Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “replication”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,171 records · Page 65Linked to original sources
PubMed1986

Deoxyribonuclease I sensitivity of DNA replicated in permeable mouse sarcoma cells.

To study chromatin structure at the sites of DNA replicated in permeable cells, deoxyribonuclease I (DNase I) sensitivity of newly replicated DNA in permeable mouse sarcoma cells was compared with that of newly replicated DNA in intact cells. About 35% of the DNA replicated in permeable cells was hypersensitive to DNase I, and the remaining DNA showed the same DNase I sensitivity as that of parental chromatin DNA. The sensitivity of DNA replicated in permeable cells was higher than that of DNA newly replicated in intact cells, and was close to that of DNA replicated in the presence of cycloheximide. The sensitivity of DNA pulse-labeled with [3H]deoxythymidine triphosphate by replication in permeable cells was reduced significantly by chasing with cold deoxythymidine triphosphate. The present results suggest that chromatin structure at the sites of DNA replicated in permeable cells is similar to that at the sites of DNA replicated in living cells in the absence of protein synthesis, and that some structural change (possibly toward the maturation) of newly replicated chromatin occurs after the DNA replication in permeable cells.

Animals↗
PubMed1985

5',5'''-P1, P4 diadenosine tetraphosphate (Ap4A): a putative initiator of DNA replication.

The proposal that Ap4A acts as an inducer of DNA replication is based primarily on two pieces of evidence (7). The intracellular levels of Ap4A increase ten- to 1000-fold as cells progress into S phase and the introduction of Ap4A into nonproliferating cells stimulated DNA synthesis. There is also some additional suggestive evidence such as the binding of Ap4A to a protein that is associated with multiprotein forms of the replicative DNA polymerase alpha and the ability of this enzyme to use Ap4A as a primer for DNA synthesis in vitro with single-stranded DNA templates. These observations have stimulated interest in the cellular metabolism of Ap4A. This is well since there is a great need for additional experimentation in order to clearly establish Ap4A as an inducer of DNA replication. Microinjection experiments of Ap4A into quiescent cells are needed in order to ascertain if Ap4A will stimulate DNA replication and possibly cell division in intact cells. Studies of the effects of nonhydrolyzable analogs of Ap4A on DNA replication in intact quiescent cells could also prove valuable. Although Ap4A can function as a primer for in vitro DNA synthesis by DNA polymerase alpha this may not be relevant in regard to its in vivo role in DNA replication. Ap4A in vivo could interact with key protein(s) in DNA replication and in this way act as an effector molecule in the initiation of DNA replication. In this regard the interaction of Ap4A with a protein associated with a multiprotein form of DNA polymerase alpha isolated from S-phase cells is of interest. More experiments are required to determine if there is a specific target protein(s) for Ap4A in vivo and what its role in DNA replication is. The cofractionation of tryptophanyl-tRNA synthetase with the replicative DNA polymerase alpha from animal and plant cells is of interest. The DNA polymerase alpha from synchronized animal cells also interacted with Ap4A. Although the plant cell alpha-like DNA polymerase did not interact with Ap4A this DNA polymerase was not a multiprotein form of polymerase alpha and the synchrony of the wheat germ embryos was not known. A possible tie between protein-synthesizing systems and the regulation of proteins involved in DNA replication may exist. The requirement of protein synthesis for the initiation of DNA replication has long been known. Also, it is well established that many temperature-sensitive mutants for tRNA synthetases are also DNA-synthesizing mutants. More investigation in this area may be warranted.(ABSTRACT TRUNCATED AT 400 WORDS)

Acid Anhydride Hydrolases↗
PubMed2000

Modification in the inherent mode of allelic replication in lymphocytes of patients suffering from renal cell carcinoma: a novel genetic alteration associated with malignancy.

Using fluorescence in situ hybridization (FISH) to interphase nuclei, we examined the replication timing of 1 allele relative to its counterpart in PHA-stimulated peripheral blood lymphocytes of normal subjects and patients suffering from a solid tumor (renal cell carcinoma). In the FISH assay, an unreplicated DNA sequence is identified by a single dot-like hybridization signal, whereas a replicated region gives rise to a duplicated, bipartite signal. Accordingly, lymphocytes of normal individuals show 2 patterns of allelic replication: (i) synchronized replication of allelic counterparts, as exemplified by the biallelically expressed loci TP53 and D21S55; and (ii) non-synchronized replication of allelic partners, as exemplified by the early and late replicating alleles of GABRB3, an imprinted locus subjected to monoallelic expression. However, when present in lymphocytes of the cancer patients, all 3 loci change their replication mode: alleles of TP53 and D21S55 become asynchronous, whereas the early replicating allele of GABRB3 delays replication, leading to relaxation in the imprinted mode of replication. Based on the tight relationship between temporal order of allelic replication and allelic mode of expression, the modified order of allelic replication observed in nonmalignant cells of individuals diagnosed with cancer represents a novel genetic alteration associated with malignancy. This alteration detected by simple cytogenetic means, applied to peripheral blood lymphocytes, offers a potential test for cancer identification. Genes Chromosomes Cancer 27:270-277, 2000.

Aged↗
PubMed1990

Specificity of RepC protein in plasmid pT181 DNA replication.

The plasmid pT181 of Staphylococcus aureus consists of 4437 base pairs and encodes resistance to tetracycline. Initiation of pT181 DNA replication specifically requires the plasmid-encoded initiator protein, RepC. The initiator protein binds specifically to a 32-base pair sequence within the pT181 origin of replication. RepC protein also has a nicking-closing activity that is specific for the pT181 origin. Replication of pT181 initiates by covalent extension of the nick and proceeds by a rolling circle mechanism. Two other small, multicopy plasmids pC221 and pS194 belong to the pT181 family and have common structural organization and replication properties. The replication proteins and replication origins of these plasmids have extensive sequence homologies, although they belong to different incompatibility groups. In spite of this homology, the replication proteins and replication origins of these three plasmids do not show any cross-reactivity in vivo. We have carried out a series of in vitro experiments to determine the specificity of pT181-encoded initiator protein, RepC. DNA binding experiments showed that although the binding of RepC to the pT181 origin was very efficient, little or no binding was seen with pC221 and pS194 origins. The nicking-closing activity of RepC was found to be equally efficient with the pC221 and pS194 plasmids. The plasmids pC221 and pS194 replicated efficiently in a RepC-dependent in vitro system. However, replication of these plasmids was greatly reduced in the presence of a competing pT181 origin. The results presented here suggest that nicking-closing by RepC at the origin is not sufficient for maximal replication and that tight binding of RepC to the origin plays an important role in the initiation of DNA replication.

Bacterial Proteins↗
PubMed1989

Synthesis of single-stranded plasmid pT181 DNA in vitro. Initiation and termination of DNA replication.

The origin of replication of plasmid pT181 is nicked by the plasmid-encoded RepC protein. The free 3'-hydroxyl end at the nick is presumably used as primer for leading strand DNA synthesis. In vitro replication of pT181 was found to generate single-stranded DNA in addition to the supercoiled, double-stranded DNA. The single-stranded DNA was circular and corresponded to the pT181 leading strand. Recombinant plasmids were constructed that contain two pT181 origins of replication in either direct or inverted orientation. In vitro replication of the plasmid carrying two origins in direct orientation was shown to generate circular, single-stranded DNA that corresponded to initiation of replication at one origin sequence and termination at the other origin. These results demonstrate that the origin of pT181 leading strand DNA replication also serves as the site for termination of replication. Interestingly, the presence of two origins in inverted orientation resulted in initiation of replication at one origin and stalling of the replisome at the other origin. These results suggest that RepC can reinitiate replication at the second origin by nicking partially replicated, relaxed DNA. These data are consistent with the replication of pT181 by a rolling circle mechanism and indicate that single-stranded DNA is an intermediate in pT181 replication.

Blotting, Southern↗
PubMed1984

Reversal of DNA methylation with 5-azacytidine alters chromosome replication patterns in human lymphocyte and fibroblast cultures.

Prior studies demonstrated that developmental or induced methylation of DNA can inactivate associated gene loci. Such DNA methylation can be reversed and specific genes reactivated by treatment with 5-azacytidine (5- azaC ). The present cytogenetic studies using replication banding methods show that 5- azaC treatment also results in an increase or decrease in replication staining at one or more band locations in human lymphocyte and fibroblast chromosomes. New replication band locations are not formed. These changes in replication staining, which reflect changes in timing of replication, are different between these two tissues. However, in both tissues, the delayed onset of replication in the heterocyclic, inactive X is shortened by 5- azaC . A correlation is thus suggested between the induced temporal change to earlier DNA replication, and induced hypomethylation and gene activation. The temporal effect on chromosome replication in 5- azaC -treated cells depends on the portion of the S-period studied. Toward the beginning of S, early-replication patterns are increased in both lymphocytes and fibroblasts. Toward the end of S, late-replication patterns are increased only in lymphocytes, suggesting a differential effect of 5- azaC in: (1) early-vs. late-S, and (2) lymphocytes vs. fibroblasts. Generally, 5- azaC has its greatest effect on the inactive chromosome regions that are typically late-replicating prior to 5- azaC treatment. These observed changes in replication band staining suggest that DNA methylation may modify regional groups of genes in concert.

Azacitidine↗
PubMed1995

Intraocular viral replication after systemic murine cytomegalovirus infection requires immunosuppression.

PURPOSE: Human cytomegalovirus retinitis is the most common blinding complication of acquired immune deficiency syndrome. However, the pathogenesis of the disease is poorly understood. The authors sought to characterize intraocular viral replication after systemic murine cytomegalovirus (MCMV) infection in the normal and immunosuppressed Balb/c mouse. METHODS: Normal or immunosuppressed mice (400 rads radiation plus antilymphocyte serum) were infected intravenously with a recombinant MCMV (RM408) that carries an MCMV IE1 promoter--LacZ insert. In vivo MCMV replication and its tissue distribution were monitored by beta-gal activity with x-gal staining on frozen tissue sections of multiple organs harvested from infected mice at different time points after inoculation. RESULTS: MCMV replication within the eye can be detected in the immunosuppressed Balb/c mouse but not in the normal host. Intraocular viral replication was noted first, and most frequently, in the ciliary body and was mainly restricted to the uveal tract. Intraocular viral replication coincided with the peak of systemic viral replication; however, the neurosensory retina was spared. In contrast, supraciliary inoculation of MCMV in the immunosuppressed Balb/c mouse resulted in massive viral replication and destruction of the neurosensory retina. CONCLUSIONS: This study demonstrated that intraocular MCMV replication after systemic infection requires systemic immunosuppression. Furthermore, the ciliary body is the portal of entry for the virus within the eye. MCMV can replicate in the epithelium of the uvea and retinal pigment epithelium, but it does not replicate within the neurosensory retina. The absence of MCMV replication within the neurosensory retina is not caused by either a defect in the recombinant virus or the inability of the host tissue to support viral replication.

Animals↗
PubMed1994

High resolution localization of replicating viral genome in adenovirus-infected HeLa cells.

Previous autoradiographical and in situ hybridization experiments have revealed that the replication of viral genomes in adenovirus type 5 infected HeLa cells induces changes in nuclear structure of which one of the more striking is the formation of distinctive replicative foci. The latter consist of a viral ssDNA accumulation site and a surrounding fibrillogranular network. We have reexamined these structures and processes by a more direct and higher resolution approach, that is, incorporation of bromodeoxyuridine (BrdU) by the infected cells and subsequent immunogold detection of the BrdU incorporated into DNA. Short pulses with BrdU in pulse-chase experiments confirmed that viral DNA replication at the early stage of nuclear transformation was confined within small virus-induced structures, the so-called early replicative sites, and revealed the persistence of the newly synthesized viral DNA at those sites for at least 2 h. At intermediate and late stages of nuclear transformation, the intensity of viral DNA replication, which varies from one type of replicative focus to another, was most intense in that layer of the fibrillogranular network which was in closest proximity to the viral single-stranded DNA (ssDNA) accumulation sites, whereas replication was weakest over the latter. Subsequently, BrdU-containing viral DNA molecules became more widely distributed in the viral ssDNA accumulation sites and the fibrillogranular network, the two constituents of the viral replicative machinery. Two hours later, some labeled molecules attained the viral genome storage site and/or became encapsulated. The most striking observation is the presence of a limited region in the replicative focus which is the preferential site for viral genome replication. The data also indicated that viral DNA molecules which were labeled during the short pulses remained in the replicative foci themselves, to be replicated and transcribed prior to attaining the pool of inactive genomes and/or becoming encapsulated.

Adenoviruses, Human↗
PubMed1995

Changes in the subcellular localization of replication initiation proteins and cell cycle proteins during G1- to S-phase transition in mammalian cells.

DNA replication in eukaryotic cells is restricted to the S-phase of the cell cycle. In a cell-free replication model system, using SV40 origin-containing DNA, extracts from G1 cells are inefficient in supporting DNA replication. We have undertaken a detailed analysis of the subcellular localization of replication proteins and cell cycle regulators to determine when these proteins are present in the nucleus and therefore available for DNA replication. Cyclin A and cdk2 have been implicated in regulating DNA replication, and may be responsible for activating components of the DNA replication initiation complex on entry into S-phase. G1 cell extracts used for in vitro replication contain the replication proteins RPA (the eukaryotic single-stranded DNA binding protein) and DNA polymerase alpha as well as cdk2, but lack cyclin A. On localizing these components in G1 cells we find that both RPA and DNA polymerase alpha are present as nuclear proteins, while cdk2 is primarily cytoplasmic and there is no detectable cyclin A. An apparent change in the distribution of these proteins occurs as the cell enters S-phase. Cyclin A becomes abundant and both cyclin A and cdk2 become localized to the nucleus in S-phase. In contrast, the RPA-34 and RPA-70 subunits of RPA, which are already nuclear, undergo a transition from the uniform nuclear distribution observed during G1, and now display a distinct punctate nuclear pattern. The initiation of DNA replication therefore most likely occurs by modification and activation of these replication initiation proteins rather than by their recruitment to the nuclear compartment.

Base Sequence↗
PubMed2004

Protein and sequence requirements for the recruitment of the human origin recognition complex to the latent cycle origin of DNA replication of Epstein-Barr virus oriP.

Initiation of DNA replication from within the Epstein-Barr virus (EBV) latent cycle origin oriP occurs once per cell cycle and is almost entirely dependent upon cellular proteins. The human origin recognition complex (ORC) is recruited to oriP and orchestrates the events that lead to the initiation of replication. EBNA-1, the sole viral protein required for oriP-plasmid replication, binds four sites within the replicator but the role(s) it plays in the replication of oriP plasmids has not been elucidated. We investigated the recruitment of ORC to oriP in vivo and show that the binding of EBNA-1 to the replicator is necessary for the association of the ORC subunit Orc2 with the replicator. The minimal replicator of oriP consists of two EBNA-1 binding sites flanked by perfect 14-bp inverted repeats (a and b), but these repeats are dispensable for the association of Orc2 with the replicator. A mutational analysis of the 14-bp repeats provided additional support for a role for the telomere repeat binding protein 2 in oriP replicator function. We show that nucleotide differences between the oriP replicator of the B95-8 and Raji EBV genomes are not solely responsible for the inefficient utilization of this origin in the Raji EBV genome.

Binding Sites↗
PubMed1997

Identification of sequence requirement for the origin of DNA replication in human papillomavirus type 18.

DNA replication of human papillomavirus type 18 is dependent on viral proteins E1 and E2 and the subsequent interaction of these proteins with the viral origin of replication. Using a site-directed mutagenesis analysis, we examined the sequence requirement for the DNA replication of the human papillomavirus type 18. We showed that both the E1BS palindrome and E2BS are the major determinants of the HPV replication efficiency. In particular, abolishing E2 binding sites demonstrated that E2BS makes a significant contribution towards HPV-18 DNA replication. Each part of the 18-bp inverted repeat sequence of the E1BS motif showed a clear functional difference between two regions: nt 13-21 (3' half segment) is evidently more important for replication than nt 4-12 (5' half segment). Besides E1BS and E2BS, cis-acting elements such as the poly-A6 track, perhaps the YY1 binding site, and the TATA box sequence within the origin region exhibited some contributions to optimum replication. In addition, inserting an enhancer region to the minimum origin DNA derivatives increased replication approximately 2-fold compared with the wild type levels and showed some compensational effects on loss of the cis-element within the HPV-18 minimum origin, suggesting that an enhancer region is required for efficient replication of the papillomavirus origin. These results suggest that the formation of an E1-E2-ori complex is important for replication, and other sequences near the E1 and E2 binding sites assist E1-E2-ori-mediated DNA replication in vivo.

Base Sequence↗
PubMed1998

In vitro analysis of UV-damage-induced inhibition of replication.

We investigated DNA-damage-induced inhibition of replication by using an in vitro system, with which both replication and repair can be examined simultaneously. The system contains non-irradiated simian virus 40 (SV40) origin-containing DNA, UV-irradiated circular duplex DNA lacking an SV40 origin, and cell extracts that support both replication and repair activities. Using this system, we show that replication is significantly inhibited in the presence of UV-irradiated, but not non-irradiated, DNA and, to a lesser extent, repair activity is also inhibited by the presence of replication activity. In contrast, replication activity was not affected by UV-damaged DNA when the reactions were carried out with purified replication proteins, suggesting that protein factor(s) in the cell extracts are involved in the inhibition of replication that is triggered by DNA damage. Inhibition was efficiently reversed by the combined actions of proteins involved in both repair and replication, suggesting that the inhibition of replication observed in our system may be caused by the recruitment of replication proteins to damaged DNA sites.

DNA Damage↗
PubMed2000

HeLa cells are phenotypically limiting in cyclin E/CDK2 for efficient human papillomavirus DNA replication.

Human papillomaviral (HPV) origin-containing plasmids replicate efficiently in human 293 cells or cell extracts in the presence of HPV origin-recognition protein E2 and replication initiation protein E1, whereas cervical carcinoma-derived, HPV-18-positive HeLa cells or cell extracts support HPV DNA replication poorly. We recently showed that HPV-11 E1 interacts with cyclin/cyclin-dependent kinase (cdk) complexes through an RXL motif and is a substrate for these kinases. E1 mutations in this motif or in candidate cdk phosphorylation sites are impaired in replication, suggesting a role for cdks in HPV replication. We now demonstrate that one limiting activity in HeLa cells is cyclin E/CDK2. Purified cyclin E/CDK2 or cyclin E/CDK3 complex, but not other cdks, partially complemented HeLa cell extracts. Cyclin E/CDK2 expression vectors also enhanced transient HPV replication in HeLa cells. HeLa cell-derived HPV-18 E1 protein is truncated at the carboxyl terminus but can associate with cyclin E/CDK2. This truncated E1 was replication-incompetent and inhibited cell-free HPV replication. These results indicate that HeLa cells are phenotypically limiting in cyclin E/CDK2 for efficient HPV replication, most likely due to sequestration by the endogenous, defective HPV-18 E1 protein. Further analyses of the regulation of HPV E1 and HPV replication by cyclin E may shed light on the roles of cyclin E/CDK2 in cellular DNA replication.

CDC2-CDC28 Kinases↗
PubMed1995

Cellular factors required for papillomavirus DNA replication.

In vitro replication of papillomavirus DNA has been carried out with a combination of purified proteins and partially purified extracts made from human cells. DNA synthesis requires the viral E1 protein and the papillomavirus origin of replication. The E2 protein stimulates DNA synthesis in a binding site-independent manner. Papillomavirus DNA replication is also dependent on the cellular factors replication protein A, replication factor C, and proliferating-cell nuclear antigen as well as a phosphocellulose column fraction (IIA). Fraction IIA contains DNA polymerase alpha-primase and DNA polymerase delta. Both of these polymerases are essential for papillomavirus DNA replication in vitro. However, unlike the case with T-antigen-dependent replication from the simian virus 40 origin, purified DNA polymerase alpha-primase and delta cannot efficiently replace fraction IIA in the replication reaction. Hence, additional cellular factors seem to be required for papillomavirus DNA replication. Interestingly, replication factor C and proliferating-cell nuclear antigen are more stringently required for DNA synthesis in the papillomavirus system than in the simian virus 40 in vitro system. These distinctions indicate that there must be mechanistic differences between the DNA replication systems of papillomavirus and simian virus 40.

Bovine papillomavirus 1↗
PubMed1994

A cis-acting function for the coronavirus leader in defective interfering RNA replication.

To test the hypothesis that the 65-nucleotide (nt) leader on subgenomic mRNAs suffices as a 5'-terminal cis-acting signal for RNA replication, a corollary to the notion that coronavirus mRNAs behave as replicons, synthetic RNA transcripts of a cloned, reporter-containing N mRNA (mRNA 7) of the bovine coronavirus with a precise 5' terminus and a 3' poly(A) of 68 nt were tested for replication after being transfected into helper virus-infected cells. No replication was observed, but synthetic transcripts of a cloned reporter-containing defective interfering (DI) RNA differing from the N mRNA construct by 433 nt of continuous 5'-proximal genomic sequence between the leader and the N open reading frame did replicate and become packaged, indicating the insufficiency of the leader alone as a 5' signal for replication of transfected RNA molecules. The leader was shown to be a necessary part of the cis-acting signal for DI RNA replication, however, since removal of terminal bases that destroyed a predicted intraleader stem-loop also destroyed replicating ability. Surprisingly, when the same stem-loop was disrupted by base substitutions, replication appeared only minimally impaired and the leader was found to have rapidly reverted to wild type during DI RNA replication, a phenomenon reminiscent of high-frequency leader switching in the mouse hepatitis coronavirus. These results suggest that once a minimal structural requirement for leader is fulfilled for initiation of DI RNA replication, the wild-type leader is strongly preferred for subsequent replication. They also demonstrate that, in contrast to reported natural mouse hepatitis coronavirus DI RNAs, the DI RNA of the bovine coronavirus does not require sequence elements originating from discontinuous downstream regions within the polymerase gene for replication or for packaging.

Amino Acid Sequence↗
PubMed1999

Brome mosaic virus RNA replication proteins 1a and 2a colocalize and 1a independently localizes on the yeast endoplasmic reticulum.

The universal membrane association of positive-strand RNA virus RNA replication complexes is implicated in their function, but the intracellular membranes used vary among viruses. Brome mosaic virus (BMV) encodes two mutually interacting RNA replication proteins: 1a, which contains RNA capping and helicase-like domains, and the polymerase-like 2a protein. In cells from the natural plant hosts of BMV, 1a and 2a colocalize on the endoplasmic reticulum (ER). 1a and 2a also direct BMV RNA replication and subgenomic mRNA synthesis in the yeast Saccharomyces cerevisiae, but whether the distribution of 1a, 2a, and active replication complexes in yeast duplicates that in plant cells has not been determined. For yeast expressing 1a and 2a and replicating BMV genomic RNA3, we used double-label confocal immunofluorescence to define the localization of 1a, 2a, and viral RNA and to explore the determinants of replication complex targeting. As in plant cells, 1a and 2a colocalized on and were retained on the yeast ER, with no detectable accumulation in the Golgi apparatus. 1a and 2a were distributed over most of the ER surface, with strongest accumulation on the perinuclear ER. In vivo labeling with bromo-UTP showed that the sites of 1a and 2a accumulation were the sites of nascent viral RNA synthesis. In situ hybridization showed that completed viral RNA products accumulated predominantly in the immediate vicinity of replication complexes but that some, possibly more mature cells also accumulated substantial viral RNA in the surrounding cytoplasm distal to replication complexes. Additionally, we find that 1a localizes to the ER when expressed in the absence of other viral factors. These results show that BMV RNA replication in yeast duplicates the normal localization of replication complexes, reveal the intracellular distribution of RNA replication products, and show that 1a is at least partly responsible for the ER localization and retention of the RNA replication complex.

Animals↗
PubMed1991

Position and orientation-dependent effects of a eukaryotic Z-triplex DNA motif on episomal DNA replication in COS-7 cells.

A cluster of simple repeated sequences composed of 5'-(GC)5(AC)18(AG)21(G)9(CAGA)4GAGGGAGAGAGGCAGAGAGGG(AG)27-3 ' located near the origin of replication associated with the Chinese hamster dhfr gene has been shown to adopt multiple Z-form and triplex DNA structures under various experimental conditions (Bianchi, A., Wells, R. D., Heintz, N. H., and Caddle, M. S. (1990) J. Biol. Chem. 265, 21789-21796). Thus, we refer to the cluster of alternating repeats as a Z-triplex DNA motif. Primer extension studies indicate that DNA polymerases traverse the Z-triplex sequence more readily in the Z to triplex direction than in the triplex to Z direction. To examine the effect of these sequences on replication fork travel in living cells, the Z-triplex motif was cloned in both orientations on the early and late side of the SV40 origin of replication in the vector pSV011. Test constructs were cotransfected along with pSV011 into COS-7 cells, and plasmid replication was monitored by the accumulation of DpnI-resistant replication products. A single copy of the Z-triplex motif reduced plasmid replication after 48 h by 20-50%, depending upon the position and orientation of the insert relative to the SV40 origin sequences. The replication of plasmids containing two copies of the Z-triplex motif, in different orientations on either side of the SV40 origin, was reduced by 85-95% as compared to the cotransfected control. Two-dimensional gel analysis of replication intermediates failed to show absolute termination of replication fork travel at the Z-triplex sequences, but rather indicated that the Z-triplex region causes replication intermediates to accumulate during the late phases of replication. These results indicate that the dhfr Z-triplex region has complex effects on both replication fork movement and the termination phases of episomal DNA synthesis in animal cells.

Animals↗
PubMed1984

Synchronization of bacteriophage Mu DNA replicative transposition: analysis of the first round after induction.

The lytic cycle of bacteriophage Mu includes a large number of coupled DNA replication and integration events, each of which is equivalent in several respects to the process of transposition of genetic elements. To aid us in studying the process of Mu DNA replicative transposition, we developed a technique for synchronizing the first round of replication following induction of a lysogen. Synchronization was achieved by inducing a lysogen in the absence of DNA replication for a time sufficient to develop the potential for Mu DNA replication in all cells in the population; upon release of the inhibition of replication, a synchronized round of Mu DNA replication was observed. Development of the potential for Mu DNA replication in the entire population took approximately 12 min. Protein synthesis was required for development of the potential, but the requirement for protein synthesis was satisfied by approximately 9 min suggesting that other, as yet unspecified, reactions occupied the last 3 min. Replication proceeded predominantly from the left end of the prophage, though a significant amount of initiation from the right end was observed. The usefulness of the technique for studying the mechanism of replicative transposition and the end products of a single round of replication are discussed.

Bacteriophage mu↗