Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Inverted Repeat Sequences”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,243 records · Page 69Linked to original sources
PubMed1991

Genome cloning and analysis of the large RNA segment (segment A) of a naturally avirulent serotype 2 infectious bursal disease virus.

The genome of infectious bursal disease virus (IBDV) of serotype 2 (strain OH) has been cloned, and 3171 nucleotides of genome segment A cDNA sequence have been determined for the first time. Sequence homology of OH-IBDV with the most distant serotype 1 IBDV at the nucleotide level is 83.1%, and the amino acid sequence homology of the polyprotein is 89.6%. Alignment of the polyprotein amino acid sequences showed the hypervariable region in VP2 to be 151-152 amino acid residues long in IBDV. A second variable region, 37 amino acid residues long, was identified in the N-terminal third of the IBDV VP2 molecule. IBDV strains, like the IPNV strains, also contain inverted repeats that may form stem-and-loop structures in the 5' noncoding sequences. These inverted repeats are variable between the two IBDV serotypes, particularly at the AT basepairs.

Animals↗
PubMed1992

Amplification and characterization of an inverted repeat from the Chlamydomonas reinhardtii mitochondrial genome.

Based on the nucleotide (nt) sequences of cob and L2a, two oligodeoxyribonucleotides (oligos) were synthesized and used in the polymerase chain reaction (PCR) to amplify the termini of the Chlamydomonas reinhardtii mitochondrial (mt) genome. A 0.8-kb PCR product was detected by agarose-gel electrophoresis when using unligated mt DNA as the template for PCR. This may have indicated the presence of a naturally occurring circular mt DNA molecule that acted as the PCR template. The 0.8-kb DNA could also be amplified from the linear mt DNA via an intramolecular jump during PCR. The sequence data from the 0.8-kb PCR product, and the right 0.6-kb and left 1-kb terminal fragments of the linear mt DNA, along with Southern hybridization analysis, indicated that a 0.49-kb inverted repeat (IR) sequence is present at the right and left termini of the linear mt DNA. The IR contains A+T-rich clusters, as well as numerous short direct repeats (DR) and IR, and might be involved in the recombination, replication and expression of the C. reinhardtii mt genome.

Animals↗
PubMed1999

A family of dispersed repeats in the genome of Vicia faba: structure, chromosomal organization, redundancy modulation, and evolution.

A family of repeated DNA sequences of about 1200 bp in length and bordered by well-conserved, 18 bp inverted repeats (VfB family) was found in the nuclear genome of Vicia faba. The structure, chromosomal organization, redundancy modulation and evolution of these sequences were investigated. They are enriched in A+T base pairs (about 40% G+C) and lack any obvious internally repeated motif. A 64%-73% nucleotide sequence identity was found when pairwise comparisons between VfB sequences were carried out (average 69%). Direct repeats were not found to flank the inverted repeats that border these DNA sequences. The results obtained by hybridizing VfB repeats to Southern blots of V. faba genomic DNA digested with EcoRI indicated that these DNA elements are interspersed in the genome. The appearance of bands in these Southern blots and comparison of the structure of the sequences that flank different VfB elements showed that these repeats might be part of other, longer repeated DNA sequences. A high degree of dispersion throughout the genome was confirmed by cytological hybridization, which showed VfB sequences to be scattered along the length of all chromosomes and to be absent or rare only at heterochromatic chromosomal regions. These sequences contribute to intraspecific alterations of genomic size. Indeed, dot-blot hybridizations proved that their redundancy, which is positively correlated with the overall amount of nuclear DNA in each accession, varies between V. faba land races (27x10(3)-230x10(3) copies per 1C DNA). Southern blot hybridization of VfB repeats to restriction endonuclease-digested genomic DNAs of V. faba, V. narbonensis, V. sativa, Phaseolus coccineus, Populus deltoides, and Triticum durum revealed nucleotide sequence homology of these DNA elements, whatever the stringency conditions, only to the DNAs of Vicia species, and to a reduced extent to the DNAs of V. narbonensis and V. sativa compared with that of V. faba. It is concluded that VfB repeats might be descended from mobile DNA elements and contribute to change genomic size and organization during evolution.

Base Composition↗
PubMed1989

Long-range structural effects in supercoiled DNA: statistical thermodynamics reveals a correlation between calculated cooperative melting and contextual influence on cruciform extrusion.

We have previously described [K. M. Sullivan and D. M. J. Lilley (1986) Cell 47, 817-827] a set of sequences, called C-type inducing sequences, which cause cruciform extrusion by adjacent inverted repeats to occur by an abnormal kinetic pathway involving a large denatured region of DNA. In this paper we apply statistical thermodynamic DNA helix melting theory to these sequences. We find a marked correlation between the ability of sequences to confer C-type cruciform character experimentally and their calculated propensity to undergo cooperative melting, and no exceptions have been found. The correlations are both qualitative and quantitative. Thus the ColE1 flanking sequences behave as single melting units, while the DNA of the S-type plasmid pIRbke8 exhibits no propensity to melt in the region of the bke cruciform. The results of the calculations are also fully consistent with the following experimental observations: 1. the ability of the isolated colL and colR fragments of the ColE1 flanking sequences, as well as the short sequence col30, to confer C-type character; 2. C-type induction by an A + T rich Drosophila sequence; 3. low-temperature cruciform extrusion by an (AT)34 sequence; 4. the effect of changing sequences at a site 90 base pairs (bp) removed from the inverted repeat; 5. the effects of systematic deletion of the colL sequence; and 6. the effects of insertion of various sequences in between the colL sequence and the xke inverted repeat. These studies show that telestability effects on thermal denaturation as predicted from equilibrium helix melting theory of linear DNA molecules may explain all the features that are revealed by studying the extrusion of cruciforms in circular DNA molecules subjected to superhelical stress.

Base Composition↗
PubMed1988

Structural interconversion of alternating purine-pyrimidine inverted repeats cloned in supercoiled plasmids.

Two self complementary oligonucleotides, T(GC)4AT(GC)4ACATG and C(GC)2(AT)5 (GC)3ATG, were synthesized and cloned into plasmids. Negative supercoiling causes a structural transition in the primary helix of both inserts. The first sequence converts into the left-handed helix, whereas the second sequence undergoes a transition into a cruciform or a Z-type structure depending on the experimental conditions employed. This has been deduced from the mapping of S1 nuclease sensitive sites, OsO4-sensitive sites, DEP modification pattern and relaxation studies. In addition, the differential effect of 5-cytosine methylation and binding of the AT-specific drug distamycin on these transitions further supports this interpretation. Thus, it is demonstrated, that the same sequence which is both inverted repeat and alternating purine-pyrimidine type may adopt either the left-handed conformation or the cruciform structure in response to the superhelical stress. Formation of the Z-type helix can be transmitted through the d(AT)n region which is 10 bp in length.

5-Methylcytosine↗
PubMed2000

Phylogenetic analysis of the functional domains of mariner-like element (MLE) transposases.

We have analyzed the sequences of mariner-like element (MLE) transposases, in order to obtain a clearer picture of their phylogenetic relationships. In particular, we have considered their two known structural domains, as well as the nucleic acid sequences of the MLE inverted terminal repeats (ITR). The most consistent tree was obtained using sequences of the catalytic domain of the transposase. The trees obtained with the amino acid sequences of the ITR-binding domain and the ITR sequences themselves were similar to that obtained with the catalytic domain. However, a major difference indicated that the cecropia sub-family is divided into two sub-groups. These new trees were used to examine the evolutionary divergence of mariner-like transposable elements, with particular reference to the possibility that recombination events or gene conversions created mosaic elements during the evolution of transposons.

Amino Acid Sequence↗
PubMed1995

Cloning and sequencing of a secY homolog from Streptomyces scabies.

The complete DNA sequence of the Streptomyces scabies (Ss) secY homolog and partial sequences of adjacent upstream and downstream open reading frames (ORFs) have been determined. The nucleotide sequence of a 2-kb region predicts a polypeptide of 437 amino acids in length with homology to the SecY protein family. The Ss secY homolog lies upstream from a sequence that has homology to the adenylate kinase gene (adk) family. The translational stop codon of the putative SecY ORF overlaps the predicted start codon for the Adk ORF. Another ORF that lies upstream from the secY homolog has sequence similarity to the genes that code for the L15 r-protein. Within the 243-bp intergenic region between the L15 and SecY coding sequences, the presence of a streptomycete-like promoter sequence and an 18-bp inverted repeat suggests that the secY homolog and the adjacent downstream sequences may be transcribed independently of the L15 coding sequence. Transcript analysis indicates that the secY homolog is expressed in both Ss and Streptomyces lividans. The proposed gene and transcript organization of the L15-SecY-Adk coding regions in the Ss clone resembles that of Micrococcus luteus which, like the streptomycetes, has a G+C-rich genome.

Adenylate Kinase↗
PubMed1995

Cooperative binding of Tn3 resolvase monomers to a functionally asymmetric binding site.

BACKGROUND: The inverted repeat is a common feature of protein-binding sites in DNA. The two-fold symmetry of the inverted repeat corresponds to the two-fold symmetry of the protein that binds to it. In most natural inverted-repeat binding sites, however, the DNA sequence does not have perfect two-fold symmetry. Our study of how a site-specific recombinase recognizes an inverted-repeat binding site indicates that such sequence asymmetry can be functionally important. RESULTS: Tn3 resolvase forms two complexes with the 34 base-pair binding site II of its recombination region, res. A resolvase monomer first binds at the left end of the site; a second monomer then binds cooperatively at the right end. In both complexes, the DNA is bent by resolvase. In contrast, the closely related gamma delta resolvase binds to site II mainly as a dimer. Insertion of 5 or 10 base pairs at the centre of the site does not prevent cooperative binding of two Tn3 resolvase subunits. The fully occupied site II has a very asymmetric structure. Reversal of the orientation of site II in res blocks recombination; thus, its asymmetric properties are functionally important. We propose a structure for the two-subunit complex formed with site II, based on our results and by analogy with the co-crystal structure of gamma delta resolvase bound to res site I. CONCLUSIONS: Deviations from perfect inverted-repeat symmetry in a resolvase-binding site lead to ordered binding of subunits, structural asymmetry of resolvase-DNA complexes, and asymmetric function.

Base Sequence↗
PubMed1985

Extrachromosomal DNA transformation of Caenorhabditis elegans.

DNA was introduced into the germ line of the nematode Caenorhabditis elegans by microinjection. Approximately 10% of the injected worms gave rise to transformed progeny. Upon injection, supercoiled molecules formed a high-molecular-weight array predominantly composed of tandem repeats of the injected sequence. Injected linear molecules formed both tandem and inverted repeats as if they had ligated to each other. No worm DNA sequences were required in the injected plasmid for the formation of these high-molecular-weight arrays. Surprisingly, these high-molecular-weight arrays were extrachromosomal and heritable. On average 50% of the progeny of a transformed hermaphrodite still carried the exogenous sequences. In situ hybridization experiments demonstrated that approximately half of the transformed animals carried foreign DNA in all of their cells; the remainder were mosaic animals in which some cells contained the exogenous sequences while others carried no detectable foreign DNA. The presence of mosaic and nonmosaic nematodes in transformed populations may permit detailed analysis of the expression and function of C. elegans genes.

Animals↗
PubMed1990

Cloning and sequence analysis of linear plasmid telomeres of the bacterium Borrelia burgdorferi.

Borrelia burgdorferi, the Lyme disease agent, has double-stranded linear plasmids with covalently closed ends. DNA at the ends, or telomeres, of two linear plasmids of B. burgdorferi strain B31 was examined. Telomeric sequences from both ends of a 16 kb linear plasmid and from one end of a 49 kb linear plasmid were cloned and sequenced. An 18 bp AT-rich inverted repeat was found at each end of the 16 kb linear plasmid. The sequences of the two ends of this plasmid were different beyond these short inverted terminal repeats. The cloned end of the 49 kb linear plasmid had sequence identity with one end of the 16 kb linear plasmid. The end sequence common to both plasmids contained a series of phased, short direct repeats and a 52 bp palindrome adjacent to a highly AT-rich region. These findings indicate that Borrelia linear plasmid telomeres have structural features different from those of other known replicons.

Base Sequence↗
PubMed1992

A 16 kb small single-copy region separates the plastid DNA inverted repeat of the unicellular red alga Cyanidium caldarium: physical mapping of the IR-flanking regions and nucleotide sequences of the psbD-psbC, rps16, 5S rRNA and rpl21 genes.

The four inverted repeat (IR) flanking regions of the Cyanidium caldarium plastid DNA were cloned. Southern blotting, transcript and sequence analyses of the border regions revealed the psbD-psbC operon and the rps16 gene within the large single-copy region upstream of the 16S rDNA gene and the rpl21 gene downstream of the 5S rDNA within the 16 kb small single-copy region. The size of the IR is ca. 5 kb. The nucleotide sequences of the psbD-psbC, rps16, rpl21 and 5S rRNA genes with the corresponding alignments and physical maps of the regions are presented. Northern analysis revealed a less complex psbD-psbC transcription pattern than has been found in higher plants. Comparisons to other red algal data point to structural diversity within red algal plastid DNA.

Amino Acid Sequence↗
PubMed1993

A cluster of strong topoisomerase II cleavage sites is located near an integrated human immunodeficiency virus.

The Human Immunodeficiency Virus (HIV) integrates into host cellular DNA as a double strand DNA molecule. Here a previously studied HIV isolate was examined for binding and cleavage by topoisomerase II in vitro within the 5' LTR region and human flanking DNA. A cluster of strong binding and cleavage sites in the human sequences was located approximately 850 bp upstream from the integration site. This region maps to a locus consisting of a complex repeating element, and alternating purine/pyrimidine sequences. Topoisomerase II binding and cleavage sites were also located within the HIV 5' LTR, in particular a site overlying the DNA sequence coding for TAR, another inverted repeat element in the DNA.

Base Sequence↗
PubMed2005

A novel rudivirus, ARV1, of the hyperthermophilic archaeal genus Acidianus.

Virus ARV1, the first member of the family Rudiviridae infecting hyperthermophilic archaea of the genus Acidianus, was isolated from a hot spring in Pozzuoli, Italy. The rod-shaped virions, 610 +/- 50 nm long and 22 +/- 3 nm wide, are non-enveloped and carry a helical nucleoprotein core, with three tail fibers protruding at each end which appear to be involved in adsorption onto the host cell surface. The virions contain two protein components, a major one of 14.4 kDa, which is glycosylated and a minor of about 124 kDa. The linear double-stranded DNA genome yielded 24,655 bp of sequence, including 1365 bp inverted terminal repeats. Coding is on both strands and about 40% of the predicted genes are homologous to those of other hyperthermophilic crenarchaeal viruses, mainly rudiviruses. They include genes encoding the coat protein, two glycosyl transferases and a Holliday junction resolvase. Other assigned functions include a thymidylate synthase and three DNA-binding proteins. The genome sequence and composition differ strongly from those of the Sulfolobus rudiviruses SIRV1 and SIRV2, and the genome stability is very high, with no sequence variants being detected. Although the sequences of the inverted terminal repeats of the three rudiviruses are different, they all carry the motif AATTTAGGAATTTAGGAATTT near the genome ends which may constitute a signal for the Holliday junction resolvase and DNA replication.

Acidianus↗
PubMed1976

Structural evolution of bacterial plasmids: role of translocating genetic elements and DNA sequence insertions.

Recent evidence suggests that plasmids have evolved by site-specific recombinational events involving translocation and insertion of discretely defined DNA segments. The role of translocating genetic elements and repeated DNA sequences in the formation and structural evolution of bacterial plasmids, and in the control of plasmid gene expression, is the subject of this brief review. Insertion sequence (IS) regions are discrete segments of DNA that are known to cause strongly polar mutations in the genes of Escherichia coli and several bacteriophages as a consequence of their insertion into bacterial or phage genomes. Recent investigations have identified three separate kinds of IS segments on plasmids, and have indicated that such regions may have a role in 1) site-specific reversible dissociation of antibiotic resistance plasmids into their component segments, 2) recombination of certain plasmids with the bacterial chromosome, and 3) translocation of segments of plasmid DNA onto other replicons, or onto different sites of the same replicon. In addition, such DNA sequences, which may be repeated on plasmid genomes in either direct or reverse orientation, are involved in the control of plasmid gene expression. Inverted repeats other than the genetically characterized IS segments also appear to be involved in recA-independent, recombination and translocation of plasmid DNA segments. These inverted repeats contain palindromic nucleotide sequences on each strand of DNA and are detectable as hairpin-loop structures by electron microscope heteroduplex analysis. Such palindromes resemble the recognition sites for restriction endonucleases, some of which are encoded by plasmids, suggesting that similar endonucleolytic enzymes may be involved in the translocation of plasmid DNA segments.

Base Sequence↗
PubMed1980

Tandem repeats within the inverted terminal repetition of vaccinia virus DNA.

A tandemly repeated sequence within the genome of vaccinia virus is cut to fragments of approximately 70 bp by Hinf I, Taq I or Mbo II. The 70 bp repetition was localized within the much larger (10,300 bp) inverted terminal repetition by restriction analysis of cloned DNA fragments and by hybridization of the purified 70 bp repeat to vaccinia virus DNA restriction fragments. The molar abundance of the 70 bp fragment corresponds to a 30 fold repetition at each end of the genome. The repeating restriction endonuclease sites were mapped by agarose gel electrophoresis of partial Hinf I digests of the terminally labeled cloned DNA fragment. The first of 13 repetitive Hinf I sites occurred approximately 150 bp from the end of the cloned DNA. After an intervening sequence of approximately 435 bp, a second series of 17 repetitive Hinf I sites occurred. The DNA between the two blocks of repetitions has a unique sequence containing single Dde I, Alu I and Sau 3A sites. Tandem repeats within the inverted terminal repetition could serve to accelerate self-annealing of single strands of DNA to form circular structures during replication.

Base Sequence↗
PubMed1978

Oligonucleotides in heterogeneous nuclear RNA: similarity of inverted repeats and RNA from repetitious DNA sites.

A comparison has been made by oligonucleotide analysis of three fractions of HeLa cell hnRNA: (1) the "snap-back" fraction (ds-hnRNA, 5% of the total); (2) the fraction that self-anneals during prolonged incubation (25% of total); and (3) the fraction that hybridizes most rapidly to an excess of HeLa cell DNA (rep-hnRNA, 10% of the total). T1 fingerprints of each of these hnRNA fractions were similar to one another and featured the largest T1 oligonucleotides of known sequence previously isolated from ds-hnRNA (Robertson, H.D., et al. (1977) J. Mol. Biol. 115, 571--590; Jelinek, W. (1977 J. Mol. Biol. 115, 591--602). When hybridized to DNA either in solution or immobilized on filters, the isolated ds-hnRNA and the rep-hnRNA fractions showed similar hybridization kinetics in the COt range of "intermediate" repetitive DNA sequences; the ds-hnRNA and the rep-hnRNA also self-annealed to equal extents in the absence of any DNA. DNA of all buoyant density classes contained the T1 oligonucleotides diagnostic of the ds-hnRNA and the rep-hnRNA. While hnRNA is rich in inverted repeated sequences, cytoplasmic mRNA contains far fewer such sequences.

Base Sequence↗
PubMed2006

A high-throughput screen identifying sequence and promiscuity characteristics of the loxP spacer region in Cre-mediated recombination.

BACKGROUND: Cre-loxP recombination refers to the process of site-specific recombination mediated by two loxP sequences and the Cre recombinase protein. Transgenic experiments exploit integrative recombination, where a donor plasmid carrying a loxP site and DNA of interest integrate into a recipient loxP site in a target genome. Unfortunately, integrative recombination is highly inefficient because the insert is flanked by two loxP sites, which themselves become targets for Cre and lead to subsequent excision of the insert. A small number of mutations have been discovered in parts of the loxP sequence, specifically the spacer and inverted repeat segments, that increase the efficiency of integrative recombination. In this study we introduce a high-throughput in vitro assay to rapidly detect novel loxP spacer mutants and describe the sequence characteristics of successful recombinants. RESULTS: We created synthetic loxP oligonucleotides that contained a combination of inverted repeat mutations (the lox66 and lox71 mutations) and mutant spacer sequences, degenerate at 6 of the 8 positions. After in vitro Cre recombination, 3,124 recombinant clones were identified by sequencing. Included in this set were 31 unique, novel, self-recombining sequences. Using network visualization tools, we recognized 12 spacer sets with restricted promiscuity. We observed that increased guanine content at all spacer positions save for position 8 resulted in increased recombination. Interestingly, recombination between identical spacers was not preferred over non-identical spacers. We also identified a set of 16 pairs of loxP spacers that reacted at least twice with another spacer, but not themselves. Further, neither the wild-type P1 phage loxP sequence nor any of the known loxP spacer mutants appeared to be kinetically favoured by Cre recombinase. CONCLUSION: This study approached loxP spacer mutant screening in an unbiased manner, assuming nothing about candidate loxP sites save for the conserved 4 and 5 spacer positions. Candidate sites were free to recombine with any other sequence in the pool of all possible sites. The subset of loxP sites identified here are candidates for in vivo serial recombination as they have already demonstrated limited promiscuity with other loxP spacer and stability in the presence of Cre.

Bacteriophage P1↗