Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “mitochondrial dysfunction”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,153 records · Page 64Linked to original sources
PubMed2006

Suppression of survival kinases and activation of JNK mediate ethanol-induced cell death in the developing rat brain.

Administration of ethanol to immature rat pups during the period in which synaptogenesis occurs triggers extensive apoptotic cell death in the brain. This ethanol-induced cell death is known to be mediated by Bax activation, which is caused by mitochondrial dysfunction. However, little data is available regarding the regulation of survival signaling pathways and their downstream events that lead to Bax activation. Thus, in the present study, we aimed to investigate the effect of ethanol on survival signaling pathways and their downstream events that lead to cell death in the rat brain during the brain developmental period. Ethanol (3 g/kg, 20% in saline) was administered subcutaneously to post-natal 7-day-old rat pups twice at 2-h intervals and the pups were sacrificed at 4 h following the first ethanol injection. Ethanol treatment suppressed the activation of survival kinases, particularly Akt, Erk1/2 and PKAalpha, whereas it increased the activation of JNK. Moreover, dissociation of dephosphorylated Bad from 14-3-3 and the interaction of activated JNK with Bcl-2 were elevated by ethanol treatment. The present study demonstrated that ethanol treatment during the brain developmental period induced mitochondrial dysfunction, which led to cell death by the suppression of survival kinases, Bad release from 14-3-3 and inactivation of Bcl-2 by activated JNK.

14-3-3 Proteins↗
PubMed2005

Age-associated increases in oxidative stress and antioxidant enzyme activities in cardiac interfibrillar mitochondria: implications for the mitochondrial theory of aging.

Mitochondrial dysfunction and the accumulation of oxidative damage to macromolecules are believed to play key roles in the aging process. Characterization of age-related changes to cardiac mitochondria has been complicated by the fact that two distinct populations of mitochondria exist in the myocardium: subsarcolemmal mitochondria (SSM) and interfibrillar mitochondria (IFM). We investigated whether differences in hydrogen peroxide production (H2O2) and oxidative stress existed between cardiac SSM and IFM isolated from young (6 mo) and old (24 mo) male Fischer-344 rats. There was a significant increase in oxidative stress levels (4-hydroxy-2-nonenal-modified proteins, protein carbonyls, and malondialdehyde) in IFM with age. In contrast, only protein carbonyls were elevated in SSM with age. Significant age-related increases in MnSOD, GPX, and CAT activities were detected in IFM, while in SSM, MnSOD, and GPX activities increased with age and CAT activity declined. These increases in antioxidant enzyme activity likely occurred in response to increased mitochondrial production of superoxide and hydrogen peroxide. Indeed, SSM produced more H2O2 with age, while the increase in IFM was not significant, but this may be due to the higher antioxidant enzyme activity observed in IFM compared with SSM. Finally, reduced glutathione levels were significantly lower in IFM compared with SSM in both young and old rats, while glutathione reductase activity was not different with age or mitochondrial subpopulations, indicating increased consumption of glutathione. The accumulation of oxidant-induced damage in IFM may be a major contributing factor to the age-related alterations in myocardial function. Our results emphasize the importance of studying both mitochondrial populations when attempting to elucidate the contribution of mitochondrial dysfunction to myocardial aging.

Aging↗
PubMed1998

Thiol oxidation and loss of mitochondrial complex I precede excitatory amino acid-mediated neurodegeneration.

Human ingestion of "chickling peas" from the plant Lathyrus sativus, which contains an excitatory amino acid, L-BOAA (L-beta-N-oxalylamino-L-alanine), leads to a progressive corticospinal neurodegenerative disorder, neurolathyrism. Exposure to L-BOAA, but not its optical enantiomer D-BOAA, causes mitochondrial dysfunction as evidenced by loss of complex I activity in vitro in male mouse brain slices and in vivo in selected regions of mouse CNS (lumbosacral cord and motor cortex). Loss of complex I activity in lumbosacral cord after L-BOAA administration to mice was accompanied by concurrent loss of glutathione. The inhibited complex I activity in mitochondria isolated from lumbosacral cord of animals treated with L-BOAA rebounded after incubation with the thiol-reducing agent dithiothreitol, indicating that oxidation of protein thiols to disulfides was responsible for enzyme inhibition. The inhibition of complex I could be abolished by pretreatment with antioxidant thiols such as glutathione ester and alpha-lipoic acid. Chronic treatment of male mice, but not female mice, with L-BOAA resulted in loss of complex I activity and vacuolation and dendritic swelling of neurons in the motor cortex and lumbar cord, paralleling the regionality of the aforementioned biochemical effects on CNS mitochondria. These results support the view that thiol oxidation and concomitant mitochondrial dysfunction (also implicated in other neurodegenerative disorders), occurring downstream of glutamate receptor activation by L-BOAA, are primary events leading to neurodegeneration. Maintenance of protein thiol homeostasis by thiol delivery agents could potentially offer protection against excitotoxic insults such as those seen with L-BOAA.

Amino Acids, Diamino↗
PubMedDate not supplied

Induction of cytotoxicity and apoptosis and inhibition of cyclooxygenase-2 gene expression by eugenol-related compounds.

Induction of cytotoxicity and internucleosomal DNA fragmentation by 4-allyl-2-methoxyphenol (eugenol, EUG), 2-methoxy-4-methylphenol (MMP), 3,3'-dimethoxy-5,5'-di-2-propenyl-1,1'-biphenyl-2,2'-diol (bis-EUG) and 3,3'-di-methoxy-5,5'-dimethyl-1,1'-biphenyl-2,2'-diol (bis-MMP) were investigated in HL-60 leukemia cells. The 50% cytotoxic concentrations (CC50) for EUG, MMP, bis-EUG and bis-MMP were 0.38 mM, 0.38 mM, 0.18 mM and 0.20 mM, respectively. DNA fragmentation was induced most strongly by bis-EUG, followed by EUG, MMP and bis-MMP. The expression of MnSOD and, less strongly, Cu/ZnSOD activity, as assessed by acrylamide gel electrophoresis, was inhibited by EUG, suggesting mitochondrial dysfunction. The expression of the mRNAs for MnSOD and Cu/ZnSOD in HL-60 cells, as assessed by RT-PCR, was significantly inhibited by treatment with 1 mM EUG for 1 hour. Furthermore, inhibition of SOD mRNAs expression by EUG was strongly potentiated by the addition of 5 mM N-acetyl cysteine (NAC) or glutathione (GSH), whereas NAC or GSH alone did not affect the expression of SOD mRNAs. The cytotoxicity of EUG was significantly enhanced by high concentrations of NAC or GSH, which may be attributed to the inhibition of SOD mRNAs expression by the synergistic action of EUG and GSH or NAC. The regulatory effects of eugenol-related compounds on lipopolysaccharide (LPS)-induced cyclooxygenase-2 (COX-2) gene expression in RAW 264.7 cells were investigated by Northern blot analysis. Bis-EUG, MMP and bis-MMP inhibited COX-2 gene expression at concentrations of 300 microM, 500 microM and 500 microM, respectively. In contrast, no inhibitory effect of EUG was found over the wide concentration range of 10-500 microM, possibly as a result of the extensive mitochondrial dysfunction induced by this compound, which possesses potent pro-oxidative activity. Eugenol-related compounds, particularly bis-EUG, may act as nonsteroidal anti-inflammatory drug (NSAID)-like compounds.

Animals↗
PubMed2003

Reduced oxidative power but unchanged antioxidative capacity in skeletal muscle from aged humans.

The hypothesis that the aging process is associated with mitochondrial dysfunction and oxidative stress has been investigated in human skeletal muscle. Muscle biopsy samples were taken from seven old male subjects [OS; 75 (range 61-86) years] and eight young male subjects [YS; 25 (22-31) years]. Oxidative function was measured both in permeabilised muscle fibres and isolated mitochondria. Despite matching the degree of physical activity, OS had a lower training status than YS as judged from pulmonary maximal O(2) consumption ( Vdot;O(2)max, -36%) and handgrip strength (-20%). Both maximal respiration and creatine-stimulated respiration were reduced in muscle fibres from OS (-32 and -34%, respectively). In contrast, respiration in isolated mitochondria was similar in OS and YS. The discrepancy might be explained by a biased harvest of "healthy" mitochondria and/or disruption of structural components during the process of isolation. Cytochrome C oxidase was reduced (-40%, P<0.01), whereas UCP3 protein tended to be elevated in OS ( P=0.09). Generation of reactive oxygen species by isolated mitochondria and measures of antioxidative defence (muscle content of glutathione, glutathione redox status, antioxidative enzymes activity) were not significantly different between OS and YS. It is concluded that aging is associated with mitochondrial dysfunction, which appears to be unrelated to reduced physical activity. The hypothesis of increased oxidative stress in aged muscle could not be confirmed in this study.

Adult↗
PubMed2025

Targeting the bile acid receptor TGR5 with Gentiopicroside to activate Nrf2 antioxidant signaling and mitigate Parkinson's disease in an MPTP mouse model.

INTRODUCTION: Parkinson's disease (PD) is a common neurodegenerative disorder characterized by classical symptoms including bradykinesia, rest tremor and rigidity. Oxidative stress and mitochondrial dysfunction are recognized as pivotal factors in PD progression. Gentiopicroside (GPS), a secoiridoid derived from Gentiana manshurica Kitagawa, exhibits antioxidant and mitophagy induction properties. Nonetheless, the effects and mechanisms by which GPS mitigates neurodegeneration in PD remain to be thoroughly elucidated. OBJECTIVES: The goal of this study was to investigate the neuroprotective effects and mechanisms of GPS in PD models. METHODS: We established the MPTP/MPP+-induced PD models to measure the neuroprotection of GPS. Transcriptomic analysis, oxidative biochemical kits, western blot and cell immunofluorescence were conducted to elucidate the fundamental mechanisms at play. Subsequently, the targeting and activation of the transmembrane G protein-coupled receptor-5 (TGR5) by GPS were measured by molecular docking, cellular thermal shift assay, microscale thermophoresis (MST) and cyclic adenosine monophosphate (cAMP) quantitation. Finally, we verified whether the neuroprotective and antioxidant effects of GPS were dependent on TGR5 by using specific small interfering RNA (siRNA), pharmacological antagonist and knockout mice. RESULTS: GPS significantly attenuated dopaminergic (DAergic) neuron loss and restored motor function in the MPTP-induced PD mouse model. Whole-genome RNA sequencing and subsequent mechanistic investigations revealed that GPS enhanced the expression and facilitated nuclear entry of factor erythroid-related 2-factor 2 (Nrf2), and reduced oxidative stress and mitochondrial dysfunction stimulated by neurotoxin. Additionally, GPS could target TGR5 and prevent its downregulation in PD model. TGR5's silencing or inhibition weakened the neuroprotective effect of GPS and blocked GPS-mediated activation of Nrf2 antioxidant signaling in PD model. Moreover, the therapeutic effect of GPS in mitigating motor deficits and neurodegeneration was also abolished in Tgr5 knockout mice. CONCLUSION: These findings collectively indicated that GPS targeted TGR5 to activate Nrf2 antioxidant signaling and ultimately ameliorated the pathological progression of PD.

Animals↗
PubMed1996

Hemoglobin oxygenation kinetics and secondary ischemia in renal transplantation.

The significance of poor medullary reperfusion in the etiology of acute tubular necrosis during renal transplantation is poorly understood. Our objective was to determine the kinetics of renal hemoglobin oxygenation using near-infrared spectroscopy during renal transplantation, to provide a framework against which the timing of mitochondrial dysfunction could be considered. New Zealand White rabbit kidneys were flushed with hypertonic citrate solution (0-2 degrees C and autografted immediately (group 1) or stored at 0-2 degrees C for 72 hours before autografting (group 2). Changes in oxyhemoglobin (HbO2) and deoxyhemoglobin (Hb) were monitored by near-infrared spectroscopy for 3 hours of reperfusion. Intrarenal perfusion was evaluated separately by barium sulfate angiography. Reperfusion resulted in rapid increases in HbO2 within 1 minute in both groups. Group 1 HbO2 fell sharply to a minimum at 3 minutes but recovered by 20 minutes; group 2 changes were similar, but there was no recovery (P<0.05 by 10 minutes). Hb increased rapidly in both groups upon reperfusion but in group 2 was significantly greater after 10 minutes (P<0.05). Total hemoglobin levels were similar in both groups. Renal hemoglobin saturation was 69% at 1 minute in both groups; there was no significant change in group 1 but a profound desaturation in group 2 to 25% at 10 minute (P<0.005) and no recovery thereafter. Barium sulfate distribution was normal in all group 1 kidneys; cortical distribution was normal in all group 2 kidneys, but medullary perfusion was poor for the first 60 minutes. Renal hemoglobin oxygenation kinetics as determined here do not correlate with the timing of mitochondrial dysfunction previously reported (Thorniley et al., Kidney International, 1994; 45: 1489). We conclude that secondary ischemia during reflow is not the only mechanism leading to acute tubular necrosis.

Animals↗
PubMed2001

Invited review: manganese superoxide dismutase in disease.

Manganese superoxide dismutase (MnSOD) is essential for life as dramatically illustrated by the neonatal lethality of mice that are deficient in MnSOD. In addition, mice expressing only 50% of the normal compliment of MnSOD demonstrate increased susceptibility to oxidative stress and severe mitochondrial dysfunction resulting from elevation of reactive oxygen species. Thus, it is important to know the status of both MnSOD protein levels and activity in order to assess its role as an important regulator of cell biology. Numerous studies have shown that MnSOD can be induced to protect against pro-oxidant insults resulting from cytokine treatment, ultraviolet light, irradiation, certain tumors, amyotrophic lateral sclerosis, and ischemia/reperfusion. In addition, overexpression of MnSOD has been shown to protect against pro-apoptotic stimuli as well as ischemic damage. Conversely, several studies have reported declines in MnSOD activity during diseases including cancer, aging, progeria, asthma, and transplant rejection. The precise biochemical/molecular mechanisms involved with this loss in activity are not well understood. Certainly, MnSOD gene expression or other defects could play a role in such inactivation. However, based on recent findings regarding the susceptibility of MnSOD to oxidative inactivation, it is equally likely that post-translational modification of MnSOD may account for the loss of activity. Our laboratory has recently demonstrated that MnSOD is tyrosine nitrated and inactivated during human kidney allograft rejection and human pancreatic ductal adenocarcinoma. We have determined that peroxynitrite (ONOO- ) is the only known biological oxidant competent to inactivate enzymatic activity, to nitrate critical tyrosine residues, and to induce dityrosine formation in MnSOD. Tyrosine nitration and inactivation of MnSOD would lead to increased levels of superoxide and concomitant increases in ONOO- within the mitochondria which, could lead to tyrosine nitration/oxidation of key mitochondrial proteins and ultimately mitochondrial dysfunction and cell death. This article assesses the important role of MnSOD activity in various pathological states in light of this potentially lethal positive feedback cycle involving oxidative inactivation.

Animals↗
PubMed2003

Oral choline decreases brain purine levels in lithium-treated subjects with rapid-cycling bipolar disorder: a double-blind trial using proton and lithium magnetic resonance spectroscopy.

OBJECTIVES: Oral choline administration has been reported to increase brain phosphatidylcholine levels. As phospholipid synthesis for maintaining membrane integrity in mammalian brain cells consumes approximately 10-15% of the total adenosine triphosphate (ATP) pool, an increased availability of brain choline may lead to an increase in ATP consumption. Given reports of genetic studies, which suggest mitochondrial dysfunction, and phosphorus (31P) magnetic resonance spectroscopy (MRS) studies, which report dysfunction in high-energy phosphate metabolism in patients with bipolar disorder, the current study is designed to evaluate the role of oral choline supplementation in modifying high-energy phosphate metabolism in subjects with bipolar disorder. METHODS: Eight lithium-treated patients with DSM-IV bipolar disorder, rapid cycling type were randomly assigned to 50 mg/kg/day of choline bitartrate or placebo for 12 weeks. Brain purine, choline and lithium levels were assessed using 1H- and 7Li-MRS. Patients received four to six MRS scans, at baseline and weeks 2, 3, 5, 8, 10 and 12 of treatment (n = 40 scans). Patients were assessed using the Clinical Global Impression Scale (CGIS), the Young Mania Rating Scale (YRMS) and the Hamilton Depression Rating Scale (HDRS) at each MRS scan. RESULTS: There were no significant differences in change-from-baseline measures of CGIS, YMRS, and HDRS, brain choline/creatine ratios, and brain lithium levels over a 12-week assessment period between the choline and placebo groups or within each group. However, the choline treatment group showed a significant decrease in purine metabolite ratios from baseline (purine/n-acetyl aspartate: coef = -0.08, z = -2.17, df = 22, p = 0.030; purine/choline: coef = -0.12, z = -1.97, df = 22, p = 0.049) compared to the placebo group, controlling for brain lithium level changes. Brain lithium level change was not a significant predictor of purine ratios. CONCLUSIONS: The current study reports that oral choline supplementation resulted in a significant decrease in brain purine levels over a 12-week treatment period in lithium-treated patients with DSM-IV bipolar disorder, rapid-cycling type, which may be related to the anti-manic effects of adjuvant choline. This result is consistent with mitochondrial dysfunction in bipolar disorder inadequately meeting the demand for increased ATP production as exogenous oral choline administration increases membrane phospholipid synthesis.

Administration, Oral↗
PubMed2004

Quantitative PCR analysis of mitochondrial DNA content in patients with mitochondrial disease.

Molecular diagnosis of mitochondrial DNA disorder is usually focused on point mutations and large deletions. In the absence of detectable mtDNA mutations, abnormal amounts of mtDNA, either depletion or elevation, can be indicative of mitochondrial dysfunction. The amount of mitochondrial DNA (mtDNA), however, varies among individuals of different ages and among different tissues within the same individual. To establish a range of mtDNA levels, we analyzed 300 muscle and 200 blood specimens from patients suspected of having a mitochondrial disorder by real-time quantitative polymerase chain reaction (PCR) method. Copy numbers were calculated from the standard curve and threshold cycle number using TaqMan probes; 6FAM 5'TTACCGGGCTCTGCCATCT3'-TAMRA and VIC-5'AGCAATAACAGGTCTGTGATG3'-TAMRA for mtDNA and 18S rRNA gene (nDNA), respectively. The copy number ratio of mtDNA to nDNA was used as a measure of mtDNA content in each specimen. The mtDNA content in muscle increases steadily from birth to about 5 years of age; thereafter, it stays about the same. On the contrary, the mtDNA content in blood decreases with age. The amount of mtDNA in skeletal muscle is about 5-20 times higher than that in blood. About 7% of patients had mtDNA levels in muscle below 20% of the mean of the age-matched group, and about 10% of patients had muscle mtDNA levels 2- to 16-fold higher than the mean of the age-matched group. Patients with abnormal levels of mtDNA, either depletion or proliferation, had significant clinical manifestations characteristic of mitochondrial disease in addition to abnormal respiratory enzymes and mitochondrial cytopathies. Cardiomyopathy, lactic acidosis, abnormal brain MRI findings, hypotonia, developmental delay, seizures, and failure to thrive are general clinical pictures of patients with mtDNA depletion. The average age of patients with mtDNA depletion is 4.1 years, compared to 23.6 years in patients with mtDNA proliferation. Mutations in nuclear genes involved in mtDNA synthesis and deoxynucleotide pools are probably the cause of mtDNA depletion. Our results demonstrate that real time quantitative PCR is a valuable tool for molecular screening of mitochondrial diseases.

Adult↗
PubMed2006

Successful heart failure therapy in mitochondrial disorder with noncompaction cardiomyopathy.

OBJECTIVE: Effective heart failure therapy with angiotensin-converting enzyme inhibitors and beta-blockers in a patient with mitochondrial disorder and asymptomatic previously stable hypertrophic cardiomyopathy and left ventricular noncompaction (NCCMP) has not been reported. CASE REPORT: In a 58-year-old male with juvenile seizures, impaired hearing, recurrent pancreatitis, diabetes, recurrent emesis and diarrhea, discrete weakness for hip flexion, general wasting, and reduced tendon reflexes, elevated muscle-enzymes, abnormal lactate-stress-test, and mitochondrial dysfunction on muscle biopsy, mitochondrial disorder was diagnosed at age 51 year. Echocardiography revealed myocardial thickening and NCCMP. Cardiac abnormalities did not progress upon repeated follow-ups. At age 57 year he developed acute heart failure during respiratory infection. Echocardiography additionally revealed reduced left ventricular systolic function, and a restrictive filling pattern. Within seven weeks of therapy with ramipril (2.5 mg/day) and bisoprolol (1.25 mg/day) the restrictive filling pattern disappeared and fractional shortening normalized. CONCLUSION: This case shows that heart failure in a patient with mitochondrial disorder and previously stable hypertrophic cardiomyopathy and NCCMP promptly resolves under therapy with angiotensin-converting enzyme inhibitors and beta-blockers.

Adrenergic beta-Antagonists↗
PubMed2006

Mitochondrial-nuclear cross-talk in the aging and failing heart.

HYPOTHESIS: Damage to heart mitochondrial structure and function occur with aging, and in heart failure (HF). However, the extent of mitochondrial dysfunction, the expression of mitochondrial and nuclear genes, and their cross-talk is not known. OBSERVATIONS: Several observations have suggested that somatic mutations in mitochondrial DNA (mtDNA), induced by reactive oxygen species (ROS), appear to be the primary cause of energy decline, and that the generation of ROS is mainly the product of the mitochondrial respiratory chain. The free radical theory of aging, that could also be applied to HF, and in particular the targeting of mtDNA is supported by a plurality of observations from both animal and clinical studies showing decreased mitochondrial function, increased ROS levels and mtDNA mutations in the aging heart. DISCUSSION: Aging and HF with their increased ROS-induced defects in mtDNA, including base modifications and frequency of mtDNA deletions, might be expected to cause increased errors or mutations in mtDNA-encoded enzyme subunits, resulting in impaired oxidative phosphorylation and defective electron transport chain (ETC) activity which in turn creates more ROS. These events in both the aging and failing heart involve substantial nuclear-mitochondrial interaction, which is further illustrated in the progression of myocardial apoptosis. In this review the cross-talk between the nucleus and the mitochondrial organelle will be examined based on a number of animal and clinical studies, including our own.

Aging↗
PubMed1995

Electrophysiological exploration of visual function in mitochondrial diseases.

In a group of 10 children (ranging from 5 months to 15 years old) affected by diseases with mitochondrial dysfunction, 4 suffered from mitochondrial myopathy, 4 from mitochondrial encephalopathy and 2 from Friedreich's ataxia. The clinically detectable visual impairment consisted of 3 grey ocular fundi (the other 7 were normal) associated, in 2 subjects, with a mild nystagmus. Electrophysiological assessment, consisting of ERGs and flash VEPs, was systematically performed. The normal ERGs in all subjects confirmed the normal functioning of retinal electrogenesis. In contrast, the VEPs of 6 out of 10 subjects were modified: in 2 of the 4 subjects with mitochondrial myopathy, the VEPs had a hyperamplitude; in the 2 subjects with Friedreich's ataxia, the implicit time of the principal VEP peaks was increased, together with a hyperamplitude in 1 case; lastly, in 2 of the 4 subjects with mitochondrial encephalopathy, the VEPs were altered. These modifications reflected visual pathway conduction disorders with no clinical expression. Various underlying pathophysiological mechanisms possibly responsible for these modifications are discussed.

Adolescent↗
PubMed2006

Preservation of mitochondrial structure and function after cardioplegic arrest in the neonate using a selective mitochondrial KATP channel opener.

BACKGROUND: Mitochondrial dysfunction may contribute to early postoperative neonatal heart dysfunction. Diazoxide, a mitochondrial-selective adenosine triphosphate-sensitive potassium-channel opener, is associated with mitochondrial preservation after cardioplegic arrest. We evaluated the mitochondrial-protective effect of diazoxide in terms of mitochondrial structure and function after neonatal cardioplegic arrest. METHODS: Newborn piglets (age, approximately 14 days) underwent cardiopulmonary bypass and 60 minutes of cardioplegic arrest using cold crystalloid cardioplegic solution (CCP, n = 5) or cold crystalloid cardioplegic solution with diazoxide (CCP+D, n = 5). After 6 hours of recovery, myocardium was harvested. Control myocardium from piglets that did not undergo cardiopulmonary bypass (non-CPB, n = 5) was obtained. RESULTS: Cardioplegic arrest was associated with translocation of Bax to the mitochondria, which was not prevented by diazoxide. Nevertheless, by electron microscopy, CCP-associated remodeling of mitochondrial structure was subjectively diminished in CCP+D hearts. In addition, CCP-associated mitochondrial permeabilization and cytochrome c release into the cytosol were prevented with CCP+D (p < 0.05). In vitro oxygen consumption of isolated mitochondria demonstrated deficient function of mitochondrial complex I in CCP, but it was preserved in the CCP+D myocardial mitochondria (p < 0.05). Complex II and IV activity was not different among groups. In parallel with impaired complex I function, the cardiac adenosine triphosphate content was diminished in CCP hearts, but well maintained in CCP+D hearts (p < 0.05). CONCLUSIONS: Although early apoptotic signaling events (Bax translocation) are not prevented by diazoxide, addition of the mitochondrial-selective adenosine triphosphate-sensitive potassium-channel opener to the cardioplegic solution is associated with protection of mitochondrial structural and functional integrity in a clinically relevant model of neonatal cardiac surgery. The mitochondrial-protective effects of diazoxide may contribute to improved postoperative myocardial function in the neonate.

Adenosine Triphosphate↗
PubMed2004

mTOR integrates amino acid- and energy-sensing pathways.

The AMP-activated protein kinase (AMPK) exists as a heterotrimetric complex comprising a catalytic alpha subunit and non-catalytic beta and gamma subunits. Under conditions of hypoxia, exercise, ischemia, heat shock, and low glucose, AMPK is activated allosterically by rising cellular AMP and by phosphorylation of the catalytic alpha subunit. The mammalian target of rapamycin (mTOR) controls cellular functions in response to amino acids and growth factors. Recent reports including our study have demonstrated the possible interplay between mTOR and AMPK signaling pathways, supporting a model in which mitochondrial dysfunction caused by the mitochondrial inhibitors or ATP depletion inhibits activation of p70 S6 kinase alpha (p70alpha), a downstream effector of mTOR, by activating AMPK. Leucine may stimulate p70alpha phosphorylation via mTOR pathway, in part, by serving both as a mitochondrial fuel through oxidative carboxylation and an allosteric activation of glutamate dehydrogenase. This hypothesis may support an idea in which leucine modulates mTOR function, in part by regulating mitochondrial function and AMPK. Further understanding of the role of mTOR in coordinating amino acid- and energy-sensing pathways would provide new insights into relationship between nutrients and cellular functions.

AMP-Activated Protein Kinases↗
PubMed2004

Role of the permeability transition pore in cytochrome C release from mitochondria during ischemia-reperfusion in rat liver.

Ischemia and reperfusion cause mitochondrial dysfunctions that initiate the mitochondrial apoptosis pathway. They involve the release of cytochrome C and the activation of the caspase cascade but the mechanism(s) leading to cytochrome C release is(are) poorly understood. The aim of this study was to analyse the relation between cytochrome C release and the opening of the permeability transition pore (PTP) during in situ liver ischemia and reperfusion. Liver ischemia was induced for 30, 60 and 120 min and blood re-flow was subsequently restored for 30 and 180 min. Ischemia hugely altered mitochondrial functions, i.e., oxidative phosphorylation and membrane potential, and was accompanied by a time-dependent mitochondrial release of cytochrome C into the cytosol and by activations of caspases-3 and -9. PTP opening was not observed during ischemia, as demonstrated by the absence of effect of an in vivo pre-treatment of rats with cyclosporin A (CsA), a potent PTP inhibitor. Cytochrome C release was due neither to a direct effect of caspases onto mitochondria nor to an interaction of Bax or Bid with the mitochondrial membrane but could be related to a direct effect of oxygen deprivation. In contrast, during reperfusion, CsA pre-treatment inhibits cytochrome C release, PTP opening and caspase activation. At this step, cytochrome C release is likely to occur as a consequence of PTP opening. In conclusion, our study reveals that cytochrome C release, and thus the induction of the mitochondrial cell death pathway, occur successively independently and dependent on PTP opening during liver ischemia and reperfusion, respectively.

Animals↗