Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Elements”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,243 records · Page 69Linked to original sources
PubMed2001

A multi-element profile of housedust in relation to exterior dust and soils in the city of Ottawa, Canada.

This paper presents multi-element profiles of indoor dust versus exterior soils and dusts from 50 residences located in 10 neighborhoods across Ottawa, the capital city of Canada. Mercury concentrations were determined using nitric-sulphuric acid digestion and cold vapor AAS. Concentrations of 31 other elements were determined using nitric-hydrofluoric acid digestion and ICP-MS. Comparisons of household dust, garden soil and street dust at the individual residence scale and at the community scale were based on a consistent 100-250-microm particle size fraction. Results showed housedust samples to contain significantly higher concentrations of many key elements, including lead, cadmium, antimony and mercury, than either street dust or garden soil samples. Also, housedust profiles revealed a distinct multi-element signature in relation to exterior dust and soil samples. Interestingly, garden soil contained higher concentrations of aluminum, barium and thallium than either house or street dust. Geometric mean concentrations (mg/kg) of these elements in household dust/garden soil were: lead 233/42; cadmium 4.42/0.27; antimony 5.54/0.25; mercury 1.728/0.055; aluminum 24281/55677; barium 454/763; and thallium 0.14/0.29. Street dust contained lower geometric mean concentrations than garden soil for 23 out of a total of 32 elements. In general, indoor/outdoor concentration ratios varied widely from one element to another, and from one residence to another within the community. In the case of Ottawa, which is a city with a low concentration of heavy industries, it would be difficult-to-impossible to accurately predict indoor dust concentrations based on exterior soil data. It is concluded that dust generated from sources within the house itself can contribute significantly to exposures to certain elements, such as lead, cadmium, antimony and mercury.

Canada↗
PubMed2002

Biogeochemical dynamics following land use change from forest to pasture in a humid tropical area (Rondĵnia, Brazil): a multi-element approach by means of XRF-spectroscopy.

Forest burning for pastures in tropical areas represents an important component of biogeochemical cycles. In order to provide information concerning chemical modifications after forest burning, in this local study the total contents of 29 elements in topsoils were analyzed when forest is changed to pasture land. The work was carried out in 1999 in Rondĵnia state (Brazilian Amazon Basin) focussing on a native forest site and four neighboring pastures established in 1987, 1983, 1972 and 1911 after forest conversion. Chemical fingerprint graphs of the pasture soils related to the forest soil illustrated mainly higher contents for the vast majority of macro- and micro nutrients, but for other elements as well (e.g. Ba, Sr, Cr, Ni, V or Pb). Also increases of pH levels were measured in all pastures, which remained higher than the forest values for decades. After initial increases of most of the elements in pasture of 1987 the decreases of some macro elements (e.g. C, N, K, Mg, S) in pasture 1983 as well as again the enhanced levels in pasture 1972 and 1911 suggest both a persistent leaching of these elements and a function of pasture age where external element inputs exceed outputs. Ash deposition, accumulation of organic matter, animal excreta as well as natural soil conditions are discussed as influencing factors on the element contents of the original forest and the pasture soils. Nevertheless, in this particular area continuous pasturing after forest clearing primarily enriched the soils in elements.

Agriculture↗
PubMed1983

The role of soil and plant metabolic processes in controlling trace element behavior and bioavailability to animals.

Metabolic and physiological processes play important roles in regulating the transfer and behavior of trace elements in the soil/plant/animal system. The behaviors of Ni, Cd, Cr, T1, Np, Pu and Tc are used to illustrate important aspects of these processes. Microbial metabolism has both indirect and direct effects on trace element solubility in soils. Once non-nutrient trace elements are solubilized, the ability of plant roots to actively accumulate them is dependent on chemical activity of the element in soil solution, the presence of competing ions and the redox potential and absorption capacity of the root. After absorption in the plant, trace elements are translocated, metabolized and stored; fate and behavior varies with the properties of the element, but is generally analogous to nutrient elements. These processes can dramatically affect the availability of individual elements to animals consuming plants.

Animals↗
PubMed2001

Maque, a family of extremely short interspersed repetitive elements: characterization, possible mechanism of transposition, and evolutionary implications.

Database analysis revealed a novel family of very short interspersed repetitive elements named Maque in the African malaria mosquito, Anopheles gambiae. Past mobility of Maque was demonstrated by evidence of its insertion that resulted in a target duplication. Approximately 220 copies of Maque were present in the A. gambiae genome. Although only approximately 60 bp long, Maque has the appearance of a distinct transposition unit. Eleven of the 12 Maque elements found in the database were flanked by 9-14 bp direct repeats, indicating that their transposition was relatively recent. Sequence comparison and phylogenetic analyses suggest that there are at least two subgroups within the Maque family, suggesting that they may have been originated from more than one source. Five of the 12 Maque elements had at least one other repetitive element nearby. Three of the Maque elements were found near genes. However, Maque was not found in the coding regions of genes or in any of the expressed sequence tags (ESTs), which is consistent with its significantly biased distribution toward A + T rich regions. Several characteristics of Maque indicate that it is likely a non-autonomous retro-element. The evolutionary origin of Maque and the differences between Maque and other known retro-elements including short interspersed repetitive elements (SINEs) are discussed. A hypothesis is proposed in which short sequences containing just the reverse transcriptase recognition signal (RTRS) could potentially contribute to exon shuffling and the genesis of some primordial SINEs.

Animals↗
PubMed1997

Trace elements in pleural effusions.

When the secretion of pleural fluids exceeds their resorption, liquid (pleural effusion ) will accumulate between the visceral and parietal pleura. Pleural effusions derived from the liquid components of blood are expected to contain trace elements and may, as a sink for trace elements, deprive the body of needed essential elements upon their removal by medical intervention. Consequently, patients may be at risk of drifting into trace-element deficiencies. Because the literature is almost devoid of data about trace elements in effusions, the concentrations of 14 trace elements (Ba, Ca, Cd, Co, Cs, Cu, Mg, Mn, Mo, Pb, Rb, Sn, Sr, Zn) were determined simultaneously by inductively-coupled argon-plasma mass spectrometry (ICP-MS) in effusions from 17 patients. The median values for the concentrations of Rb (209 microgram/kg, range 104-334 microgram/kg) and Cs (1.5 micrograms/kg, range 0.8-2.4 microgram/kg) in the effusions were almost the same as in the sera. The concentrations of Mg (range 15-22 mg/kg), Ca range 52-91 mg/kg), Sr (range 12-37 micrograms/kg), and Ba (range 1.4-18.2 micrograms/kg) were consistently lower in the effusions than in the sera by 18% for Mg, 26% Ca 14% for Sr, and 88% for Ba (percentages based on median in serum as 100%). The concentrations of the essential trace elements Co (range 0.16-0.5 microgram/kg), Cu (130-902 micrograms/kg), Mn (0.2-2.2 micrograms/kg), Mo (0.4-1.5 micrograms/kg), Sn (0.4-1.2 micrograms/kg), and Zn (27-1931 micrograms/kg) in the effusions are generally lower (25-55% based on median) than in the corresponding sera, although a few effusions have higher concentrations of Co, Mn Mo, or Zn than in the sera. The concentrations of Cd (range 0.2-0.5 microgram/kg) in the effusions were approximately the same as in the sera for three patients, considerably lower than in the sera for four patients, and considerably higher for three patients. The concentrations for lead (range 0.6-45 micrograms/kg) in the effusions were generally much higher than in the sera. The effusions were not significantly contaminated with lead-rich erythrocytes. The concentrations of Ca, Cu, and Zn in the effusions correlated positively with the protein concentrations in the effusions. One kilogram of the effusions contain from 10-30% of the trace elements present in the entire volume of serum in circulation.

Adult↗
PubMed2000

The piggyBac element is capable of precise excision and transposition in cells and embryos of the mosquito, Anopheles gambiae.

The piggyBac transposable element was tested for transposition activity in plasmid-based excision and inter-plasmid transposition assays to determine if this element would function in Anopheles gambiae cells and embryos. In the Mos55 cell line, precise excision of the piggyBac element was observed only in the presence of a helper plasmid. Excision occurred at a rate of 1 event per 1000 donor plasmids screened. Precise excision of the piggyBac element was also observed in injected An. gambiae embryos, but at a lower rate of 1 excision per 5000 donor plasmids. Transposition of the marked piggyBac element into a target plasmid occurred in An. gambiae cells at a rate of 1 transposition event per 24,000 donor plasmids. The piggyBac element transposed in a precise manner, with the TTAA target site being duplicated upon insertion, in 56% of transpositions observed, and only in the presence of the piggyBac helper. The remaining transpositions resulted in a deletion of target sequence, a novel observation for the phenomenon of piggyBac element insertion. 'Hot spots' for insertion into the target plasmid were observed, with 25 of 34 events involving one particular site. These results are the first demonstration of the precise mobility of piggyBac in this malaria vector and suggest that the lepidopteran piggyBac transposon is a candidate element for germline transformation of anopheline mosquitoes.

Animals↗
PubMed1999

Determination of low-Z elements in individual environmental particles using windowless EPMA.

The determination of low-Z elements such as carbon, nitrogen, and oxygen in atmospheric aerosol particles is of interest in studying environmental pollution. Conventional electron probe microanalysis technique has a limitation for the determination of the low-Z elements, mainly because the Be window in an energy-dispersive X-ray (EDX) detector hinders the detection of characteristic X-rays from light elements. The feasibility of low-Z element determination in individual particles using a windowless EDX detector is investigated. To develop a method capable of identifying chemical species of individual particles, both the matrix and the geometric effects of particles have to be evaluated. X-rays of low-Z elements generated by an electron beam are so soft that important matrix effects, mostly due to X-ray absorption, exist even within particles in the micrometer size range. Also, the observed radiation, especially that of light elements, experiences different extents of absorption, depending on the shape and size of the particles. Monte Carlo calculation is applied to explain the variation of observed X-ray intensities according to the geometric and chemical compositional variation of individual particles, at different primary electron beam energies. A comparison is carried out between simulated and experimental data, collected for standard individual particles with chemical compositions as generally observed in marine and continental aerosols. Despite the many fundamental problematic analytical factors involved in the observation of X-rays from low-Z elements, the Monte Carlo calculation proves to be quite reliable to evaluate those matrix and geometric effects. Practical aspects of the Monte Carlo calculation for the determination of light elements in individual particles are also considered.

Electron Probe Microanalysis↗
PubMed1999

How valuable are model organisms for transposable element studies?

Model organisms have proved to be highly informative for many types of genetic studies involving 'conventional' genes. The results have often been successfully generalized to other closely related organisms and also, perhaps surprisingly frequently, to more distantly related organisms. Because of the wealth of previous knowledge and their availability and convenience, model organisms were often the species of choice for many of the earlier studies of transposable elements. The question arises whether the results of genetic studies of transposable elements in model organisms can be extrapolated in the same ways as those of conventional genes? A number of observations suggest that special care needs to be taken in generalizing the results from model organisms to other species. A hallmark of many transposable elements is their ability to amplify rapidly in species genomes. Rapid spread of a newly invaded element throughout a species range has also been demonstrated. The types and genomic copy numbers of transposable elements have been shown to differ greatly between some closely related species. Horizontal transfer of transposable elements appears to be more frequent than for nonmobile genes. Furthermore, the population structure of some model organisms has been subject to drastic recent changes that may have some bearing on their transposable element genomic complements. In order to initiate discussion of this question, several case studies of transposable elements in well-studied Drosophila species are presented.

Biological Evolution↗
PubMed2003

The cryptic enhancer elements of the tCUP promoter.

Examination of the tCUP cryptic promoter from tobacco demonstrates that cryptic gene regulatory elements in the plant genome are functionally equivalent to elements responsible for the expression of plant genes. They are also organized in a similar fashion. Analysis of the expression pattern of the GUS reporter gene in transgenic Arabidopsis plants revealed that all of the information needed for strong constitutive expression was located in the truncated, -394tCUP promoter fragment. A series of 5' deletion and linker-scan mutagenesis constructs identified two separate enhancer elements. A long AT-rich region was identified between positions -350 and -161 bp relative to the transcription start site. 5' deletions that removed this A/T-rich fragment resulted in a significant decrease in promoter activity; whereas, oligomerization enhanced activity. A 21 bp sequence (TAGCCCCAATTTCAAATTCAA) spanning nucleotides -150 to -130 relative to transcription start site was also identified in a similar fashion and defined a novel cryptic constitutive enhancer element (Cce). Electrophoretic mobility-shift assays showed that tobacco nuclear proteins that interacted strongly with the tCUP promoter bound specifically to the 21-bp Cce element, suggesting that this sequence is probably a binding site(s) for transcription factors. The Cce element was dependent on the AT-rich element for activity indicating combinatorial control. The combined effects of the A/T rich and Cce elements appear to be responsible for the constitutive transcriptional activity of the tCUP promoter.

AT Rich Sequence↗
PubMed2003

The genetic relatedness of Porphyromonas gingivalis clinical and laboratory strains assessed by analysis of insertion sequence (IS) element distribution.

OBJECTIVES: Porphyromonas gingivalis is frequently found in periodontitis lesions. This organism contains a large number of insertion sequence (IS) elements. We sought to determine the distribution of seven IS elements from strain W83 among nine P. gingivalis laboratory strains and nine clinical isolates and to use these findings to determine strain relationships. METHODS: Southern blots of BamHI digested genomic DNA digests were probed with insertion sequence elements ISPg1-7. RESULTS: The restriction fragment length polymorphism (RFLP) patterns revealed that five of the nine laboratory strains, including strain W83, were nearly identical for all seven IS elements. Two of nine clinical isolates were similar to the five laboratory strains. Two of the four remaining laboratory strains had similar or identical RFLP patterns. The remaining two laboratory strains had limited similarity to clinical strains. Four of the clinical isolates had identical RFLP patterns for all seven IS elements. The three remaining clinical isolates were unique in their RFLP patterns. Several strains lacked from one to four of the IS elements. Similar strain relationships were suggested regardless of the IS element examined. CONCLUSIONS: Transposition and recombination between IS elements are not sufficiently pervasive to obscure strain relationships, though this does not preclude the possibility that such events play an important role in allowing P. gingivalis to adapt to new environments. Given the level of genetic diversity observed, it may be especially important to examine genetically diverse strains when drawing conclusions based on the W83 P. gingivalis genomic database.

Adaptation, Physiological↗
PubMed2003

Genomic scale profiling of nutrient and trace elements in Arabidopsis thaliana.

Understanding the functional connections between genes, proteins, metabolites and mineral ions is one of biology's greatest challenges in the postgenomic era. We describe here the use of mineral nutrient and trace element profiling as a tool to determine the biological significance of connections between a plant's genome and its elemental profile. Using inductively coupled plasma spectroscopy, we quantified 18 elements, including essential macro- and micronutrients and various nonessential elements, in shoots of 6,000 mutagenized M2 Arabidopsis thaliana plants. We isolated 51 mutants with altered elemental profiles. One mutant contains a deletion in FRD3, a gene known to control iron-deficiency responses in A. thaliana. Based on the frequency of elemental profile mutations, we estimate 2-4% of the A. thaliana genome is involved in regulating the plant's nutrient and trace element content. These results demonstrate the utility of elemental profiling as a useful functional genomics tool.

Algorithms↗
PubMed1996

Trace elements in a commercial freeze-dried human urine reference material.

A large batch of freeze-dried human urine reference material, Seronorm Trace Elements Urine, Lot 101021, was prepared commercially (Nycomed Pharma AS, Oslo, Norway) for quality control purposes in trace element analysis. Analytes are being determined by a voluntary, international co-operative effort so that the material will be available to the scientific community at modest cost. The material is in stoppered glass vials and is to be reconstituted with 5.00 ml of water prior to use. We have evaluated the trace element content for several elements, including chromium and zinc, elements for which we have two independent methods available for the determinations, namely isotope dilution mass spectrometry (IDMS) and atomic absorption spectrometry (AAS). We also report on other trace elements measured by IDMS alone, such as Se, for which we have enriched stable isotopes available. Results for chromium indicate a mean +/- standard deviation (n = 10) of 1.2 +/- 0.3 (by IDMS) and 1.4 +/- 0.3 (by AAS) ng Cr per ml of reconstituted urine, indicating possible inhomogeneity and/or contamination (21-25% relative standard deviation, RSD). Approximately half of the observed chromium originates from the sample container. The values observed for zinc were 590 +/- 90 ng ml-1 (15% RSD) for freshly reconstituted material, 760 +/- 60 ng ml-1 (8% RSD) for material reconstituted 4 d earlier, and 940 +/- 60 ng ml-1 (6% RSD) 2 months after reconstitution. Selenium values by IDMS were very reproducible, with a mean concentration of 16 +/- 0.15 ng g-1 (0.9% RSD), suggesting little or no contamination and a high degree of sample homogeneity for this element. The source of potential contaminants has been evaluated by multielement determinations of leachates of the vials and stoppers. Elements noted in significant amounts include B, Ba, Sr, Mo, Cu and Zn, with most of the zinc coming from the rubber stopper.

Freeze Drying↗
PubMed1996

The proximal element of the human apolipoprotein A-II promoter increases the enhancer activity of the distal region.

We have previously shown that human apolipoprotein A-II (apoA-II) transcription is controlled by a complex set of regulatory elements. In this study, we demonstrate that the distal region of the apoA-II promoter (-911/-614) acts as an enhancer and results in a 6-fold increase in activity when the proximal AB element is inserted between this enhancer and a TATA box. The AB element alone does not display any transcriptional activity. The combination of the proximal AB element and the enhancer is sufficient to activate transcription to the same level as that achieved with the full-length promoter. DNA binding and competition assays, and binding interference experiments allowed us to identify two adjacent binding sites within the AB element. These bind activities designated CIIIB1 and AIIAB3/4, respectively. Mutation on each of these sites showed that the binding site of CIIIB1 within the AB element played a major role in the interaction with the enhancer. Whereas transcriptional activation of other apolipoprotein genes involves the binding of the liver-enriched hepatocyte nuclear factor 4 (HNF4) on their proximal promoter, the present study demonstrates that neither HNF4 nor ApoA-I regulatory protein 1, its antagonistic orphan receptor, was able to bind the AB element. Instead, apoA-II transcription was driven by the interaction of apoA-II enhancer with proximal AB element, which involves an unidentified activity, CIIIB1.

Animals↗
PubMed1999

The Queensland fruit fly, Bactrocera tryoni, contains multiple members of the hAT family of transposable elements.

Members of the hAT transposable element family are mobile in non-host insect species and have been used as transformation vectors in some of these species. We report that the Queensland fruit fly, Bactrocera tryoni, contains at least two types of insect hAT elements called Homer and a Homer-like element (HLE). The Homer element is 3789 bp in size and contains 12-bp imperfect inverted terminal repeats. The Homer element contains a long open reading frame (ORF) that encodes a putative transposase. Three different copies of this long ORF were recovered from the B. tryoni genome and, upon transcription and translation in an in vitro system, all produced transposase. The HLE is an incomplete element since no 3' inverted terminal repeat (ITR) was found. Homer and the HLE are as related to one another as either is to the other insect hAT elements such as Hermes, hobo, hermit and hopper. The structure and distribution of these two Homer elements is described.

Amino Acid Sequence↗
PubMed1999

The effectiveness of a new algorithm on a three-dimensional finite element model construction of bone trabeculae in implant biomechanics.

More validity of finite element analysis (FEA) in implant biomechanics requires element downsizing. However, excess downsizing needs computer memory and calculation time. To evaluate the effectiveness of a new algorithm established for more valid FEA model construction without downsizing, three-dimensional FEA bone trabeculae models with different element sizes (300, 150 and 75 micron) were constructed. Four algorithms of stepwise (1 to 4 ranks) assignment of Young's modulus accorded with bone volume in the individual cubic element was used and then stress distribution against vertical loading was analysed. The model with 300 micron element size, with 4 ranks of Young's moduli accorded with bone volume in each element presented similar stress distribution to the model with the 75 micron element size. These results show that the new algorithm was effective, and the use of the 300 micron element for bone trabeculae representation was proposed, without critical changes in stress values and for possible savings on computer memory and calculation time in the laboratory.

Algorithms↗
PubMed2002

The vitamin D response element of the involucrin gene mediates its regulation by 1,25-dihydroxyvitamin D3.

Involucrin is a major protein of the cornified envelope of keratinocytes that provides much of the structural integrity of skin. Its expression is stimulated by a number of agents including calcium and 1,25-dihydroxy-vitamin D3 that promote the differentiation process in keratinocytes. Within the distal regulatory region of the involucrin promoter lies an AP-1 site and an element homologous to other vitamin D response elements. In previous studies mutation of the AP-1 site was found to reduce basal activity and block calcium stimulation of the involucrin promoter, whereas the vitamin D response element was not critical for calcium regulation. In this study both elements proved to be important for 1,25-dihydroxyvitamin D3 stimulation of the involucrin promoter. Mutation of the AP-1 site reduced basal activity and blocked 1,25-dihydroxyvitamin D3 stimulation of the involucrin promoter. In contrast, mutation of the vitamin D response element did not reduce basal expression of the involucrin promoter or prevent calcium stimulation of involucrin gene expression, but blocked 1,25-dihydroxyvitamin D3 stimulation. The vitamin D response element from the involucrin gene bound the vitamin D receptor and the retinoid X receptor, but not the retinoic acid receptor, in a specific manner. We conclude that the AP-1 site and the vitamin D response element in the involucrin promoter play important roles in mediating the action of 1,25-dihydroxyvitamin D3 on involucrin expression, but the vitamin D response element provides specificity for the 1,25-dihydroxyvitamin D3 response lacking at the AP-1 site.

Calcitriol↗
PubMed2006

Ribosomal shunting mediated by a translational enhancer element that base pairs to 18S rRNA.

In eukaryotes, 40S ribosomal subunits move from their recruitment site on the mRNA to the initiation codon by an as yet poorly understood process. One postulated mechanism involves ribosomal shunting, in which ribosomal subunits completely bypass regions of the 5' leader. For some mRNAs, shunting has been shown to require various mRNA elements, some of which are thought to base pair to 18S rRNA; however, the role of base pairing has not yet been tested directly. In earlier studies, we demonstrated that a short mRNA element in the 5' leader of the Gtx homeodomain mRNA functioned as a ribosomal recruitment site by base pairing to the 18S rRNA. Using a model system to assess translation in transfected cells, we now show that this intermolecular interaction also facilitates ribosomal shunting across two types of obstacles: an upstream AUG codon in excellent context or a stable hairpin structure. Highly efficient shunting occurred when multiple Gtx elements were present upstream of the obstacles, and a single Gtx element was present downstream. Shunting was less efficient, however, when the multiple Gtx elements were present only upstream of the obstacles. In addition, control experiments with mRNAs lacking the upstream elements showed that these results could not be attributed to recruitment by the single downstream element. Experiments in yeast in which the mRNA elements and 18S rRNA sequences were both mutated indicated that shunting required an intact complementary match. The data obtained by this model system provide direct evidence that ribosomal shunting can be mediated by mRNA-rRNA base pairing, a finding that may have general implications for mechanisms of ribosome movement.

Animals↗
PubMed2003

piggyBac-based insertional mutagenesis in the presence of stably integrated P elements in Drosophila.

P element-mediated mutagenesis has been used to disrupt an estimated 25% of genes essential for Drosophila adult viability. Mutation of all genes in the fly genome, however, poses a problem, because P elements show significant hotspots of integration. In addition, advanced screening scenarios often require the use of P element-based tools like the generation of germ-line mosaics using FLP recombinase-mediated recombination or gene misexpression using the UAS/Gal4 system. These techniques are P element-based and can therefore not be combined with the use of P elements as mutagenic agents. To circumvent these limitations, we have developed an insertional mutagenesis system using non-P element transposons. An enhanced yellow fluorescent protein-marked piggyBac-based mutator element was mobilized by a piggyBac specific transposase source expressed from a Hermes-based jump-starter transposon marked with enhanced cyan fluorescent protein. In a pilot screen, we have generated 798 piggyBac insertions on FRT bearing third chromosomes of which 9% have sustained a putatively piggyBac-related lethal hit. The FRTs present on the target chromosome remained stably integrated during the screen and could subsequently be used to generate germ-line clones associated with maternal and zygotic phenotypes. PCR-based analysis of insertion loci shows that 57% of the insertions are in genes for which no P element insertions have been reported. Our data demonstrate the potential of this technique to facilitate the quest for saturation mutagenesis of the Drosophila genome. The system is Drosophila nonspecific and potentially applicable in a broad spectrum of nonmodel organisms.

Animals↗