate effects of aging and reproductive status on NMDA receptor (NR) subunit mRNA levels in the hippocampus. NR1, NR2A, and NR2B mRNA levels were measured by RNase protection assay in young (3-4 month), middle-aged (12-13 month), and aged (24-25 month) Sprague-Dawley rats in different phases of the estrous cycle in cycling animals and in acyclic subjects. Our results demonstrated that NMDA receptor subunit mRNA levels were much more prominently affected by the chronological age than by the reproductive status of the animals. Age-related changes were observed in NR1, NR2A, and NR2B in the ventral hippocampus and in NR1 and NR2B in the dorsal hippocampus. However, the only relationship with reproductive status was seen for NR1 mRNA, and this was restricted to the ventral hippocampus. An interaction between chronological age and reproductive status was found, with higher levels of NR1 mRNA seen in young animals in proestrus than in those in diestrus I (high and low estrogen levels, respectively). However, this relationship was not seen in the aged subjects. These results demonstrate that the hippocampus is subjected to age-related alterations in NMDA receptor subunit mRNA levels and that animals of different ages are influenced differently by reproductive status. This shift in the NMDA receptor mRNA levels may be a possible molecular mechanism contributing to alterations in cognitive behavior during normal aging.

Aging↗
PubMed1995

Volumes of hippocampus, amygdala and frontal lobes in the MRI-based diagnosis of early Alzheimer's disease: correlation with memory functions.

We studied the usefulness of measuring volumes of the hippocampus, amygdala and frontal lobes with coronal magnetic resonance imaging (MRI) scans in the diagnosis of early Alzheimer's disease (AD). We examined 32 patients diagnosed according to the NINCDS-ADRDA criteria of probable AD and 16 age-matched healthy cognitively normal controls. The AD patients had mild dementia with a mean score of 22.8 in the Mini-Mental Status Examination (MMSE). We used a 1.5 T magnetic resonance imager and normalized the volumes for brain area. The AD patients had significantly smaller volumes of the right and the left hippocampus (-38%) (ANOVA, p < 0.0001) and the left frontal lobe (-16%, p < 0.05) compared to controls. The reductions in volumes of the right frontal lobe (-13%), the right amygdala (-14%) or the left amygdala (-18%) were not statistically significant. In the discriminant function analysis which included the volumes of the hippocampus, amygdala, and the frontal lobes and age, the volumes of the left and right hippocampus, the left and right frontal lobe, and the right amygdala entered the model and we could correctly classify 92% of the subjects into AD and control groups (Chi-square 42.6, df 5, p < 0.001). By using the volumes of the hippocampus, the frontal lobes or the amygdala on their alone, the correct classification was achieved in 88%, 65% and 58% of the subjects, respectively. In addition, in AD patients the volumes of the left hippocampus correlated significantly with the MMSE score and with immediate and delayed verbal memory; the smaller the volume the more impaired was their performance. Our data indicate that measurements of volumes of the hippocampus might be useful in diagnosis of early AD.

Aged↗
PubMed1992

Septal cholinergic afferents regulate expression of brain-derived neurotrophic factor and beta-nerve growth factor mRNA in rat hippocampus.

In situ hybridization was used to study the expression of members of the nerve growth factor family of trophic factors in rat hippocampus following stimulation of afferent cholinergic and glutamatergic pathways with quisqualate. A transient increase in brain-derived neurotrophic factor (BDNF) and beta-nerve growth factor (NGF) mRNA expression in the hippocampus was seen 4 h after a quisqualate injection into the medial septal nucleus. Both BDNF and NGF mRNA levels increased more than 4-fold in the granule layer of the dentate gyrus and for BDNF mRNA also in the pyramidal cells of CA1, while the levels of BDNF mRNA in CA3 increased 2-fold. The increase in BDNF and NGF mRNA levels were completely prevented by pretreatment with systemic injections of either scopolamine or diazepam. A quisqualate injection into the entorhinal cortex, containing glutamatergic afferents to the hippocampus, resulted in a 15-, 5- and 17-fold increase in the expression of BDNF mRNA in the ipsilateral granule cells, CA3 and CA1 pyramidal cells, respectively. Similar increases were also seen in the hippocampus contralateral to the injections. In contrast, the level of NGF mRNA did not increase significantly in any of the subfields in the hippocampus. The increase in BDNF mRNA after cortex injections was attenuated by diazepam but not by scopolamine. These findings imply that increased activity in afferent cholinergic and glutamatergic pathways to the hippocampus differentially regulate expression of the NGF family of neurotrophic factors in the hippocampus.

Afferent Pathways↗
PubMed2000

A comparative Golgi study of chicken (Gallus domesticus) and homing pigeon (Columba livia) hippocampus.

Neurons and fibres in the chick and homing pigeon hippocampus were described following Golgi impregnation. Two principal classes of neurons were distinguished: projection neurons with distant projecting axons and spiny dendrites, and local circuit neurons. In the homing pigeon and chicken hippocampus there are three types of projection neurons: pyramidal, pyramidal-like and multipolar. The pyramidal and pyramidal-like neurons are only found in the central 'pyramidal' layer of the hippocampus whereas multipolar neurons are present in the suprapyramidal, pyramidal and infrapyramidal layers. The axon of projection neurons typically emits several varicose collaterals from the initial section. Most of these collaterals extend along the infrapyramidal layer of the hippocampus, while others ascend to the pyramidal and suprapyramidal layers where they branch. The number of impregnated axon collaterals was higher in the homing pigeon than in the chick hippocampus. A variety of multi-angular/ovoid local circuit neurons ranging from small to large size are found in the homing pigeon and chick hippocampus. Their axons develop local arborization of varicose branches, the extent of which varies with the type of local circuit neurons. The density of GABA immunopositive local circuit neurons was found to be greater in the homing pigeon than in the chick. The profuse arborization of projection neuron axon collaterals and the higher density of GABA-immunopositive local circuit neurons in the homing pigeon hippocampus may underlie the differences in hippocampal function between the homing pigeon and chick, and this complex local connectivity may contribute to the ability of spatial orientation and memory.

Animals↗
PubMed1999

CB1 receptor density and CB1 receptor-mediated functional effects in rat hippocampus are decreased by an intracerebroventricularly administered antisense oligodeoxynucleotide.

We have studied (i) the effect of antisense oligodeoxynucleotides complementary to CB1 mRNA on the CB1 receptor binding in hippocampus, striatum and cerebral cortex of the rat; (ii) the possible mechanism of action of one of the antisense oligodeoxynucleotides; and (iii) its effect on two functional CB1 receptor-mediated effects. Synthetic oligodeoxynucleotides or saline were administered to male Wistar rats by the intracerebroventricular (i.c.v.) route twice daily for 3 days. Antisense oligodeoxynucleotides corresponding to the nucleotides 4 to 21 (AS1; GCCATCTAGGATCGACTT) and -8 to 12 (AS2; GATCGACTTCATAACCTCAG) and a mismatch oligodeoxynucleotide differing from AS1 in 6 positions (MM; TCCAGCTACTATGGACTG) were used. The dissociation constant (K(D)) of rat CB1 cannabinoid receptors, labelled by the radioligand [3H]-SR141716, did not differ in membranes from rats treated with saline, AS , AS2 or MM. The density of receptor binding (Bmax) was reduced by the antisense oligodeoxynucleotides, 10nmol, in the hippocampus (AS 1, -40%; AS2, -20%) and striatum (AS1, -29%; AS2 -6%), but not in the cerebral cortex. When the dose of AS1 was raised to 30 nmol, the reduction of Bmax in the hippocampus and striatum was only marginally increased; a dose of 3nmol of AS1 reduced Bmax in both brain regions by somewhat more than the half-maximum effect. The mismatch oligodeoxynucleotide MM (3-30nmol) did not affect Bmax. In the second part of the study, RNA obtained from the three brain regions of rats pretreated with AS1 10 nmol, MM 10 nmol or saline was analyzed using reverse transcription-polymerase chain reaction of CB1 receptor mRNA and of beta-actin mRNA levels (used as reference value). The ratio of CB1 receptor mRNA over beta-actin mRNA after treatment with AS1 did not differ from the ratios following treatment with saline or MM in the hippocampus, striatum and cerebral cortex. Finally, pretreatment with antisense oligodeoxynucleotide AS1 30nmol attenuated two functional effects via CB1 receptors, i.e., the facilitatory effect of WIN 55,212-2 on [35S]-GTPgammaS binding in rat hippocampus membranes and the inhibitory effect of WIN 55,212-2 on acetylcholine release in rat hippocampus slices. In conclusion, (i) two antisense oligodeoxynucleotides reduce the density of CB1 receptors in the rat hippocampus and striatum after i.c.v. administration. (ii) The effect of the antisense oligodeoxynucleotide AS1 does not appear to be related to breakdown of CB1 receptor mRNA. (iii) Pretreatment with AS1 attenuated the CB1 receptor-mediated effect in two functional models.

Acetylcholine↗
PubMed2004

Cytokine production of activated microglia and decrease in neurotrophic factors of neurons in the hippocampus of Lewy body disease brains.

Dementia is a frequent complication of Parkinson's disease (PD) and usually occurs late in the protracted course of the illness. We have already reported numerous MHC class II-positive microglia in the hippocampus in PD patients, and that this phenomenon may be responsible for functional changes in the neurons and the cognitive decline in PD patients. In this study, we have investigated the distribution of activated microglia and the immunohistochemical and the mRNA expression of several cytokines and neurotrophic factors of the hippocampus in PD and dementia with Lewy bodies (DLB). The brains from five cases of PD and five cases of DLB that were clinically and neuropathologically diagnosed, and those from four normal controls (NC) were evaluated by immunohistochemistry using anti-HLA-DP, -DQ, -DR (CR3/43), anti-alpha-synuclein, anti-brain-derived neurotrophic factor (BDNF), and anti-glial fibrillary acidic protein antibodies. In addition, the mRNA expressions of cytokines (IL-1alpha, IL-1beta, TNF-alpha, IL-6, TGF-beta) and neurotrophic factors (BDNF, GDNF, NGF, NT-3) of these brains were evaluated by the reverse transcription-PCR method. MHC class II-positive microglia were distributed diffusely in the hippocampus of PD and DLB brains. Although the cytoplasm of pyramidal and granular cells of the hippocampus in NC brains was strongly stained by anti-BDNF antibodies, it was only weakly stained in PD and DLB brains. The mRNA expression of IL-6 was significantly increased in the hippocampus of PD and DLB brains, and that of BDNF was significantly decreased in the hippocampus of DLB brains. The increased number of activated microglia and the production of neurotrophic cytokines such as IL-6, together with the decreased expression of the neurotrophic factors of neurons in the hippocampus of PD and DLB brains, may be related to functional cellular changes associated with dementia.

Aged↗
PubMed2001

Functional regional distribution of histamine receptors in the rat hippocampus: modulation of learning of an active avoidance response.

The possible functional regional distribution of the histamine sensitive sites controlling the behavioral performance of learning of an active avoidance response in the hippocampal structure was studied. Adult male rats were stereotaxically implanted with microinjection cannula into three different regions of the hippocampus: the ventral, the dorsal posterior and the dorsal anterior hippocampus. Different groups of rats were microinjected into these subregions with either saline, 9, 45 or 90 nmol of histamine. Five min later all groups were subjected to learning of a conditioned response to an ultrasonic tone warning an electric shock to the feet of the animals. Three sessions of 8 trials were necessary in order to control animals learn the task. Results show that histamine microinjections into the ventral hippocampus were able to significantly inhibit the natural decrease of the latency to escape during trials, impairing the efficiency of learning. Histamine administration into the dorsal posterior hippocampus was slightly effective in prolonging latency and impairing learning, while injections into the dorsal anterior region of the hippocampus had no effect. Results give a further support to the idea that histamine sensitive neurons in the ventral hippocampus are modulating the memory and learning mechanisms in the rat. In addition, evidence has been found suggesting a regional distribution of histamine sensitive neurons controlling learning of avoidance responses along the septo-temporal axis of the rat hippocampus.

Animals↗
PubMed1994

Long-term exposure to high levels of corticosterone aggravates AF64A-induced cholinergic hypofunction in rat hippocampus in vivo.

Male Sprague-Dawley rats were bilaterally adrenalectomized and corticosterone (CORT) was substituted as subcutaneous pellets in two groups of animals: low- (L-CORT: 1 x 25 mg pellet) or high-level of CORT (H-CORT: 4 x 100 mg pellet). Between 14 and 19 days after CORT substitution, ethylcholine aziridinium (AF64A) was intracerebroventricularly (i.c.v.) injected in the CORT long-term exposed rats and the dose- and time-dependent effect of this treatment was measured on choline acetyltransferase (ChAT) and acetylcholinesterase (AChE) activities in hippocampus and septum and on serotonin (5-HT), 5-hydroxyindoleacetic acid (5-HIAA) and noradrenaline (NA) levels in hippocampus. Rats were killed at 2, 4, 7 and 14 days after AF64A treatment. Starting 4 days after the i.c.v. administration of 0.5 or 1.0 nmol of AF64A, an aggravation of the reduction of ChAT activity was measured in the hippocampus of the H-CORT animals compared to the L-CORT ones. In the septum of the H-CORT rats, the activity of ChAT increased within the first week after the infusion of the toxin, while no significant effect was observed in the L-CORT group. As we observed with ChAT, AF64A induced a severe inhibition of AChE activity in the hippocampus of the H-CORT rats compared to the L-CORT ones. In the septum, an increase of AChE activity was observed in both groups of CORT-exposed animals. In the hippocampus of H-CORT animals, the exacerbation of the inhibition of ChAT and AChE activity was accompanied by a parallel decrease in the content of 5-HT and 5-HIAA starting 4 days after AF64A injections. Finally, NA content in hippocampus was not affected by the toxin in the CORT-substituted animals. These data demonstrate that: (1) long-term exposure to supraphysiological levels of CORT enhances the cholinodisruption induced in hippocampus by AF64A, at doses of 0.5 and 1.0 nmol/side; (2) high circulating plasma CORT concentrations impair hippocampal cholinergic neuronal capacity to recover from damage; and (3) the degree of inhibition of the serotoninergic system is augmented in H-CORT animals, most probably due to an adaptation of the serotoninergic neurons to the larger withdrawal of cholinergic function observed in this group.

Acetylcholinesterase↗
PubMed1995

Non-phosphorylated neurofilament protein immunoreactivity in adult and developing rat hippocampus: specificity and application in grafting studies.

Neurofilament proteins are critical to the development and maintenance of neuronal shape in the nervous system. These proteins are developmentally regulated and several transition forms are expressed, prior to full neuronal stabilization. We have studied the spatial distribution and time course of expression of non-phosphorylated neurofilament protein (NPNFP) immunoreactivity in several preparations of rat hippocampus, using a mixture (SMI 311) of several monoclonal antibodies directed against NPNFP epitopes. Differential staining was observed in young and adult hippocampus. Large pyramidal neurons in CA3 and CA4 subfields were strongly immunoreactive in adult hippocampus whereas the smaller CA1 pyramidal neurons, most interneurons and dentate granule cells were immunonegative. SMI 311 staining initially appeared at postnatal day (P) 5 with positive staining in apical dendrites and soma in a few pyramidal neurons in CA3, but almost reached the adult pattern by P10. Compared to adult hippocampus, the number of immunoreactive interneurons in all subfields appeared increased at P10 and P15. In cultures of embryonic hippocampus, all neurons, regardless of their morphology, were SMI 311 positive, suggesting loss of differential expression in tissue culture conditions. However, SMI 311 expression in fetal hippocampal neurons grafted to adult hippocampus was similar to hippocampal neurons which had developed in situ. These results suggest that SMI 311 antibody identifies a distinct group of primarily CA3 and CA4 pyramidal cells in adult hippocampus. The application of SMI 311 immunostaining appears suitable for identification of large CA3 and CA4 pyramidal neurons within hippocampal transplants grafted to adult CNS but not in tissue culture.

Animals↗
PubMed1996

Enhanced acetylcholine release in the hippocampus and cortex during acquisition of an operant behavior.

The activity of the septo-hippocampal and nucleus basalis-cortical cholinergic pathways was investigated by measuring changes in the extracellular acetylcholine levels in the hippocampus and parietal cortex, by means of transversal microdialysis, during the acquisition and recall of a positively reinforced operant behavior. Adult male Wistar rats were trained in a sound-isolated operant chamber equipped with a single lever. The positive reinforcement was represented by food pellets and the number of cumulative reinforced responses was recorded every 30 min. Five groups of rats were used. Unoperated animals were used as controls. In two groups of untrained animals, the microdialysis tubes were transversally implanted in the parietal cortex, and hippocampus and the training in the operant behavior chamber began 24 h after surgery. In two further groups the microdialysis tubes were implanted in the parietal cortex, and hippocampus after training for 15 days in the operant chamber. Food was removed 12 h before training. The time needed by the control rats to reach a stable baseline of reinforced responses was 83 +/- 12 min, while in the untrained rats implanted with dialysis probes in the cerebral cortex and in the hippocampus was 621 +/- 129 and 521 +/- 126 min, respectively, and in those pretrained and implanted in cerebral cortex and in the hippocampus was 116 +/- 38 and 217 +/- 59 min, respectively. In the untrained operated rats, both cortical and hippocampal extracellular acetylcholine levels remained constant until the number of reinforced responses was low but increased significantly (+156% in the cortex and +183% in the hippocampus) in the first 30 min period in which there was a sharp rise in the reinforced responses. In the pretrained operated rats, neither in the cortex nor in the hippocampus was the increase in response rate accompanied by a statistically significant increase in extracellular acetylcholine levels. Our findings demonstrate that activation of the forebrain cholinergic pathways occurs during the acquisition of a rewarded operant responses, while recall of the same behavior is not associated with the activation of the cholinergic system.

Acetylcholine↗
PubMed1994

Development of mRNAs for glucocorticoid and mineralocorticoid receptors in rat hippocampus.

The hippocampus plays an important role in mediating glucocorticoid effects on the brain. Glucocorticoids are also implicated in neurogenesis and age-related neuronal death in the hippocampus. The effects of glucocorticoids in the hippocampus are elicited through two receptors with high-affinity for corticosterone, the glucocorticoid receptor (GR) and the mineralocorticoid receptor (MR). In this study, we used a sensitive RNase protection assay to quantify the ontogeny of GR mRNA and MR mRNA in hippocampus from embryonic day 18 (E18) to postnatal day 60 (P60). GR mRNA and MR mRNA are expressed at approximately equal levels in the E18 hippocampus. However, by birth, the level of MR mRNA is three-fold that of GR mRNA and remains elevated up to P60. The levels of both mRNAs increase gradually during the period of postnatal neurogenesis after which they markedly increase to adult levels. In addition, the levels of hippocampal MR mRNA are the same in male and female rats, whereas the levels of GR mRNA are significantly higher in the P60 female rat hippocampus, but not in younger female rats. Our data on the development of mRNA levels do not parallel the levels of glucocorticoid and mineralocorticoid receptors as reported in a number of binding studies. Therefore, our studies, when considered together with previous reports, suggest that posttranscriptional mechanisms play a major role in regulating the levels of glucocorticoid-binding sites in the hippocampus.

Animals↗
PubMed1995

What does the hippocampus really do?

Much of the evidence used to implicate the hippocampus in learning and memory has been obtained from clinical cases and/or experimental studies with animals where the damage is extensive and includes more than just the hippocampus. When the damage is limited to the cells that comprise the hippocampus (CA1-CA3 pyramidal cells, hilar and granule cells in the dentate gyrus) the effect on behavior in the rat is more limited than what is usually reported. Selective, axon-sparing ibotenic acid lesions of the hippocampus were used in the experiments that are reviewed to study the effects of removing the hippocampus on: (1) the acquisition of spatial and non-spatial information; (2) complex, non-spatial representational learning; and (3) acquisition and utilization of contextual information. The results indicated that rats with the hippocampus removed were impaired on those tasks that require the utilization of spatial and contextual information but performed like controls in learning about and handling (even complex) non-spatial information. Future research utilizing selective lesions of the hippocampus and sensitive behavioral testing techniques should help clarify the extent to which the impairments in the acquisition of spatial information and the ability to utilize contextual, background cues can be reduced to a single, underlying learning process.

Animals↗
PubMed1996

Development of food-storing and the hippocampus in juvenile marsh tits (Parus palustris).

Food-storing birds, e.g., marsh tits, Parus palustris, use memory to retrieve stored food and have a larger hippocampus relative to the rest of the telencephalon than do species that store little or no food, e.g., blue tits, P. caeruleus. The difference in relative hippocampal volume arises after the young have fledged from the nest and recent work on the dual ontogeny of the hippocampus and memory in hand-raised marsh tits suggests that the hippocampal growth depends upon some aspect of the experience of storing and retrieving food. The aim of this experiment was to test whether hippocampal growth precedes or accompanies changes in food-storing behaviour. Hand-raised marsh tits were provided with the opportunity to store and retrieve food every third day from day 35 post-hatch and the volume of the hippocampus and remainder of the telencephalon was measured and compared with those of age-matched controls at three different stages (days 41, 47 and 56 post-hatch). Experience had no significant effect on telencephalon volume but experienced birds had larger absolute and relative hippocampal volumes than did controls at all stages of the experiment, even before the increase in food-storing intensity on day 44. The stage at which the birds were killed had a significant effect on the absolute volume of both the hippocampus and telencephalon but there was no significant interaction between experience and stage. The results suggest that both hippocampus and telencephalon continue to increase in volume between days 35 and 56 but that the hippocampus shows a additional increase in volume relative to telencephalon in the experienced groups. One interpretation of these results is that the one or two seeds stored before day 44 may have been sufficient to stimulate the growth of the hippocampus and that there is an increase in relative hippocampal volume in preparation for the increased memory demands associated with the sharp increase in food-storing.

Animals↗
PubMed1992

Changes in content of neuroactive amino acids and acetylcholine in the rat hippocampus following transient forebrain ischemia.

Changes in content of selected neuroactive amino acids [glutamic acid, aspartic acid, glycine, gamma-aminobutyric acid (GABA) and taurine] and acetylcholine (ACh) in the rat hippocampus following transient forebrain ischemia were investigated using male Wistar rats. Rats were allowed to survive for 1 or 5 days following 10 or 20 min of 4-vessel occlusion, and killed by a focused microwave irradiation. A significant reduction in all neuroactive amino acids examined except GABA was noted in the hippocampus on the fifth day. One day after the 4-vessel occlusion for 10 min, no significant effect on the content of neuroactive amino acids in all brain areas was observed. gamma-Aminobutyric acid content in the hippocampus was only significantly reduced on the fifth day after the occlusion for 20 min. Similarly, a significant decrease in ACh content in the hippocampus was observed on the fifth day after the occlusion for 20 min. Considering the data that a significant loss of neuronal cells in the hippocampus (delayed neuronal death) was detected only 5 days after the 4-vessel occlusion, it can be said that the alterations in the hippocampus of neuroactive amino acids such as glutamic acid, aspartic acid, glycine and taurine are more sensitive than those in GABA and ACh against cerebral ischemia. A possible correlation of these changes of neuroactive amino acids in the occurrence of delayed neuronal death in the hippocampus is also suggested.

Acetylcholine↗