Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Chromosome Structures”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,243 records · Page 69Linked to original sources
PubMed1996

Structure and chromosomal localization of the human homeobox gene Prox 1.

The genomic organization and nucleotide sequence of the human homeobox gene Prox 1 as well as its chromosomal localization have been determined. This gene spans more than 40 kb, consists of at least 5 exons, and encodes an 83-kDa protein. It shows 89% identity with the chicken sequence at the nucleotide level in the coding region, while the human and chicken proteins are 94% identical. Among the embryonic tissues analyzed (lens, brain, lung, liver, and kidney), the human Prox 1 gene is most actively expressed in the developing lens, similar to the expression pattern of the chicken Prox 1 gene. The Prox 1 gene was mapped to human chromosome 1q32.2-q32.3.

Adult↗
PubMed1996

Structure and chromosomal localization of the genomic locus encoding the Kiz1 LIM-kinase gene.

We have cloned and characterized the mouse gene encoding Kiz1/Limk1, a new member of the zinc-finger LIM family that also has a kinase domain. The gene encompasses 25 kb of the mouse genome, and the organization of its 16 exons does not correlate with its functional domains. The promoter region of Kiz1/Limk1 was identified by cloning a 1.06-kb genomic fragment upstream from the first ATG in a promotorless CAT vector. This construct was demonstrated to drive CAT expression in Jurkat cells. The promoter sequence lacks conventional TATA and CAAT motifs but contains consensus binding sequences for several transcriptional regulators implicated in control of transcription in many different cell types, including Sp1, Ets, and E2A. Analysis of the chromosomal localization of KIZ1/LIMK1 indicates that it lies on human chromosome 17 in the region 17q25 and on mouse Chromosome 5, band G2.

Animals↗
PubMed1996

Mouse and human neuronal pentraxin 1 (NPTX1): conservation, genomic structure, and chromosomal localization.

We have previously identified novel members of the pentraxin family (neuronal pentraxin 1 and 2) that are expressed in the nervous system. Neuronal pentraxin 1 (NP1) was identified as a rat protein that may mediate the uptake of synaptic material and the presynaptic snake venom toxin, taipoxin. NP2 was identified as a separate gene discovered by screening for a human homolog for NP1. Here, we report human cDNA and mouse genomic DNA sequences for NP1 (gene symbol NPTX1). Human NP1 and mouse NP1 show 95 and 99% amino acid identity, respectively, with rat NP1 and conserve all potential glycosylation sites. Like rat NP1, human NP1 message is large (6.5 kb) and is exclusively localized to the nervous system. The mouse NP1 gene is 13 kb in length and contains four introns that break the coding sequence of NP1 in the same positions as the introns of the human NP2 gene. The human and mouse NP1 genes are localized to chromosome 17q25.1-q25.2 and chromosome 11e2-e1.3, respectively. These data demonstrate the existence of a separate family of pentraxin proteins that are expressed in the human brain and other tissues and that may play important roles in the uptake of extracellular material.

Amino Acid Sequence↗
PubMed1996

Structure and chromosomal assignment of the human cyclin G gene.

Human cDNA and genomic DNA encoding cyclin G were cloned and analyzed. The amino acid sequence of cyclin G is well conserved among mammals. Human cyclin G (295 amino acids) has one extra Thr at residue 6 compared with rat and mouse cyclin G (294 amino acids). The genomic DNA for human cyclin G consists of six exons, and in the first intron, one distinct putative binding site for the p53 tumor suppressor gene product (GCACAAGCCCAGGCTAGTCC) was detected. We performed chromosome mapping utilizing the fluorescence in situ hybridization (FISH) technique using both cDNA and genomic DNA for cyclin G. FISH localizes human cyclin G to the 5q32-q34 region. In the vicinity of the chromosomal location of human cyclin G, four cases of chromosomal translocations in human hematopoietic tumors have been reported, such as a subgroup of chronic myelomonocytic leukemia, non-Hodgkin lymphoma, and acute lymphocytic leukemia. It is therefore important to examine whether chromosomal translocations around this region cause aberrant cyclin G expression in a manner that is causally related to leukemia.

Amino Acid Sequence↗
PubMed1997

Genomic structure and chromosomal localization of GML (GPI-anchored molecule-like protein), a gene induced by p53.

Among its known functions, tumor suppressor gene p53 serves as a transcriptional regulator and mediates various signals through activation of downstream genes. We recently identified a novel gene, GML (glycosylphosphatidylinositol (GPI)-anchored molecule-like protein), whose expression is specifically induced by wildtype p53. To characterize the GML gene further, we determined 35.8 kb of DNA sequence that included a consensus binding sequence for p53 and the entire GML gene. The GML gene consists of four exons; and the p53-binding sequence is present in the 5'-flanking region. In genomic organization this gene resembles genes encoding murine Ly-6 glycoproteins, a human homologue of the Ly-6 family called RIG-E, and CD59; products of these genes, known as GPI-anchored proteins, are variously involved in signal transduction, cell-cell adhesion, and cell-matrix attachment. FISH analysis revealed that the GML gene is located on human chromosome 8q24.3. Genes encoding at least two other GPI-anchored molecules, E48 and RIG-E, are also located in this region.

Animals↗
PubMed1997

Genomic structure and chromosomal localization of the novel ETS factor, PE-2 (ERF).

The members of the ETS family of transcription factors are grouped because they share a highly conserved DNA binding domain. These factors are involved in growth factor pathways and regulate both proliferation and differentiation. To identify ETS factors that may be involved in early hematopoietic progenitor regulation, we isolated a novel member of the ETS family by reverse transcriptase-PCR of the conserved DNA binding domain using degenerate oligonucleotides. This gene directs the synthesis of a 2704-nucleotide transcript whose largest open reading frame encodes a 548-amino-acid protein. Northern blot analysis reveals ubiquitous expression in all human tissues and cell lines tested, with highest levels in the testis, ovary, pancreas, and heart. Comparison of this gene with the available databases reveals very significant homology to the ETS factor PE-1 and probable near-identity with the recently cloned factor ERF. The PE-2 gene is composed of four exons spanning over 9 kb of genomic DNA. Sequence analysis of the promoter region reveals a GC-rich sequence without a TATA motif and with putative binding motifs for CREB, c-myb, and AP-1 factors. Using mouse-human somatic hybrids and FISH analysis, the PE-2 gene is localized to human chromosome 19q13.2, a region involved in translocations and deletions in leukemias and several solid tumors, suggesting that this novel ETS factor may play a role in carcinogenesis.

Amino Acid Sequence↗
PubMed1997

Structures and chromosomal localizations of the glycosylphosphatidylinositol synthesis gene PIGC and its pseudogene PIGCP1.

More than 10 genes are involved in the biosynthesis of glycosylphosphatidylinositol (GPI), which anchors many mammalian cell surface proteins to the membrane. Paroxysmal nocturnal hemoglobinuria (PNH) is caused by a somatic mutation in a GPI biosynthesis gene within the hematopoietic stem cell. The X-linked gene PIGA has been found to be mutated in all patients with PNH. This is probably because all other GPI synthesis genes are autosomal; hence two somatic mutations must occur to cause PNH, whereas one somatic mutation is sufficient to inactivate PIGA. Consistent with this notion, three other genes, PIGB, PIGF, and PIGH, are autosomal. Here we isolated a genomic clone of another GPI-synthesis gene, PIGC, and mapped it to chromosome 1q23-q25, further supporting this notion. PIGC is an intronless gene. We found an intronless pseudogene of PIGC, PIGCP1, and mapped it to chromosome 11p12-p13. The presence of a processed pseudogene is a common feature of PIGA, PIGF, and PIGC.

Amino Acid Sequence↗
PubMed1997

The structure and chromosome location of the human chondroadherin gene (CHAD).

The cDNA sequence of the human chondroadherin gene was cloned using PCR-based techniques. The gene encodes a protein of 359 amino acids, of which the first 21 amino acids represent a putative signal peptide sequence and which possesses 11 leucine-rich repeats flanked by cysteine-rich regions. The cDNA possesses a 5' untranslated region of 149 bp, a coding region of 1080 bp including the stop codon, and a 3' untranslated region of 561 bp terminating in a poly(A) tail. The cDNA hybridizes with a single messenger RNA of 1.9 kb, which is present in chondrocytes at all ages. Analysis of genomic DNA revealed that the chondroadherin gene possesses two introns, both of which reside within the coding region. The first intron has a length of about 2.3 kb and separates the codons for lysine(258) and phenylalanine(259). The second intron has a length of about 0.5 kb and splits the codon for tryptophan(314). This genomic organization results in exon 1 encoding the signal peptide, the amino-terminal cysteine-rich region, and the first 9 leucine-rich repeats; exon 2 encoding the last 2 leucine-rich repeats and part of the carboxy-terminal cysteine-rich region; and exon 3 encoding the remainder of the carboxy-terminal cysteine-rich region. The gene does not possess a TATA box prior to its transcription start site. Isolation of a cosmid clone spanning the chondroadherin gene enabled its chromosome location to be established. The gene was shown to reside at chromosome 17q21.33.

Amino Acid Sequence↗
PubMed1997

Genomic structure and chromosomal localization of mouse cyclin G1 gene.

Mouse genomic DNA harboring the full coding sequence of cyclin G1 was cloned and analyzed. The locations of five coding exons and the intron-exon boundary sequences were found to be conserved between the mouse and the human genes. Two putative binding sites for the p53 tumor suppressor gene product were found around the first exon: one was located in the 5' regulatory region, and the other was in the first intron. The mouse cyclin G1 gene was mapped to bands A5 to B1 of chromosomes 11 (11A5-B1) by FISH using genomic DNA clone as a biotinylated probe. The location of mouse cyclin G1 is syntenic to that of its human homologue, which we previously mapped to 5q32-q34 of chromosome 5. An additional faint signal was detected on chromosome 4 (4B1-C2), probably indicating the presence of a cyclin G1-related gene or pseudogene in the mouse genome.

Animals↗
PubMed1998

Genomic structure and chromosomal localization of the human cathepsin O gene (CTSO).

The human gene encoding cathepsin O, a cysteine proteinase from the papain superfamily, has been cloned and its overall organization established. The gene (HGMW-approved symbol CTSO) is composed of eight coding exons and seven introns and spans more than 30 kb. The number and distribution of exons and introns differ from those reported for other human cysteine proteinases, indicating that these genes are not closely related. Chromosomal localization of CTSO revealed that it maps to chromosome 4q31-q32, which is a unique location for all cysteine proteinases mapped to date.

Cathepsin K↗
PubMed1999

Genomic structure and chromosomal localization of TCEAL1, a human gene encoding the nuclear phosphoprotein p21/SIIR.

Human p21/SIIR is a novel Ser/Arg/Pro-rich nuclear phosphoprotein that is 48% similar to transcription factor SII and modulates transcription in a promoter context-dependent fashion. We have obtained the complete sequence of TCEAL1, the gene that codes for p21/SIIR. This gene consists of three exons and two introns with the entire coding sequence in exon III. Tissue-specific expression patterns of TCEAL1 by Northern blot analysis showed the presence of an approximately 1.2-kb transcript in all normal human tissues examined, and heart and skeletal muscle contained an additional transcript of approximately 7 kb. Expression was lowest in hematopoietic cells of both normal and tumor origin. TCEAL1 was mapped to human chromosome Xq22.1 by fluorescence in situ hybridization.

Animals↗
PubMed1999

Cloning of a novel member of the reticulon gene family (RTN3): gene structure and chromosomal localization to 11q13.

A novel member of the neuron-specific protein (NSP) or newly named reticulon (RTN) gene family was isolated during a subtraction cloning between macula and peripheral retina. The mRNA for this NSP/RTN-like gene is approximately threefold more abundant in macula than in peripheral retina. The cDNA is 2527 bp long and contains an open reading frame of 236 amino acids. The deduced peptide shows a strong similarity to the NSP/RTN and tropomyosin-like gene families but it is clearly a novel member. The gene contains seven exons and spans more than 15 kb. The gene was localized to chromosome 11q13 between markers D11S4535 and D11S4627 using somatic cell hybrid panels. Southern blot analysis identified the presence of a pseudogene(s) that was subsequently localized to chromosome 4. Multitissue Northern blot analysis found this gene to be widely expressed in human tissues with the highest expression in the brain. We are calling this gene RTN3 to reflect the newly proposed nomenclature.

Amino Acid Sequence↗
PubMed2000

cDNA cloning, genomic structure, and chromosomal localization of three members of the human fatty acid desaturase family.

The insertion of double bonds into specific positions of fatty acids is achieved by the action of distinct desaturase enzymes. Here we report the cloning and characterization of three members of the fatty acid desaturase (FADS) gene family in humans. Initially identified as cDNA fragments by direct cDNA selection within a defined 1.4-Mb region in 11q12-q13.1, full-length fatty acid desaturase-1 (FADS1) and fatty acid desaturase-2 (FADS2) transcripts were obtained by EST sequence assembly. A third member, fatty acid desaturase-3 (FADS3), was identified in silico revealing 62 and 70% nucleotide sequence identity with FADS1 and FADS2, respectively. The three genes are clustered within 92 kb of genomic DNA located 2 kb telomeric to FEN1 and 50 kb centromeric to VMD2 and are likely to have arisen evolutionarily from gene duplication as they share a remarkably similar exon/intron organization. Protein database searches identified FADS1, FADS2, and FADS3 as fusion products composed of an N-terminal cytochrome b5-like domain and a C-terminal multiple membrane-spanning desaturase portion.

Amino Acid Sequence↗
PubMed2002

Structure and chromosomal distribution of human mitochondrial pseudogenes.

Nuclear mitochondrial pseudogenes (Numts) have been found in the genome of many eukaryote species, including humans. Using a BLAST approach, we found 1105 DNA sequences homologous to mitochondrial DNA (mtDNA) in the August 2001 Goldenpath human genome database. We assembled these sequences manually into 286 pseudogenes on the basis of single insertion events and constructed a chromosomal map of these Numts. Some pseudogenes appeared highly modified, containing inversions, deletions, duplications, and displaced sequences. In the case of four randomly selected Numts, we used PCR tests on cells lacking mtDNA to ensure that our technique was free from genome-sequencing artifacts. Furthermore, phylogenetic investigation suggested that one Numt, apparently inserted into the nuclear genome 25-30 million years ago, had been duplicated at least 10 times in various chromosomes during the course of evolution. Thus, these pseudogenes should be very useful in the study of ancient mtDNA and nuclear genome evolution.

Chromosome Mapping↗
PubMed1991

Structure, expression, chromosomal location and product of the gene encoding ADH1 in Petunia.

A genomic clone for an alcohol dehydrogenase (Adh) gene has been isolated from Petunia hybrida cv. V30 by screening a Petunia genomic library with a maize Adh1 probe. A combination of RFLP and allozyme segregation data failed to demonstrate which of two Adh loci, both of which map to chromosome 4, was the source of the cloned gene. The product of the cloned genes has been identified unequivocally by a transient expression assay in Petunia protoplasts. We have designated this gene Petunia Adh1. The expression of this gene is tightly regulated in the developing anther, where its gene product is the predominant ADH isozyme. It is anaerobically inducible in roots, stems and leaves of seedlings. The induction of enzyme activity is correlated with induction of Adh1 mRNA.

Alcohol Dehydrogenase↗
PubMed1991

Localization of the human Rh blood group gene structure to chromosome region 1p34.3-1p36.1 by in situ hybridization.

A cDNA clone, RhIXb (1384 bp), encoding the entire protein sequence of a human blood group Rh polypeptide has been used to map the Rh locus, by in situ hybridization, to the region p34.3-p36.1 of chromosome 1. Two other unrelated cDNA clones, pUCA2 (750 bp) and pUCIII (1600 bp), isolated during the cloning procedure of the Rh cDNA were investigated simultaneously, and assigned to chromosome 3p21.1-3p22 (clone pUCA2) and to chromosome 22q12.1-22q13.1 (clone pUCIII).

Chromosome Banding↗
PubMed1988

Cytogenetic analysis of sperm from a male heterozygous for a 13;14 Robertsonian translocation.

Cytogenetic analysis of 121 sperm from a man heterozygous for a t(13;14) Robertsonian translocation was performed using the technique of in vitro penetration of hamster eggs. The frequency of sperm that were chromosomally unbalanced with respect to the translocation was 27%. The frequency of chromosomally normal (36%) and balanced (38%) complements was approximately equal, as theoretically expected. There was no evidence for an interchromosomal effect since the frequency of numerical chromosomal abnormalities (2.5%) and structural chromosomal abnormalities (10.7%)--both unrelated to the translocation--were within the normal range of control donors. The ratio of X- and Y-chromosome bearing sperm was equal, and there was no evidence for preferential segregation of the X chromosome with the translocation.

Adult↗