Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “RNA sequencing”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,171 records · Page 65Linked to original sources
PubMed1986

Effects of heavy metals on Drosophila larvae and a metallothionein cDNA.

Drosophila melanogaster larvae reared on food containing radioactive cadmium retained over 80% of it, mostly in the intestinal epithelium. The majority of this radioactivity was associated with a soluble protein of less than 10,000 molecular weight. Synthesis of this cadmium-binding protein was induced by the metal as demonstrated by incorporation of radioactive cysteine. Most copper ingested by larvae was also found to associate with a low molecular weight, inducible protein, but some of it was found in an insoluble fraction. Zinc was unable to, or very inefficient at, binding or inducing the synthesis of a similar protein. A D. melanogaster cDNA clone was isolated based on its more intense hybridization to copies of RNA sequences from copper-fed larvae than from control larvae. This clone showed strong hybridization to mouse metallothionein-I cDNA at reduced stringency. Its nucleotide sequence includes an open-reading segment which codes for a 40-amino acid protein; this protein was identified as metallothionein based on its similarity to the amino-terminal portion of mammalian and crab metalloproteins. The ten cysteine residues present occur in five pairs of near-vicinal cysteines (Cys-X-Cys). This cDNA sequence hybridized to a 400-nucleotide polyadenylated RNA whose presence in the cells of the alimentary canal of larvae was stimulated by ingestion of cadmium or copper; in other tissues this RNA was present at much lower levels. Mercury, silver, and zinc induced metallothionein to a lesser extent. Whether (any of) the protein(s) discussed above correspond(s) to that coded by this RNA sequence has not yet been determined.

Amino Acid Sequence↗
PubMed1993

CTLA-8, cloned from an activated T cell, bearing AU-rich messenger RNA instability sequences, and homologous to a herpesvirus saimiri gene.

To detect novel molecules involved in immune functions, a subtracted cDNA library between closely related murine lymphoid cells was prepared using improved technology. Differential screening of this library yielded several clones with a very restricted tissue specificity, including one that we named CTLA-8. CTLA-8 transcripts could be detected only in T cell hybridoma clones related to the one used to prepare the library. Southern blots showed that the CTLA-8 gene was single copy in mice, rats, and humans. By radioactive in situ hybridization, the CTLA-8 gene was mapped at a single site on mouse chromosome 1A and human chromosome 2q31, in a known interspecific syntenic region. The CTLA-8 cDNA sequence indicated the presence, in the 3'-untranslated region of the mRNA, of AU-rich repeats previously found in the mRNA of various cytokines, growth factors, and oncogenes. The CTLA-8 cDNA contained an open reading frame encoding a putative protein of 150 amino acids. This protein was 57% homologous to the putative protein encoded by the ORF13 gene of herpesvirus Saimiri, a T lymphotropic virus. These findings are discussed in the context of other genes of this herpesvirus homologous to known immunologically active molecules. More generally, CTLA-8 may belong to the growing set of virus-captured functionally important cellular genes related to the immune system or to cell death and cell survival.

Amino Acid Sequence↗
PubMed1977

Sequence from the assembly nucleation region of TMV RNA.

In an effort to isolate RNA sequences containing the assembly nucleation region, uniformly 32P-labeled tobacco mosaic virus RNA was partially digested with pancreatic ribonuclease, and the mixture of fragments was incubated with limited amounts of tobacco mosaic virus protein disks in conditions favorable for reconstitution. The RNA fragments which became encapsidated were purified and sequenced by conventional techniques. The sequence of the first 139 nucleotides of P1, the principal encapsidated fragment, is AGGUUUGAGAGAGAAGAUUACAAGCGUGAGAGACGGAGGGCCCAUGGAACUUACAGAAGAAGUUGUUGAUGAGUUCAUGGAAGAUGUCCCUAUGUCAAUCAGACUUGCAAAGUUUCGAUCUCGAACCGGAAAAAAGAGU. Residues 1--110 of P1 overlap the assembly origin isolated and characterized in the accompanying papers by Zimmern (1977) and Zimmern and Butler (1977). Our results, taken in conjunction with the two accompanying papers, define the sequence of much of the nucleation region as well as sequences flanking it on both sides. The features of the P1 sequence which may have role in the nucleation reaction are discussed in detail in the text.

Base Sequence↗
PubMed2005

Hairpin ribozymes in combination with siRNAs against highly conserved hepatitis C virus sequence inhibit RNA replication and protein translation from hepatitis C virus subgenomic replicons.

Chronic hepatitis C virus (HCV) infection is a clinically important liver disease with limited therapeutic options in a significant proportion of patients. Therefore, novel efficient therapeutic agents are needed. Because the 5'- and 3'-untranslated regions (UTRs) of HCV are highly conserved and functionally important for HCV replication, they are attractive targets for RNA-cleaving ribozymes or small interfering RNAs (siRNAs). In this study hairpin ribozymes (Rz) targeting HCV 5'- and 3'-UTR sequences were expressed from a retroviral vector transcript under control of two different RNA polIII promoters (tRNA(Val), U6). Ribozymes were evaluated in monocistronic, subgenomic I389/hyg-ubi/NS3-3'/5.1 HCV replicon cells as single agents or in combination with siRNAs against HCV 5'- or 3'-UTR recently demonstrated to inhibit HCV replicons. Additionally, ribozyme constructs were generated with the 3'-terminus of the ribozyme flanked by constitutive transport element (CTE) sequences, an RNA motif that has previously been shown to enhance cleavage activity of hammerhead ribozymes. In our study, tRNA(Val) as well as U6 promoter-driven Rzs markedly reduced HCV replicon RNA expression and HCV internal ribosome entry site (IRES)-mediated HCV NS5B protein translation from monocistronic subgenomic replicons. However, attachment of CTE sequences to the 3'-terminus did not significantly enhance activity of Rzs tested in this study. Interestingly, we detected additive HCV inhibitory effects for combinations of tRNA(Val)-driven Rzs and U6-derived siRNAs both directed against highly conserved 5'- and 3'-UTR sequence, suggesting that a dual strategy of ribozymes and siRNAs might become a powerful molecular tool to specifically silence HCV RNA replication.

Blotting, Western↗
PubMed2006

A set of nearest neighbor parameters for predicting the enthalpy change of RNA secondary structure formation.

A complete set of nearest neighbor parameters to predict the enthalpy change of RNA secondary structure formation was derived. These parameters can be used with available free energy nearest neighbor parameters to extend the secondary structure prediction of RNA sequences to temperatures other than 37 degrees C. The parameters were tested by predicting the secondary structures of sequences with known secondary structure that are from organisms with known optimal growth temperatures. Compared with the previous set of enthalpy nearest neighbor parameters, the sensitivity of base pair prediction improved from 65.2 to 68.9% at optimal growth temperatures ranging from 10 to 60 degrees C. Base pair probabilities were predicted with a partition function and the positive predictive value of structure prediction is 90.4% when considering the base pairs in the lowest free energy structure with pairing probability of 0.99 or above. Moreover, a strong correlation is found between the predicted melting temperatures of RNA sequences and the optimal growth temperatures of the host organism. This indicates that organisms that live at higher temperatures have evolved RNA sequences with higher melting temperatures.

Algorithms↗
PubMed1999

Amplification of 16S ribosomal RNA gene sequences for the identification of streptococci of Lancefield group B.

The 16S r RNA gene of 49 streptococci of serological group B isolated from various origins was amplified by polymerase chain reaction (PCR) and subsequently digested with the restriction enzymes Rsa I and Msp I. The restriction profiles of all group B streptococci appeared to be identical indicating no intraspecies sequence variations of this gene. A fragment of the gene of two group B-streptococcal reference strains, including the hypervariable V2 region, could be amplified by PCR and sequenced. The sequence appeared to be identical and allowed the design of species-specific oligonucleotide primers. The primer pair used produced an amplicon with a size of 1250 bp and correctly identified all 49 group B-streptococci investigated but none of the control strains of various species and serogroups. This primer could be used in a multiplex PCR and allowed a rapid identification of bacteria of this species.

Base Sequence↗
PubMed2027

Teratoma Formation and Genomic Profiling Using Multi-Omics Approaches.

Teratoma formation is the gold standard assay for evaluating the developmental pluripotency of human and mouse embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs). Following subcutaneous injection into immunodeficient mice, pluripotent stem cells spontaneously differentiate into derivatives representing all three embryonic germ layers-ectoderm, mesoderm, and endoderm. Beyond serving as a functional assay for pluripotency, teratomas provide a unique three-dimensional model system for studying early human development and lineage specification in vivo. This chapter describes comprehensive protocols for teratoma formation in immunodeficient mice, tissue processing for multiple downstream genomic applications, and multi-omics profiling approaches. We detail methods for embryonic stem cell culture, teratoma generation via subcutaneous injection, tissue dissection and processing for chromatin immunoprecipitation followed by sequencing (ChIP-Seq), RNA sequencing (RNA-Seq), single-cell multiome profiling combining chromatin accessibility (ATAC-Seq) and gene expression (scRNA-Seq), and histological analysis using hematoxylin and eosin (H&E) staining. Additionally, we provide bioinformatics workflows for analyzing the resulting genomic datasets to characterize the epigenetic and transcriptional landscapes of teratoma-derived tissues. These methods enable comprehensive molecular characterization of developmental processes and provide valuable resources for stem cell biologists studying pluripotency, differentiation, and early embryonic development.

Teratoma↗
PubMed2026

Non-structural maintenance of chromosome condensin I complex subunit H knockdown suppresses malignant progression of esophageal squamous cell carcinoma via the Wnt/β-catenin signaling pathway.

BACKGROUND: Esophageal squamous cell carcinoma (ESCC) remains a major cause of cancer-related mortality, and effective therapeutic targets are still limited. Non-structural maintenance of chromosome condensin I complex subunit H (NCAPH) has been implicated in tumorigenesis; however, its clinical relevance, functional roles, and underlying mechanisms in ESCC are not fully defined. We aimed to characterize the expression pattern, prognostic value, biological functions, and mechanistic basis of NCAPH in ESCC. METHODS: Public datasets from The Cancer Genome Atlas (TCGA) and Gene Expression Omnibus (GEO) were analyzed to evaluate NCAPH expression and clinical associations. Single-cell RNA sequencing (scRNA-seq) data were used to map cell-type-specific distribution of NCAPH in tumor and adjacent tissues. NCAPH was silenced in KYSE150 and KYSE510 cells using lentiviral short hairpin RNAs (shRNAs), followed by Cell Counting Kit-8 (CCK-8), colony formation, wound-healing, and Transwell migration/invasion assays. A nude mouse xenograft model was established to assess the effect of NCAPH knockdown in vivo. RNA sequencing (RNA-seq), quantitative polymerase chain reaction (qPCR), western blotting, and enzyme-linked immunosorbent assay (ELISA) were performed to explore potential mechanisms. RESULTS: NCAPH was consistently upregulated in ESCC across multiple cohorts and was associated with unfavorable clinicopathological features and poorer survival. Functional assays demonstrated that NCAPH knockdown significantly inhibited ESCC cell proliferation, migration, invasion, and clonogenic growth. In vivo, NCAPH silencing suppressed xenograft tumor growth. Mechanistically, transcriptomic profiling and molecular validation indicated attenuation of Wnt/β-catenin signaling following NCAPH depletion, accompanied by reduced β-catenin and downstream targets. CONCLUSIONS: NCAPH promotes malignant progression of ESCC, at least in part through activation of the Wnt/β-catenin pathway, and may serve as a potential biomarker and therapeutic target.

Esophageal squamous cell carcinoma (ESCC)↗
PubMed1973

Tissue-specific transcription of the globin gene in isolated chromatin.

RNA was transcribed from chrmation from mouse fetal liver or brain, by use of DNA-dependent RNA polymerase of Escherichia coli. Globin messenger RNA sequences in the transcript were measured with complementary DNA copied from globin messenger RNA with RNA-dependent DNA polymerase. Globin messenger RNA sequences were found in RNA newly transcribed from chromatin from erythropoietic tissue but not in that transcribed from brain chromatin.

Animals↗
PubMed2005

HIV-2 genomic RNA contains a novel type of IRES located downstream of its initiation codon.

Eukaryotic translation initiation begins with assembly of a 48S ribosomal complex at the 5' cap structure or at an internal ribosomal entry segment (IRES). In both cases, ribosomal positioning at the AUG codon requires a 5' untranslated region upstream from the initiation site. Here, we report that translation of the genomic RNA of human immunodeficiency virus type 2 takes place by attachment of the 48S ribosomal preinitiation complex to the coding region, with no need for an upstream 5' untranslated RNA sequence. This unusual mechanism is mediated by an RNA sequence that has features of an IRES with the unique ability to recruit ribosomes upstream from its core domain. A combination of translation assays and structural studies reveal that sequences located 50 nucleotides downstream of the AUG codon are crucial for IRES activity.

Base Pairing↗
PubMed1991

Escherichia coli ribosome is inactivated by Mirabilis antiviral protein which cleaves the N-glycosidic bond at A2660 of 23 S ribosomal RNA.

Ribosome-inactivating proteins (RIPs) are known to inactivate eukaryotic ribosomes, which results in the inhibition of protein synthesis, but there has been no evidence that they inactivate the ribosomes of Escherichia coli. Recently, Mirabilis antiviral protein (MAP), a RIP, has been shown to inhibit the protein synthesis of E. coli as well as eukaryotes. To elucidate its mechanism, E. coli ribosomes treated with MAP were analyzed by polyacrylamide/agarose composite gel electrophoresis and RNA sequencing using reverse transcriptase with DNA primer. The 23 S rRNAs, with an A260 value for ribosomes of 15, were completely cleaved in vitro by a 30 minute treatment with MAP at a concentration of 100 nM at 37 degrees C and a subsequent treatment with aniline. However, they were not affected by ricin A-chain under the same conditions. The primer extension of DNA polymerization stopped before A2660 of 23 S rRNA in RNA sequencing. Furthermore, both 16 S and 23 S rRNAs were cleaved by the MAP and aniline treatments when naked E. coli rRNAs were used as substrates, and the primer extension stopped before bases A2660 and A1014, respectively, in RNA sequencing. As the A2660 region has been shown to interact with the elongation factors EF-Tu and EF-G these results indicate that MAP cleaves the N-glycosidic bond at A2660 in E. coli 23 S RNA resulting in the inactivation of the ribosome.

Base Sequence↗
PubMed1992

Suppression of gene expression in plant cells utilizing antisense sequences transcribed by RNA polymerase III.

Inverted sequences of the chloramphenicol acetyltransferase (CAT) reporter gene were fused to a soybean tRNA(met(i)) gene lacking a terminator such that the tRNA(met(i)) sequences caused the co-transcription of CAT antisense sequences by RNA polymerase III. When electroporated into carrot protoplasts, these antisense DNA constructs suppressed CAT enzyme activity expressed from co-electroporated DNAs containing the CAT gene downstream of the cauliflower mosaic virus (CaMV) 35S RNA promoter. Our most effective construct, an antisense sequence complementary to the 3' portion of the CAT gene, inhibited CAT activity five-fold greater than an antisense construct expressed by RNA polymerase II from the cauliflower mosaic virus 35S RNA promoter. These results indicate that antisense sequences transcribed by RNA polymerase III should efficiently suppress gene expression in plants.

Cell Line↗
PubMed2007

Early archives of genetically-restricted proviral DNA in the female genital tract after heterosexual transmission of HIV-1.

OBJECTIVES AND METHOD: In order to characterize human immunodeficiency virus type 1 (HIV-1) variants that are transmitted in women via heterosexual intercourse, the env V1-V3 sequences of HIV-1 provirus (DNA) and free virus (RNA) in paired samples of blood and cervicovaginal secretions of untreated chronically and primary infected African women were compared. RESULTS: Env RNA sequences retrieved from plasma and genital compartments formed a single cluster in primary infection. In contrast, env RNA sequences from these two compartments were distinct in chronically infected women. Analysis of proviral DNA of primary infected women showed that most HIV-1 sequences derived from the genital epithelia form independent clusters from HIV-1 sequences of DNA from peripheral blood mononuclear cells and RNA recovered from plasma and genital secretions. Similarly, the analysis of proviral DNA in the genital compartment of chronically infected women showed the persistence of genetically-restricted cluster of HIV-1. CONCLUSIONS: These observations indicate that a viral subpopulation is archived as proviral DNA in the female genital tract early in primary infection, and suggest that HIV-1 variants from the male donor are selected in the female mucosal site during male to female transmission of HIV-1.

Acute Disease↗
PubMed2024

TGIRT-seq to profile tRNA-derived RNAs and associated RNA modifications.

RNA modifications are key regulators for RNA processes. tRNA-derived RNAs are small RNAs with size between 15 and 50 bases long that are processed from mature or precursor tRNAs. Despite their more recent discovery, tRNA-derived RNAs have been found to play regulatory roles in many cellular processes including gene silencing, protein synthesis, stress response, and transgenerational inheritance. Furthermore, tRNA-derived RNAs are highly abundant in bodily fluids, posing as potential biomarkers. A unique feature of tRNA-derived RNAs is that they are rich in RNA modifications. Many of the RNA modifications on tRNA-derived RNAs disrupt Watson-Crick base pairing and will thus stall reverse transcriptase, such as N1-methyladenosine (m1A), N1-methylguanosine (m1G) and N2, N2-dimethylguanosine (m22G). These RNA modifications add another layer of regulation onto tRNA-derived RNAs' functions and are of interests for future research. However, these RNA modifications could also lead to lower detection of modification-containing RNAs in genome-wide small RNA sequencing analysis due to reverse transcriptase stall. To circumvent this bias, TGIRT (Thermostable Group II Intron Reverse Transcriptase) has been used to readthrough RNA modifications inserting mismatches. These mismatch signatures can then be used to precisely map the modification sites at base resolution. Here we describe the step-by-step experimental protocol to start with purified RNAs from cells or tissues and use TGIRT to make small RNA sequencing library for Illumina sequencing to profile the abundance of tRNA-derived RNAs and the associated RNA modifications.

RNA, Transfer↗
PubMed2003

Early diagnosis of Exophiala CAPD peritonitis by 18S ribosomal RNA gene sequencing and its clinical significance.

Phenotypic identification of fungi in clinical microbiology laboratories is often difficult and late, especially for slow growing and rarely encountered fungi. We describe the application of 18S ribosomal RNA (rRNA) gene sequencing in the early diagnosis of a case of Exophiala peritonitis. A yeast-like fungus was isolated from the dialysate fluid of a 66-year-old man undergoing continuous ambulatory peritoneal dialysis. It grew slowly after 12 days of incubation to yield mature cultures to permit recognition of microscopic features resembling those of Exophiala, a dematiacerous mold. 18S rRNA gene sequencing provided results 12 days earlier than phenotypic identification and revealed 15 base difference (0.9%) between the isolate and Exophiala sp. strain GHP 1205 (GenBank Accession no. AJ232954), indicating that the isolate most closely resembles a strain of Exophiala species. The patient responded to 4 weeks of intravenous amphotericin B therapy. Early identification of the fungus was important for the choice of anti-fungal regimen. As opportunistic fungal infections in immunocompromised patients are globally emerging problems, the development of molecular techniques for fungal identification is crucial for early diagnosis and appropriate treatment.

Aged↗
PubMed2025

Identification of GREM-1 and GAS6 as Specific Biomarkers for Cancer-Associated Fibroblasts Derived from Patients with Non-Small-Cell Lung Cancer.

Background/Objectives: Cancer-associated fibroblasts (CAFs) play a pivotal role in the tumor microenvironment. We conducted an analysis using RNA sequencing to identify specific markers for CAFs compared to normal fibroblasts (NFs) in non-small-cell carcinoma (NSCLC). Methods: CAFs and NFs were isolated and cultured from tumor tissues (primary tumor or metastatic lymph nodes) and matched non-tumor tissues, respectively. Bulk RNA sequencing was conducted on isolated CAFs and normal fibroblast NFs. Differential expressions, gene set enrichment, and CAF subpopulation prediction analyses were performed. Results: During the study period, 27 CAFs and 12 NFs were isolated and cultured from tumor and non-tumor tissues in patients with treatment-naïve NSCLC. Among them, 22 CAFs and 11 NFs were included in the RNA sequencing analysis. The 22 CAF samples consisted of 12 adenocarcinomas and 10 squamous cell carcinomas (SqCC), with 16 samples from the lungs and 6 samples from the lymph nodes. Notably, COL11A1, GREM1, CD36, and GAS6 showed a higher expression in CAFs than in NFs, whereas TNC and CXCL2 were more abundantly expressed in NFs. CD36 levels were elevated in CAFs from lymph nodes (LN-CAFs) compared with those from lung specimens (Lung-CAFs) and NFs. COL11A1 levels in Lung-CAFs surpassed those in LN-CAFs and NFs. Both GREM1 and GAS6 showed a strong expression in Lung-CAFs and LN-CAFs relative to NFs. CAFs exhibited features of the myofibroblast CAF subpopulation, whereas NFs displayed traits of the antigen-presenting CAF subtype. In the co-culture model of CAFs and THP-1 cells, the knockdown of GREM1 or GAS6 in CAFs significantly decreased the M2 marker expression in macrophages. Conclusions: In NSCLC, GREM1 and GAS6 can be valuable diagnostic targets for CAFs from primary tumors and metastatic sites; they warrant further study.

cancer-associated fibroblast↗
PubMed2006

High sensitivity RNA pseudoknot prediction.

Most ab initio pseudoknot predicting methods provide very few folding scenarios for a given RNA sequence and have low sensitivities. RNA researchers, in many cases, would rather sacrifice the specificity for a much higher sensitivity for pseudoknot detection. In this study, we introduce the Pseudoknot Local Motif Model and Dynamic Partner Sequence Stacking (PLMM_DPSS) algorithm which predicts all PLM model pseudoknots within an RNA sequence in a neighboring-region-interference-free fashion. The PLM model is derived from the existing Pseudobase entries. The innovative DPSS approach calculates the optimally lowest stacking energy between two partner sequences. Combined with the Mfold, PLMM_DPSS can also be used in predicting complicated pseudoknots. The test results of PLMM_DPSS, PKNOTS, iterated loop matching, pknotsRG and HotKnots with Pseudobase sequences have shown that PLMM_DPSS is the most sensitive among the five methods. PLMM_DPSS also provides manageable pseudoknot folding scenarios for further structure determination.

Algorithms↗
PubMed1990

Cloning and sequencing of RNA of hepatitis delta virus isolated from human serum.

The RNA of hepatitis delta virus (HDV) 1682 nucleotides long, has been cloned from a human serum isolate. Comparison with the three complete published sequences shows that a region of the HDV genome, between positions 620 and 1350, which contains sequences involved in replication and possibly pathogenicity, is highly conserved.

Animals↗