Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “RNA virus evolution”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,225 records · Page 68Linked to original sources
PubMed2004

Selection of TAR RNA-binding chameleon peptides by using a retroviral replication system.

The interaction between the arginine-rich motif (ARM) of the human immunodeficiency virus (HIV) Tat protein and TAR RNA is essential for Tat activation and viral replication. Two related lentiviruses, bovine immunodeficiency virus (BIV) and Jembrana disease virus (JDV), also require Tat ARM-TAR interactions to mediate activation, but the viruses have evolved different RNA-binding strategies. Interestingly, the JDV ARM can act as a "chameleon," adopting both the HIV and BIV TAR binding modes. To examine how RNA-protein interactions may evolve in a viral context and possibly to identify peptides that recognize HIV TAR in novel ways, we devised a retroviral system based on HIV replication to amplify and select for RNA binders. We constructed a combinatorial peptide library based on the BIV Tat ARM and identified peptides that, like the JDV Tat ARM, also function through HIV TAR, revealing unexpected sequence characteristics of an RNA-binding chameleon. The results suggest that a retroviral screening approach may help identify high-affinity TAR binders and may provide new insights into the evolution of RNA-protein interactions.

Amino Acid Sequence↗
PubMed2003

Chronic hepatitis associated with GB virus B persistence in a tamarin after intrahepatic inoculation of synthetic viral RNA.

Progress in understanding the pathogenesis of hepatitis C virus (HCV) has been slowed by the absence of tractable small animal models. Whereas GB virus B (GBV-B, an unclassified flavivirus) shares a phylogenetic relationship and several biologic attributes with HCV, including hepatotropism, it is not known to cause persistent infection, a hallmark of HCV. Here, we document persistent GBV-B infection in one of two healthy tamarins (Saguinus oedipus) inoculated intrahepatically with infectious synthetic RNA. High-titer viremia (108 to 109 genome equivalents per ml) and transiently elevated serum alanine transaminase activities were present from weeks 4 to 12 postinoculation in both animals. However, whereas GBV-B was eliminated from one animal by 20 weeks, the second animal remained viremic (103 to 107 genome equivalents per ml) for >2 years, with alanine transaminase levels becoming elevated again before spontaneous resolution of the infection. A liver biopsy taken late in the course of infection demonstrated hepatitis with periportal mononuclear infiltrates, hepatocellular microvesicular changes, cytoplasmic lipid droplets, and disordered mitochondrial ultrastructure, findings remarkably similar to chronic hepatitis C. GBV-B-infected hepatocytes contained numerous small vesicular membranous structures resembling those associated with expression of HCV nonstructural proteins, and sequencing of GBV-B RNA demonstrated a rate of molecular evolution comparable to that of HCV. We conclude that GBV-B is capable of establishing persistent infections in healthy tamarins, a feature that substantially enhances its value as a model for HCV. Mitochondrial structural changes and altered lipid metabolism leading to steatosis are conserved features of the pathogenesis of chronic hepatitis caused by these genetically distinct flaviviruses.

Animals↗
PubMed1997

Sequence analysis of gene 3, gene 4 and gene 5 of avian infectious bronchitis virus strain CU-T2.

We have previously reported the nucleotide sequences of gene 2 (spike (S) protein gene), gene 6 (nucleocapsid (N) protein gene), and the 3' end untranslated region of a novel avian infectious bronchitis virus (IBV) strain, CU-T2 [Jia et al. (1995) Arch. Virol. 140, 259 271]. In the present report we describe the sequences of the remaining genes of this strain (gene 3, 4 and 5) with the exception of gene 1 (RNA polymerase gene). Gene 3 contained three open reading frames (ORFs), 3a, 3b and 3c of 174, 195 and 282 nucleotides (nt), respectively. Gene 4 (membrane (M) protein gene) consisted of 749 nt with a single ORF of 687 nt. Gene 5 contained two ORFs, 5a and 5b, with 198 and 249 nt, respectively. Thus, in total, there were 7349 nt from the 5' end of S protein gene to the 3' end of the CU-T2 genome. The overall nt sequence homologies between gene 3, 4, and 5 of CU-T2 and those of other strains were between 84.1-90.8%, 85.8-88.8% and 90.4 96.4%, respectively. The predicted amino acid (aa) sequence homologies revealed that gene 3b and 5b were more conserved than 3a, 3c and 5a. Each individual gene of CU-T2 strain (with the exception of the RNA polymerase gene) had a different level of homology with the homologous gene of other strains, suggesting that the evolution of IBV strains in general has been a complex, and as yet, poorly understood process.

Amino Acid Sequence↗
PubMed1975

Nucleotide sequence determination of bacteriophage T4 species I ribonucleic acid.

The nucleotide sequence of T4 species I RNA, one of several stable RNA's specifically coded for by bacteriophage T4, has been determined using 32-P-labeled material from T4-infected cultures of Escherichia coli. The purified RNA species which has been sequenced has been shown to hybridize well to T4 DNA (Wilson J.H., Kim, J.S., and Abelson, J.N. (1972) J. Mol. Biol. 71, 547-556). The sequence is: pCGAUUCGAGGAAAUAUCUUUGCCGUAAGCCGAGUAGCGUUUUUGACGGAACGUUCGGAUAUGGUUGAGAUAUGGCCUUUUAAAAUAUUGAGUAGCGUCAACUACUUAAUAACCGGGUUCGAAUCCCGGCGUUUCGU-CAA-OHACA-OH. Species I RNA which is 140 nucleotides long is also found to occur in shorter versions with 135 to 136 nucleotides which terminate with a 3'-phosphate. The molecule can be arranged in a secondary structure which shows some striking similarities to the classic cloverleaf pattern of a tRNA. The molecule is specifically cleaved by an E. coli nuclease into three segments by cleavage at a double-stranded region in the molecule. The function of species I RNA is unknown, but evidence presented elsewhere (Paddock, G.V., and Abelson, J. (1975) J. Biol. Chem. 250, 4207-4219) indicates that the gene for this RNA molecule has been preserved in evolution. The position of a mutation within species I RNA has been determined. This mutation results in incorrect processing of the RNA and lower relative yields of the RNA are present.

Alkaline Phosphatase↗
PubMed1985

Noncumulative sequence changes in the hemagglutinin genes of influenza C virus isolates.

Sequence analysis and comparison of hemagglutinin (HA) genes of different influenza C viruses isolated between 1947 and 1983 reveals that (1) the extent of difference among the HA genes is independent of the year in which these viruses were isolated and that (2) changes in the HA genes do not appear to accumulate with time. These results suggest that epidemiologically dominant variants of influenza C viruses do not emerge successively with time and that C virus variants derived from multiple evolutionary pathways cocirculate at any one time. Thus the epidemiology of influenza C viruses differs markedly from that of influenza A viruses, which is characterized by the emergence of successive variants. Based on the nucleotide sequence data, we propose different evolutionary models for influenza A and influenza C viruses.

Amino Acid Sequence↗
PubMed2000

Memory in viral quasispecies.

Biological adaptive systems share some common features: variation among their constituent elements and continuity of core information. Some of them, such as the immune system, are endowed with memory of past events. In this study we provide direct evidence that evolving viral quasispecies possess a molecular memory in the form of minority components that populate their mutant spectra. The experiments have involved foot-and-mouth disease virus populations with known evolutionary histories. The composition and behavior of the viral population in response to a selective constraint were influenced by past evolutionary history in a way that could not be predicted from examination of consensus nucleotide sequences of the viral populations. The molecular memory of the viral quasispecies influenced both the nature and the intensity of the response of the virus to a selective constraint.

Animals↗
PubMed2006

Structure, function and evolution of the hemagglutinin-esterase proteins of corona- and toroviruses.

Virus attachment to host cells is mediated by dedicated virion proteins, which specifically recognize one or, at most, a limited number of cell surface molecules. Receptor binding often involves protein-protein interactions, but carbohydrates may serve as receptor determinants as well. In fact, many different viruses use members of the sialic acid family either as their main receptor or as an initial attachment factor. Sialic acids (Sias) are 9-carbon negatively-charged monosaccharides commonly occurring as terminal residues of glycoconjugates. They come in a large variety and are differentially expressed in cells and tissues. By targeting specific Sia subtypes, viruses achieve host cell selectivity, but only to a certain extent. The Sia of choice might still be abundantly present on non-cell associated molecules, on non-target cells (including cells already infected) and even on virus particles themselves. This poses a hazard, as high-affinity virion binding to any of such "false'' receptors would result in loss of infectivity. Some enveloped RNA viruses deal with this problem by encoding virion-associated receptor-destroying enzymes (RDEs). These enzymes make the attachment to Sia reversible, thus providing the virus with an escape ticket. RDEs occur in two types: neuraminidases and sialate-O-acetylesterases. The latter, originally discovered in influenza C virus, are also found in certain nidoviruses, namely in group 2 coronaviruses and in toroviruses, as well as in infectious salmon anemia virus, an orthomyxovirus of teleosts. Here, the structure, function and evolution of viral sialate-O-acetylesterases is reviewed with main focus on the hemagglutinin-esterases of nidoviruses.

Amino Acid Sequence↗
PubMed1991

Reconstruction and analysis of human Alu genes.

The existing classification of human Alu sequences is revised and expanded using a novel methodology and a larger set of sequence data. Our study confirms that there are two major Alu subfamilies, Alu-J and Alu-S. The Alu-S subfamily consists of at least five distinct subfamilies referred to as Alu-Sx, Alu-Sq, Alu-Sp, Alu-Sc, and Alu-Sb. The Alu-Sp and Alu-Sq subfamilies have been revealed by this study. Alu subfamilies differ from one another in a number of positions called diagnostic. In this paper the diagnostic positions are defined in quantitative terms and are used to evaluate statistical significance of the observed subfamilies. Each Alu subfamily most likely represents pseudogenes retroposed from evolving functional source Alu genes. Evidence presented in this paper indicates that Alu-Sp and Alu-Sc pseudogenes were retroposed from different source genes, during overlapping periods of time, and at different rates. Our analysis also indicates that the previously identified Alu-type transcript BC200 comes from an active Alu gene that might have existed even before the origin of dimeric Alu sequences. The source genes for Alu pseudogene families are reconstructed. It is assumed that diagnostic differences between reconstructed source genes reflect mutations that have occurred in true source Alu genes under natural selection. Some of these mutations are compensatory and are used to reconstruct a common secondary structure of Alu RNAs transcribed from the source genes. The biological function of Alu RNA is discussed in the context of its homology to the elongation-arresting domain of 7SL RNA.(ABSTRACT TRUNCATED AT 250 WORDS)

Animals↗
PubMed2001

Reduction of functional N-methyl-D-aspartate receptors in neurons by RNase P-mediated cleavage of the NR1 mRNA.

One approach to studying the functional role of individual NMDA receptor subunits involves the reduction in the abundance of the protein subunit in neurons. We have pursued a strategy to achieve this goal that involves the use of a small guide RNA which can lead to the destruction of the mRNA for a specific receptor subunit. We designed a small RNA molecule, termed 'external guide sequence' (EGS), which binds to the NR1 mRNA and directs the endonuclease RNase P to cleave the target message. This EGS has exquisite specificity and directed the RNase P-dependent cleavage at the targeted location within the NR1 mRNA. To improve the efficiency of this EGS, an in vitro evolution strategy was employed which led to a second generation EGS that was 10 times more potent than the parent molecule. We constructed an expression cassette by flanking the EGS with self-cleaving ribozymes and this permitted generation of the specified EGS RNA sequence from any promoter. Using a recombinant Herpes simplex virus (HSV), we expressed the EGS in neurons and showed the potency of the EGS to reduce NR1 protein within neurons. In an excitotoxicity assay, we showed that expression of the EGS in cortical neurons is neuroprotective. Our results demonstrate the utility of EGSs to reduce the expression of any gene (and potentially any splice variant) in neurons.

Animals↗
PubMed2000

Evolution of hepatitis B virus polymerase gene sequence during famciclovir therapy for chronic hepatitis B.

Prolonged administration of nucleoside analogues for chronic hepatitis B may result in the emergence of hepatitis B viral polymerase mutants. To gain insight into the mechanism involved in the virus's resistance to famciclovir, the amino acid sequences of the terminal protein and reverse-transcriptase (RT) domains of the viral polymerase were determined during therapy among 28 patients. The antiviral response was independent of viral genotypes, and nonresponse to famciclovir was associated with a complex variability of the RT domain. No mutation in the YMDD motif was observed, whereas an L528M mutation was clearly selected by famciclovir treatment in 2 patients, as well as 14 novel mutations in 7 patients. Clone sequence analysis of the RT domains of patients undergoing retreatment with famciclovir and/or lamivudine showed the selection of a preexisting drug-resistant mutant in one case and indicated that sequential antiviral therapy may allow the rapid selection of resistant strains.

2-Aminopurine↗
PubMed1995

Phylogenetic analyses of 55 retroelements on the basis of the nucleotide and product amino acid sequences of the pol gene.

Comparisons of pol gene nucleotide and reverse transcriptase (RT) amino acid sequences of 47 retroviruses, 3 caulimoviruses, and 5 hepadnaviruses showed that approximately one-third of the gene at the 5' end is much more conserved than other pol regions. The most conserved regions on both the nucleotide and amino acid sequences were chosen for construction of phylogenetic trees. The maximum-parsimony and distance-matrix methods were used for analyses of aligned amino acid sequences; these two methods, and the compatibility method, were used to analyze the aligned nucleotide sequences. Essentially identical majority-rule consensus trees were produced by these different methods from both the pol gene nucleotide and RT amino acid sequences, which divided the 55 retroelements into six major groups. The reliability of the phylogenetic trees was probed with the bootstrapping of 100 replicates of the original sequence alignments. The grouping results were shown to be statistically significant by multiple comparisons with the least-significant-difference procedure.

Amino Acid Sequence↗
PubMed2000

Selection of optimal polypurine tract region sequences during Moloney murine leukemia virus replication.

Retrovirus plus-strand synthesis is primed by a cleavage remnant of the polypurine tract (PPT) region of viral RNA. In this study, we tested replication properties for Moloney murine leukemia viruses with targeted mutations in the PPT and in conserved sequences upstream, as well as for pools of mutants with randomized sequences in these regions. The importance of maintaining some purine residues within the PPT was indicated both by examining the evolution of random PPT pools and from the replication properties of targeted mutants. Although many different PPT sequences could support efficient replication and one mutant that contained two differences in the core PPT was found to replicate as well as the wild type, some sequences in the core PPT clearly conferred advantages over others. Contributions of sequences upstream of the core PPT were examined with deletion mutants. A conserved T-stretch within the upstream sequence was examined in detail and found to be unimportant to helper functions. Evolution of virus pools containing randomized T-stretch sequences demonstrated marked preference for the wild-type sequence in six of its eight positions. These findings demonstrate that maintenance of the T-rich element is more important to viral replication than is maintenance of the core PPT.

Base Sequence↗
PubMed2006

Acute hepatitis C virus infection: Diagnosis, pathogenesis, treatment.

Diagnosing acute hepatitis C is still difficult. The disease is frequently asymptomatic and there are no specific diagnostic tests. Most frequently, diagnosis is based on anti HCV antibodies serum conversion and, more rarely, on a double serum conversion (initially HCV-RNA undetectable by RT-PCR, subsequently positive and serum conversion for HCV antibodies determined by EIA and RIBA techniques). Evolution of HCV infection is determined by the intensity of immune response, type of secreted cytokines and persistence of specific HCV T lymphocytes response. Patients achieving viral clearance present an early, strong and multi specific T lymphocyte response. Spontaneous viral clearance rates are highly variable between 10-60%. It is currently recommended to delay start of treatment for 2-4 months after onset and this delay does not compromise chances of achieving sustained virologic response. It is necessary to repeat viremia 6 months -1 year after spontaneous viral clearance due to the possibility of viral replication restart. There are currently no firm guidelines regarding treatment regimens, treatment duration and timing of its initiation. Monotherapy with high dose interferon alpha or peg-interferon for 6 months is recommended. Although important progress has been achieved in acute hepatitis C understanding, research continues to improve treatment regimens and to clarify mechanisms of viral clearance.

Hepatitis C↗
PubMedDate not supplied

Rapid full-length genomic sequencing of two cytopathically heterogeneous Australian primary HIV-1 isolates.

Two Australian HIV-1 isolates, derived from patient blood (HIV(MBC200)) and cerebrospinal fluid (HIV(MBC925)), were characterized after in vitro culture in peripheral blood mononuclear cells (PBMC). Although virus replication was similar, as measured by cell-free reverse transcriptase activity, only one of the two isolates (HIV-1(MCB200)) consistently induced cell syncytia and depleted the PBMC population of CD4+ cells by cell killing. A novel technique, devised for rapidly obtaining high-quality viral sequence data and the full-length genomic sequence of these two isolates, is presented. Analysis of the predicted sequence of the viral Env proteins provides correlates of the observed phenotypes. Phylogenetic analysis derived using near full-length sequence of these and other HIV-1 subtype B genomic sequences (including two other Australian isolates) shows a star-shaped phylogeny with each member having a similar genetic diversity. These data expand the database of genomic sequence available from well-characterized primary clinical isolates of HIV-1 using a novel rapid technique.

Acquired Immunodeficiency Syndrome↗
PubMed2005

An alien promoter capture as a primary step of the evolution of testes-expressed repeats in the Drosophila melanogaster genome.

Fertility of Drosophila melanogaster males is impaired due to the disruption of the silencing of the X-linked, testis-expressed, repeated Stellate (Ste) genes. Ste silencing is mediated by symmetric transcription of the paralogous Y-linked repeats and exerted by an RNA interference (RNAi) mechanism. Here we present a scenario for the origin of the Ste genes and their suppressors. The primary intermediate of their evolution emerged as a result of the acquisition of a preformed alien, testis-specific promoter. This intermediate is identified as a chimeric gene containing coding region of an autosomal gene for testis-specific protein kinase CK2. The 5' region of the chimera has been acquired from a member of a family of testis-expressed X-linked genes of unknown function. We propose that the evolution and amplification of the novel chimeric gene have led to the overproduction of the regulatory CK2 subunit in testes. The evolution of the Y-linked descendants of the primary intermediate resulted in the RNAi-mediated suppression of excessive expression of the X-linked paralogs. The newly detected "dead family" of cognate repeats on the Y chromosome has contributed to the evolution of Ste and its suppressors via gene conversion. Our results show that RNAi silencing, considered as a defense against viruses and transposable elements, may be involved in the evolution of eukaryotic genomes.

Animals↗