Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Genetic polymorphisms”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,243 records · Page 69Linked to original sources
PubMed1986

Monoclonal antibody MB19 detects genetic polymorphism in human apolipoprotein B.

Using a specific monoclonal antibody (MB19) against human apolipoprotein B (apo B), we have detected a genetic polymorphism in human low density lipoprotein (LDL). MB19 bound to LDL from different individuals in one of three distinct patterns of immunoreactivity: strong, weak, and intermediate. Scatchard analysis revealed that LDLs with strong and with weak binding patterns differed 10-fold in their affinity for MB19, but both bound the same total amount of antibody (about one mole of MB19 per mole of apo B). LDL showing the intermediate binding pattern yielded a curvilinear Scatchard plot that could be resolved into two distinct components with affinities similar to those of LDLs exhibiting only the high- or only the low-affinity binding of MB19. LDL chemical composition was similar for all three MB19 binding patterns, and the polymorphism remained after removal of LDL lipid or carbohydrate. Analysis of plasmas from 77 unrelated individuals indicated that 40% of them bound MB19 with low affinity, 23% with high affinity, and 36% with intermediate or "hybrid" affinity. Family studies showed that the three MB19 binding patterns result from codominant transmission of two common apo B alleles, each coding for an allotype with different affinity for MB19, conditionally designated here MB19(1) (high affinity) and MB19(2) (low affinity).

Antibodies, Monoclonal↗
PubMed2004

Genetic polymorphism of cytochrome P450 2C19 in healthy Malaysian subjects.

AIMS: Impaired S-mephenytoin 4'-hydroxylation is a well-described genetic polymorphism affecting drug metabolism in humans. Although ethnic differences in its distribution of polymorphism has been described, it is not known whether there is an ethnic heterogeneity of the structure and expression of the CYP2C19 enzyme in the Malaysian population. METHODS: Study subjects were 142 healthy, unrelated Malaysians aged 18-29 years. Baseline omeprazole and 2-h postingestion omeprazole and 5'-hydroxyomeprazole concentrations were measured for CYP2C19 phenotype determination. Identification of CYP2C19 genotypes was performed with the use of polymerase chain reaction. RESULTS: Phenotyping of CYP2C19 revealed that the prevalence of poor metabolizers (PMs) in the Malaysian population was 14.1%, whereas prevalence of PMs in genotyping was 12.6%. The PM genotypic prevalence rate was 5.6% in Malays, 19.1% in Chinese and 10.0% in Indian subjects. There were significant differences in PM genotypic prevalence rates among the three primary ethnic groups (P < or = 0.05). CONCLUSIONS: Phenotyping and genotyping revealed significant differences in the prevalence rates among the three ethnic groups in Malaysia, with Chinese recording highest prevalence.

2-Pyridinylmethylsulfinylbenzimidazoles↗
PubMed2004

Methylenetetrahydrofolate reductase and transcobalamin genetic polymorphisms in human spontaneous abortion: biological and clinical implications.

The pathogenesis of human spontaneous abortion involves a complex interaction of several genetic and environmental factors. The firm association between increased homocysteine concentration and neural tube defects (NTD) has led to the hypothesis that high concentrations of homocysteine might be embryotoxic and lead to decreased fetal viability. There are several genetic polymorphisms that are associated with defects in folate- and vitamin B12-dependent homocysteine metabolism. The methylenetetrahydrofolate reductase (MTHFR) 677C>T and 1298A>C polymorphisms cause elevated homocysteine concentration and are associated with an increased risk of NTD. Additionally, low concentration of vitamin B12 (cobalamin) or transcobalamin that delivers vitamin B12 to the cells of the body leads to hyperhomocysteinemia and is associated with NTD. This effect involves the transcobalamin (TC) 776C>G polymorphism. Importantly, the biochemical consequences of these polymorphisms can be modified by folate and vitamin B12 supplementation. In this review, I focus on recent studies on the role of hyperhomocysteinemia-associated polymorphisms in the pathogenesis of human spontaneous abortion and discuss the possibility that periconceptional supplementation with folate and vitamin B12 might lower the incidence of miscarriage in women planning a pregnancy.

Abortion, Spontaneous↗
PubMed2003

[Genetic polymorphisms on drug metabolizing enzymes in relation to anti-cancer drug effectiveness].

Wide inter-individual difference has been documented for various drug metabolizing enzymes(DMEs) and drug transporters. Some of the single nucleotide polymorphisms(SNPs) existing in the genes encoding DMEs and drug transporters have been associated with the deficiency of DMEs and the transporters. In the case of therapeutic drugs that undergo metabolism by a single DME, serious adverse effect might occur for patients who are devoid of the DME. Function of a number of DMEs and transporters are likely to affect drug effectiveness of three anti-cancer agents, irinotecan, taxol and 5-fluorouracil. Genetic polymorphisms of the genes related to the effectiveness of these drugs are discussed from the aspect of effects of the genetic polymorphisms on their metabolism and disposition.

Antineoplastic Agents↗
PubMed2005

[A case-control study on the association between genetic polymorphisms of metabolic enzymes and the risk of colorectal cancer].

OBJECTIVE: To investigate the association between metabolic enzymes polymorphisms and the risk of colorectal cancer(CRC). METHODS: Methods of detection used were based on polymerase chain reaction(PCR) including PCR-restriction fragment length polymorphism (PCR-RFLP), allele specific-PCR (AS-PCR) and multiple-PCR to identify the polymorphisms of CYP1A1 6235T/C, CYP1A2 734C/A, CYP2E1 -1259G/C, CYP2E1 -1019C/T, GSTM1 and T1 null type, NAT1 and NAT2 alleles among 140 cases and 343 cancer-free controls. RESULTS: The allele frequencies of CYP1A1 6235C, CYP1A2 734A, CYP2E1 -1259C, CYP2E1 -1019T, GSTM1 and T1 null type, NAT1* 10 and NAT2 Mx (x = 1,2,3) alleles were 31.65%, 63.77%, 23.02%, 32.61%, 57.25%, 17.39%, 26.45% and 39.21% in the case group and 39.85%, 66.62%, 20.27%, 28.61%, 55.46%, 20.35%, 25.22% and 39.36% in control group, respectively. The frequencies were in Hardy-Weinberg equilibrium. Data on single genetic polymorphism and stratification analysis of multi-genetic polymorphisms indicated that CYP1A1 6235CC homozygote was associated with the significant reduction of CRC risk (OR = 0.79, 95% CI: 0.63-0.99) and in individuals with CYP1A2 734A allele. CYP1A1 62345C allele had the same effect (OR = 0.53, 95% CI: 0.34-0.83). However, individuals with GSTT1 null genotype, GSTM1 null genotype could significantly increase the risk (OR = 4.41, 95% CI: 1.21-16.10). CONCLUSION: CYP1A1 6235C allele might play an important role in fighting against colorectal carcinogenesis. However, GSTM1 and T1 null genotype might serve as risk factors genetically. Larger scale population-based studies were needed to confirm the current findings.

Alleles↗
PubMed2005

Genetic polymorphisms in patients with myelodysplastic syndrome.

Myelodysplastic syndrome (MDS) is a family of clonal disorders characterized by dyshematopoiesis and susceptibility to acute myelogenous leukemia. Tumor necrosis factor-a (TNF-alpha) and transforming growth factor-beta (TGF-beta) are cytokines that play key roles in the pathogenesis of MDS. There have been several reports on the presence of genetic polymorphisms in the DNA sequence encoding the leader sequence of the TGF-beta protein, and in the -308 promoter region of TNF-alpha. The association between TNF-alpha and TGF-beta1 gene polymorphism and the susceptibility to MDS and the progression of the disease was investigated. As compared with healthy control subjects (n = 74), patients with MDS (n = 55) showed no significant deviations in genotype or allele frequencies of TNF-alpha. Similarly, there were no differences in the distribution of TNF-alpha genotypes between the MDS patients with only anemia (mild group) and those with bi- or pancytopenia (severe group). On the other hand the TT homozygosity at codon 10 in exon 1 of TGF-beta1 gene was associated with a severe degree of cytopenia [95% CI OR = 4.889, p = 0.0071]. These findings suggest that the investigated genetic polymorphisms do not predispose to the development of MDS, but that TGF-beta1 gene polymorphism may affect the disease progression.

Adult↗
PubMed2005

[Genetic polymorphism of mitochondrial DNA in coding region in 16 ethnic populations of Yunnan].

The genetic polymorphism of mitochondrial DNA in the coding region in 16 ethnic populations of Yunnan was analyzed using PCR-RFLP in a total of 654 samples. Seventeen haplogroups were found, four of which were undefined haplogroups. Haplogroup distribution and Principal Component (PC) analysis showed that the ethnic groups descended from Bai-Yue tribe have B, F and M7 as the predominant haplogroups,which indicated their origination from southern China. Haplogroup A, D and N9 were predominant in the Mongolian ethnic group, reflecting their north-originated characteristics. The groups descended from Di-Qiang tribe shared the predominant haplogroups with both the south and north originated groups,which demonstrated that they inherit the maternal characteristics from both southern and northern populations. There is genetic difference among the populations in the same ethnic group and is usually smaller than that among the ethnic groups from different ancient tribes, but not necessarily smaller than that among the groups from the same tribe.

Asian People↗
PubMed2000

Genetic polymorphism in paraoxonase is a risk factor for childhood focal segmental glomerulosclerosis.

Focal segmental glomerulosclerosis (FSGS) is an important cause of end-stage renal failure (ESRF) in children. Our previous studies have shown that Arab children in Israel have a worse prognosis compared with Jewish patients despite similar clinical presentation and management. Progression of proteinuric glomerular diseases has been associated with alterations in lipid metabolism, and similarities have been drawn between the mechanisms underlying atherosclerosis and glomerulosclerosis. Paraoxonase (PON) is a high-density lipoprotein (HDL)-associated enzyme involved in preventing the oxidation of low-density lipoprotein (LDL), and an association has been shown between two genetic polymorphisms in PON1 and the risk of coronary artery disease. The aim of this study was to determine the frequency of these genetic polymorphisms in PON1 in Arab and Jewish children with FSGS and to determine any association with severity of outcome. Forty-seven children (21 Arab and 26 Jewish) with biopsy-proven FSGS and 274 healthy controls of matching ethnic origin were studied. The glutamine (A)-192-arginine (B) and the methionine (M)-55-leucine (L) polymorphisms were analyzed. The frequency of the A allele was similar in patients and controls (0.68 versus 0.71), as was that of the L allele (0.63 versus 0.6). When subgroups were analyzed, the prevalence of the LL genotype in Arab patients was significantly greater than in Jewish patients (57.1% versus 26.9%, P: < 0.05) and Arab controls (57.1% versus 28.9%, P: < 0.03). A trend in association was found between homozygosity for the L allele and progression of renal disease in Arab children. Homozygosity for the L allele is a risk factor for developing FSGS in Arab children and may be associated with a worse prognosis.

Adolescent↗
PubMed2002

[Using RAPD for estimating genetic polymorphism in and phylogenetic relationships among species of the genus Lycopersicon (Tourn.) Mill].

RAPD genome analysis of 53 species and cultivars of the genus Lycopersicon (Tourn.) Mill. revealed their high genetic polymorphism (Tourn.) Mill., based on which their phylogenetic relationships were inferred. In total, 248 polymorphic DNA fragments were amplified. Intraspecific polymorphism was maximum (79%) in L. peruvianum and minimum (9%) in L. parviflorum. In general, genome divergence among cross-pollinating tomato species was substantially higher than in self-pollinating species. An UPGMA dendrogram constructed from the RAPD patterns was consisted with the Lycopersicon phylogeny inferred from the molecular data of RFLP, ISSR, and microsatellite analyses and with a classification based on morphological characters. The relationships of taxa within the genus Lycopersicon are discussed.

Phylogeny↗
PubMed1999

Novel genetic polymorphisms in DNA repair genes: O(6)-methylguanine-DNA methyltransferase (MGMT) and N-methylpurine-DNA glycosylase (MPG) in lung cancer patients from Poland.

Individuals with a decreased DNA repair capacity are at increased cancer risk. The aim of our investigation was to detect genetic polymorphisms in DNA repair genes. Two genes, MPG and MGMT, involved in repair of alkylated purines, have been selected. The genetic polymorphisms in the coding exons 2, 3 and 4 of MPG and in the enhancer region of MGMT were searched for in DNA samples from a group of 33 non-small-cell lung cancer (NSCLC) patients from Poland. The PCR products were sequenced with fluorescently labeled terminators and separated on automatic sequencer. Two polymorphisms in MPG were found: in exon 2: CGC-->TGC, (8603C>T, Genbank Accession Z69720) and in exon 3: CCG-->CCA, (12235G>A, Genbank Accession Z69720). The polymorphism in exon 2 results in amino acid substitution (Arg>Cys). Three polymorphisms within or around 59 bp enhancer of MGMT were detected: 1) 1034A>G (Genbank Accession X61657), 2) 1099C>T (Genbank Accession X61657), 3) 79G>T (Genbank Accession U95038). Polymorphism 2 is located in the 59-bp enhancer sequence, within a palindrome GGTGCGCACC. Polymorphism 3 destroys an inverted repeat GGGTGGGGGGCCGCCCTGACCCCCACCC that contains two PuF binding sequences GGGTGGG separated by Sp1 site. The nature and location of these polymorphisms is consistent with the hypothesis that they may have functional significance.

Carcinoma, Non-Small-Cell Lung↗
PubMedDate not supplied

Phosphoglucomutase genetic polymorphism of newborns.

An association of the phosphoglucomutase locus 1 (PGM1) genetic polymorphism with repeated spontaneous abortion (RSA), with intrauterine development in both normal and diabetic pregnancies, and with fertility has been reported in previous studies. In view of the evolutionary interest and of a possible clinical relevance of PGM1 selection during intrauterine life, this study considers healthy puerperae, consecutive newborns, and couples with RSA as well as two alleles (PGM1*1 and PGM1*2). The joint maternal-neonatal PGM1 distribution in a sample from an Italian rural population is significantly different from that expected assuming Hardy-Weinberg conditions for equilibrium. Deviation is dependent on maternal age and parity. The joint mother-newborn PGM1 genotype distribution is significantly associated with a positive history of previous spontaneous miscarriage, suggesting that the presence of the PGM1*2 allele in the father predisposes to spontaneous abortion. This hypothesis is also supported by the observation that in couples with RSA, the delivery of a live born infant within 5 years from the first episode of miscarriage is negatively associated with the presence of a PGM1*2 allele in the husband. Altogether these observations suggest the hypothesis of PGM1 maternal selection at the reproductive level involving a differential role of PGM1*1 and PGM1*2 alleles of paternal origin.

Abortion, Habitual↗
PubMed2002

Genetic polymorphisms of DNA repair and xenobiotic-metabolizing enzymes: role in mutagen sensitivity.

Mutagen sensitivity, measuring the extent of chromosome damage induced by an in vitro treatment of peripheral lymphocytes with bleomycin, has been associated with an increased risk of various human cancers. Sensitivity to bleomycin appears to have high heritability and is usually considered to reflect individual capacity to repair DNA lesions. Another potential contributor to variation in bleomycin sensitivity could be inherited differences in the metabolism of bleomycin. We assessed whether genetic polymorphisms of DNA repair and xenobiotic-metabolizing enzymes (XMEs) could explain bleomycin sensitivity. Frequencies of bleomycin-induced chromatid breaks per cell (b/c) were determined for 80 healthy Caucasians. Genotypes of DNA repair genes XRCC (X-ray repair cross-complementing) 1 and 3 and XME genes bleomycin hydrolase (BLHX), glutathione S-transferase M1 (GSTM1) and T1 (GSTT1) and N-acetyltransferase 2 (NAT2) were analyzed from leukocyte DNA using methods based on polymerase chain reaction. The mean number of chromatid b/c was increased in individuals with XRCC1 codon 280 variant allele (P = 0.002; two-sided Mann-Whitney test). Smokers carrying BLHX codon 1450 variant allele showed a decrease in the mean number of chromatid b/c (P = 0.036). In multiple linear regression models including adjustment for age, sex, smoking and genotype, the adjusted relative risks (and 95% confidence intervals) were 1.18 (0.98-1.41) and 0.84 (0.69-1.00) for carriers of XRCC1 codon 280 and BLHX codon 1450 variant alleles, respectively. XRCC1 codon 280 polymorphism had a significant effect (P = 0.012) in predetermining whether the individual was classified as non-sensitive, sensitive or hypersensitive to bleomycin. Although based on relatively few individuals, our results suggest that bleomycin sensitivity is partially explained by genetic polymorphisms affecting DNA repair (XRCC1) and in vitro metabolism of bleomycin (BLHX).

Arylamine N-Acetyltransferase↗
PubMed2004

Association study of serotonin 1B receptor (A-161T) genetic polymorphism and suicidal behaviors and response to fluoxetine in major depressive disorder.

Serotonin 1B receptors (5-HT1B) are autoreceptors involved in the local inhibitory control of serotonin release, and have been suggested to play a role in the pathogenesis of major depressive disorder (MDD) and the antidepressant effects of the selective serotonin reuptake inhibitors in patients. We genotyped the 5-HT1B A-161T polymorphism in 160 patients with MDD and 160 normal controls. We then tested the hypothesis that the allelic variant, A-161T, of the 5-HT1B gene confers susceptibility to MDD or is associated with suicide attempt. We also examined the association of this polymorphism with therapeutic response in 116 of the MDD patients who received fluoxetine treatment for 4 weeks. No significant difference was found in the A-161T genetic polymorphism between MDD patients and controls. The genotype distribution between patients with and without suicide attempt, or between fluoxetine treatment responders and nonresponders were also similar. Our findings suggest that 5-HT1B A-161T genetic polymorphism does not play a major role in the susceptibility to MDD, nor is it related to suicidal attempt or the therapeutic response to fluoxetine in MDD.

Adult↗
PubMed2003

Genetic polymorphism of the swine major histocompatibility complex ( SLA) class I genes, SLA-1, -2 and -3.

In order to identify and characterize genetic polymorphism of the swine major histocompatibility complex ( Mhc: SLA) class I genes, RT-PCR products of the second and third exons of the three SLA classical class I genes, SLA-1, SLA-2 and SLA-3 were subjected to nucleotide determination. These analyses allowed the identification of four, eight and seven alleles at the SLA-1, SLA-2 and SLA-3 loci, respectively, from three different breeds of miniature swine and one mixed breed. Among them, 12 alleles were novel. Construction of a phylogenetic tree using the nucleotide sequences of those 19 alleles indicated that the SLA-1 and -2 genes are more closely related to each other than to SLA-3. Selective forces operating at single amino acid sites of the SLA class I molecules were analyzed by the Adaptsite Package program. Ten positive selection sites were found at the putative antigen recognition sites (ARSs). Among the 14 positively selected sites observed in the human MHC ( HLA) classical class I molecules, eight corresponding positions in the SLA class I molecules were inferred as positively selected. On the other hand, four amino acids at the putative ARSs were identified as negatively selected in the SLA class I molecules. These results suggest that selective forces operating in the SLA class I molecules are almost similar to those of the HLA class I molecules, although several functional sites for antigen and cytotoxic T-lymphocyte recognition by the SLA class I molecules may be different from those of the HLA class I molecules.

Alleles↗
PubMed1988

Genetic polymorphism of alpha 2HS-glycoprotein in a French population. Description of two new rare variants.

A French population was investigated for genetic polymorphism of alpha 2HS-glycoprotein (A2HS; nomenclature according to Human Gene Mapping 7, Los Angeles, 1983) using isoelectric focusing and immunoblotting. Three variants were observed together with two common alleles A2HS 1 and A2HS 2, whose frequencies were significantly different from the data in Canadians and Egyptians. An anodal variant to A2HS 1 was identical to a variant with two different nomenclatures reported by three different groups, indicating that there is a confusion in the A2HS nomenclature. The others were new variants with cathodal isoelectric points to A2HS 2 in the native state.

Alleles↗
PubMedDate not supplied

Precise definition of anonymization in genetic polymorphism studies.

Anonymization is an essential tool to protect privacy of participants in epidemiological studies. This paper classifies types of anonymization in genetic polymorphism studies, providing precise definitions. They are: 1) unlinkable anonymization at enrollment without a participant list; 2) unlinkable anonymization before genotyping with a participant list; 3) linkable anonymization; 4) unlinkable anonymization for outsiders; and 5) linkable anonymization for outsiders. The classification in view of accessibility to a table including genotype data with directly identifiable data such as names is important; if such tables exist, staff may obtain genotype information about participants. The first three modes are defined here as anonymization unaccessible to genotype data with directly identifiable information for research staff. Anonymization with a key code held by participants is possible with any of the above anonymization modes, by which participants can access to their own genotypes through telephone or internet. A guideline issued on March 29, 2001 with collaboration of three Ministries in Japan defines "anonymization in a linkable fashion" and "anonymization in an unlinkable fashion", "for the purpose of preventing the personal information from being divulged externally in violation of law, the present guidelines or a research protocol", but the contents are not clear in practice. The proposed definitions will be useful when we describe and discuss the preferable mode of anonymization for a given polymorphism study.

Anonymous Testing↗
PubMed2001

Modulation of DNA and protein adducts in smokers by genetic polymorphisms in GSTM1,GSTT1, NAT1 and NAT2.

The formation of DNA and protein adducts by environmental pollutants is modulated by host polymorphisms in genes that encode metabolizing enzymes. In our study on 67 smokers, aromatic-DNA adduct levels were examined by nuclease P1 enriched 32P-postlabelling in mononuclear blood cells (MNC) and 4-aminobiphenyl-haemoglobin adducts (4-ABP-Hb) by gas chromatography-mass spectroscopy. Genetic polymorphisms in glutathione S-transferase M1 (GSTM1), T1 (GSTT1) and N-acetyl-transferase 1 (NAT1) and 2 (NAT2) were assessed by polymerase chain reaction-based methods. DNA adduct levels, adjusted for the amount of cigarettes smoked per day, were higher in GSTM1(-/-) individuals (1.30 +/- 0.57 adducts per 108 nucleotides) than in GSTM1(+) subjects (1.03 +/- 0.56, P = 0.05), higher in NAT1 slow acetylators (1.58 +/- 0.54) than in NAT1 fast acetylators (1.11 +/- 0.58, P = 0.05) and were also found to be associated with the NAT2 acetylator status (1.29 +/- 0.64 and 1.03 +/- 0.46, respectively, for slow and fast acetylators, P = 0.06). An effect of GSTT1 was only found in combination with the NAT2 genotype; individuals with the GSTT1(-/-) and NAT2-slow genotype contained higher adduct levels (1.80 +/- 0.68) compared to GSTT1(+)/NAT2 fast individuals (0.96 +/- 0.36). Highest DNA adduct levels were observed in slow acetylators for both NAT1 and NAT2 also lacking the GSTM1 gene (2.03 +/- 0.17), and lowest in GSTM1(+) subjects with the fast acetylator genotype for both NAT1 and NAT2 (0.91 +/- 0.45, P = 0.01). No overall effects of genotypes were observed on 4-ABP-Hb levels. However, in subjects smoking less than 25 cigarettes per day, 4-ABP-Hb levels were higher in NAT2 slow acetylators (0.23 +/- 0.10 ng/g Hb) compared to fast acetylators (0.15 +/- 0.07, P = 0.03). These results provide further evidence for the combined effects of genetic polymorphisms in GSTM1, GSTT1, NAT1 and NAT2 on DNA and protein adduct formation in smoking individuals and indicate that, due to the complex carcinogen exposure, simultaneous assessment of multiple genotypes may identify individuals at higher cancer risk.

Adult↗
PubMed1998

Genetic polymorphism of CYP2D6 and lung cancer risk.

Previous reports of the association of extensive debrisoquine metabolism, controlled by the cytochrome P450 CYP2D6, with increased lung cancer risk have been conflicting. We examined the hypothesis that genetic polymorphism at the CYP2D6 locus identifies individuals at increased risk for lung cancer in a case-control study of 98 incident Caucasian lung cancer patients and 110 age-, race-, and sex-matched controls conducted at the National Naval Medical Center, Bethesda, MD. Using germ line DNA, we identified inactivating mutations at the CYP2D6 locus (CYP2D6*3, CYP2D6*4, CYP2D6*5, and CYP2D6*6A), as well as those mutations that impair but do not abolish enzyme activity (CYP2D6*9 and CYP2D6*10A). Compared to subjects with homozygous inactivating mutations, no association with lung cancer was observed for those with homozygous or heterozygous functional alleles (odds ratios were 0.4 and 0.7, respectively). Furthermore, no excess risk was seen in any histological group or smoking category, and adjustment for smoking and sociodemographic characteristics did not alter the findings. Although the concept that genetic polymorphisms may contribute to differential lung cancer susceptibility is sound, these data do not support the role of CYP2D6 as a marker for elevated lung cancer risk.

Adenocarcinoma↗