Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Muscle development”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,153 records · Page 64Linked to original sources
PubMed2001

Smooth muscle tumor developing in an immunocompromised child after therapy for leukemia.

We report a 5.5-year-old boy who underwent autologous peripheral blood stem cell transplantation for high-risk acute lymphoblastic leukemia and who had two abdominal masses develop 6 months later. Macroscopically complete resection of the abdominal tumors was performed and revealed a well-differentiated leiomyosarcoma. Smooth muscle tumors, benign or malignant, are increasingly recognized in children with various immunodeficiencies; the association with acute lymphoblastic leukemia is rarely described.

Abdominal Neoplasms↗
PubMed1989

[Biochemical and histochemical study of type IIC muscle fiber].

Fiber type differentiation of human skeletal muscle starts at approximately 18-28 weeks of gestation, and normally completes at birth. Therefore type IIC muscle fibers are not visualized in the biopsied specimens except for some pathological conditions, such as Werdning-Hoffmann disease or Duchenne muscular dystrophy of which onsets are believed in the embryonal or neonatal period and some motor neuron disease. On the other hand in rat muscle fibers have not differentiated in the neonatal period, and most of them show reaction of type IIC muscle fiber. When we study the specificity of type IIC fiber, rat is the most useful animal. The present study aimed biochemical and histochemical analysis of type IIC fiber in soleus, gastrocnemius and extensor digitorum longus (EDL) at neonatal period, 10 days, 3 weeks, 4 weeks and adult. The ratios triglyceride to total protein were in soleus 0.038 (neonatal), 0.252 (10 days), 0.239 (3 weeks), 0.229 (4 weeks) and 0.145 (adults), in gastrocnemius 0.054, 0.241, 0.118, 0.077, and 0.078, in EDL 0.026, 0.094, 0.071, 0.071 and 0.071. Whereas, the ratios glycogen to total protein were in soleus 0.024 (neonatal), 0.017 (10 days), 0.22 (adults), in gastrocnemius 0.054, 0.025, 0.022, and in EDL 0.016, 0.011, 0.014. Also there was significant difference in the fatty acid composition of triglyceride between neonatal and 10 days in each muscle. These results suggested that the energy metabolism in neonatal muscle depends on anaerobic glycolysis rather than the oxidative phosphorylation and also suggested that, though histochemical characteristics remain the same, biochemical properties change during the course of muscle development.

Animals↗
PubMed1993

Identification of a thyroid hormone response element in the mouse myogenin gene: characterization of the thyroid hormone and retinoid X receptor heterodimeric binding site.

Thyroid hormones are positive regulators of muscle development in vivo. Triiodo-L-thyronine (T3) treatment of myogenic cell lines results in the precocious expression of myogenin, a muscle specific, helix-loop-helix factor that can trans-activate muscle specific gene expression (G. Carnac et al., Mol. Endocrinol., 6: 1185-1194, 1992). We have identified a T3 response element (TRE) in the mouse myogenin (MM) promoter between nucleotide positions -526 and -494 (5' GTGGTAGGTCTTTAGGGGTCTCATGGGACTGACA 3'). This sequence conferred appropriate hormonal regulation to an enhancerless SV40 promoter. Electrophoretic mobility shift analysis experiments showed that thyroid hormone receptor alpha (TR alpha) and retinoid X receptor alpha (RXR alpha) formed a heterodimeric complex on the MM TRE that was specifically competed by classical TREs and not by other response elements. Analyses of this heterodimer with a battery of steroid hormone response elements indicated that the complex was efficiently competed by a direct repeat of the AGGTCA motif separated by 4 nucleotides, as predicted by the 3-4-5 rule. Electrophoretic mobility shift analysis experiments showed that the myogenin, growth hormone, and myosin heavy chain TREs interacted with an identical nuclear factor(s) in muscle cells that was constitutively expressed during myogenesis. Mutagenesis of the MM TRE indicated that the sequence of the direct repeats (AGGTCA) and the 4-nucleotide gap were necessary for efficient binding to the TR alpha/RXR alpha heterodimeric complex. In conclusion, our data suggest that the MM TRE is a target for direct cross-talk between two different hormonal signals (T3 and 9-cis-retinoic acid) at the receptor level.(ABSTRACT TRUNCATED AT 250 WORDS)

Animals↗
PubMed2005

Myostatin: a modulator of skeletal-muscle stem cells.

Myostatin, or GDF-8 (growth and differentiation factor-8), was first identified through sequence identity with members of the BMP (bone morphogenetic protein)/TGF-beta (transforming growth factor-beta) superfamily. The skeletal-muscle-specific expression pattern of myostatin suggested a role in muscle development. Mice with a targeted deletion of the myostatin gene exhibit a hypermuscular phenotype. In addition, inactivating mutations in the myostatin gene have been identified in 'double muscled' cattle breeds, such as the Belgian Blue and Piedmontese, as well as in a hypermuscular child. These findings define myostatin as a negative regulator of skeletal-muscle development. Myostatin binds with high affinity to the receptor serine threonine kinase ActRIIB (activin type IIB receptor), which initiates signalling through a smad2/3-dependent pathway. In an effort to validate myostatin as a therapeutic target in a post-embryonic setting, a neutralizing antibody was developed by screening for inhibition of myostatin binding to ActRIIB. Administration of this antimyostatin antibody to adult mice resulted in a significant increase in both muscle mass and functional strength. Importantly, similar results were obtained in a murine model of muscular dystrophy, the mdx mouse. Unlike the myostatin-deficient animals, which exhibit both muscle hypertrophy and hyperplasia, the antibody-treated mice demonstrate increased musculature through a hypertrophic mechanism. These results validate myostatin inhibition as a therapeutic approach to muscle wasting diseases such as muscular dystrophy, sarcopenic frailty of the elderly and amylotrophic lateral sclerosis.

Animals↗
PubMed1977

Factors in delayed muscle soreness.

The possible causes of delayed muscle soreness which occur 24 to 48 hr after exercise were examined from three different approaches, each designed to test an existing hypothesis. Surface electromyograms were used to evaluate the muscle spasm theory; the possibility of actual muscle cell damage was monitored by the presence of myoglobinuria, while the ratio of hydroxyproline/creatinine (OHP/Cr) in 24 hr urine collection was used as a marker for connective tissue involvement. In the first study, although all volunteers developed muscle soreness 24 and 48 hr after exercise, no change in the EMG activity of the sore muscles was observed. Myoglobin excretion was found in 88% of the subjects who developed soreness. However, in a second study, 92% of the subject who performed both moderate and heavy exercise but did not develop muscle soreness had myoglobinuria. In contrast, during a third experiment subjects on gelatin-free diets showed an increase (P less than .1) in the OHP/Cr between control (.020+/-.001) and 48 hr post-exercise (.002+/-.001, X+/-SE). Soreness resulted in all cases. When the OHP/Cr value is taken for the day of maximal soreness, the post-exercise mean increases to .024+/-.001 and the level of significance rises (P less than .005). These observations support the concept that exercise induced soreness may be related to disruption of the connective tissue elements in the muscle and/or their attachments.

Adult↗
PubMed2005

How to build a myofibril.

Building a myofibril from its component proteins requires the interactions of many different proteins in a process whose details are not understood. Several models have been proposed to provide a framework for understanding the increasing data on new myofibrillar proteins and their localizations during muscle development. In this article we discuss four current models that seek to explain how the assembly occurs in vertebrate cross-striated muscles. The models hypothesize: (a) stress fiber-like structures as templates for the assembly of myofibrils, (b) assembly in which the actin filaments and Z-bands form subunits independently from A-band subunits, with the two subsequently joined together to form a myofibril, (c) premyofibrils as precursors of myofibrils, or (d) assembly occurring without any intermediary structures. The premyofibril model, proposed by the authors, is discussed in more detail as it could explain myofibrillogenesis under a variety of different conditions: in ovo, in explants, and in tissue culture studies on cardiac and skeletal muscles.

Actinin↗
PubMed1999

Muscle growth and development in normal-sex-ratio and all-female diploid and triploid Atlantic salmon.

Muscle development and growth were investigated in diploid populations of normal-sex-ratio and all-female Atlantic salmon (Salmo salar L.) and their triploid counterparts produced by high-pressure treatment. Somites were formed at the rate of 6 h-1 in both diploids and triploids at 6 degrees C. The rostral-to-caudal development of myotubes, myofibrils and acetylcholinesterase staining at the myosepta was slightly more advanced in triploid than in diploid fish, although the differences were smaller than among individual families. The c-met receptor tyrosine kinase was used as a molecular marker for the satellite cells involved in postembryonic muscle growth. Satellite cell nuclei comprised 17.5 % of total myonuclei in smolts and they were 24 % more abundant in diploid than in triploid fish. Cells expressing the myogenic regulatory factor myf-6, a marker of satellite cells committed to differentiation, represented 14.8 % of total myonuclei in diploids and 12.5 % in triploids. At ambient temperatures, the number of white muscle fibres in normal-sex-ratio fish increased more than 30-fold between the alevin and smolt stages, and approximately 3.5-fold further during the first year of seawater growth. The rate of muscle fibre recruitment in seawater stages was significantly greater in diploid than in triploid fish, reaching 1162 fibres day-1 and 608 fibres day-1, respectively, in all-female groups 800 days post-hatching. For 42 cm fork-length fish, there were approximately one-third more muscle fibres per myotome in diploid than in triploid groups, 649 878 and 413 619, respectively, for all-female fish. The probability density function of muscle fibre diameters in each fish was estimated using non-parametric smoothing techniques, and the mean densities for diploids (fD) and triploids (fT) were calculated. The peak fibre diameter was approximately 20 (micro)m in all age classes, irrespective of ploidy. Distinct bimodal distributions of muscle fibre diameter were evident in all groups 775 days and 839 days post-hatching, reflecting seasonal cycles of fibre recruitment. fD and fT were compared using a non-parametric bootstrap technique and the reference band representing the null-hypothesis indicated that there was no difference with ploidy. Reference bands for normal-sex-ratio fish at 315 days and 470 days indicated that diploids had a higher percentage of smaller-diameter fibres and that triploid distributions had a thicker right-hand tail. Similar differences in fD and fT of muscle fibre diameters were found for all-female fish, although the statistical evidence was less strong. Reference bands indicated differences in the middle range of the distributions of muscle fibre diameter in fish 620-775 days post-hatch, with triploids having a thicker right-hand tail. Thus, a lower density of satellite cells was associated with reduced rates of fibre recruitment but a compensatory increase in muscle fibre hypertrophy in triploid compared with diploid fish.

Animals↗
PubMed1980

Length-tension relation in Limulus striated muscle.

Laser diffraction techniques coupled with simultaneous tension measurements were used to determine the length-tension relation in intact, small (0.5-mm thick, 10-mm wide, 20-25-mm long) bundles of a Limulus (horseshoe crab) striated muscle, the telson levator muscle. This muscle differs from the model vertebrate systems in that the thick filaments are not of a constant length, but shorten from 4.9 to approximately 2.0 micrometers as the sarcomeres shorten from 7 to 3 micrometers. In the Limulus muscle, the length-tension relation plateaued to an average maximum tension of 0.34 N/mm2 at a sarcomere length of 6.5 micrometers (Lo) to 8.0 micrometers. In the sarcomere length range from 3.8 to 12.5 micrometers, the muscle developed 50% or more of the maximum tension. When the sarcomere lengths are normalized (expressed as L/Lo) and the Limulus data are compared to those from frog muscle, it is apparent that Limulus muscle develops tension over a relatively greater range of sarcomere lengths.

Animals↗
PubMed1992

An appraisal of body image among Nigerian university students.

This study was designed to provide baseline data on the attitudes of Nigerian university students toward their own bodies. 286 students completed the 25-item version of the Body Cathexis Scale of Berscheid, et al. These students were more satisfied than they were dissatisfied with their body parts. The body weight and general muscle development were aspects with which they were most dissatisfied. Compared to men, women were significantly more satisfied with their ears, body weight, general muscle development, chest/breast, size of sex organs, and appearance of sex organs. These baseline data may help screen Nigerian university students with negative body ideation.

Adolescent↗
PubMedDate not supplied

[Use of electric stimulation to prevent the development of muscle changes during hypokinesia].

An attempt was made to use electric stimulation of antigravity muscles of hind limbs of rats exposed to a 15 and 30 day hypokinesia as a method for preventing structural and metabolic disorders that develop in the muscular tissue during a diminished motor activity. The electric stimulation was carried out using the Bion device with a frequency-amplitude modulation. The impulses of an amplitude of 0.7-1 msec and a frequency of 100 to 130 Hz were modulated with a frequency of 0.5 Hz. During the first experimental days the electric stimulation was 5 to 7 min and by the end of the first week it reached 30 min. Throughout the first week the voltage grew from 6-7 to 20 V. Electric stimulation was applied 5 times a week. The favourable effect of the electric stimulation was demonstrated in 4 out of 12 animals during every experimental run. It is suggested that a higher percentage of the protective effect of the method can be achieved with the stimulation ensuring a more intensive influence on the deeply located muscles.

Adenosine Triphosphatases↗
PubMed2006

Notch pathway repression by vestigial is required to promote indirect flight muscle differentiation in Drosophila melanogaster.

Drosophila dorsal longitudinal muscles develop during metamorphosis by fusion of myoblasts with larval templates. It has been shown that both vestigial and Notch are crucial for correct formation of these muscles. We investigated the relationship between vestigial and the Notch pathway during this process. Using Enhancer of Split Region Transcript m6 gene expression as a reporter of Notch pathway activity, we were able to demonstrate that this pathway is only active in myoblasts. Moreover, close examination of the cellular location of several of the main actors of the N pathway (Notch, Delta, neuralized, Serrate, Mind bomb1 and fringe) during dorsal longitudinal muscle development enabled us to find that Notch receptor can play multiple roles in adult myogenesis. We report that the locations of the two Notch ligands (Delta and Serrate) are different. Interestingly, we found that fringe, which encodes a glycosyltransferase that modifies the affinity of the Notch receptor for its ligands, is expressed in muscle fibers and in a subset of myoblasts. In addition, we demonstrate that fringe expression is essential for Notch pathway inhibition and muscle differentiation. Lastly, we report that, in vestigial mutants, fringe expression is lost, and when fringe is overexpressed, a significant rescue of indirect flight muscle degeneration is obtained. Altogether, our data show that a vestigial-differentiating function is achieved through the inhibition of the Notch pathway.

Animals↗
PubMed1994

Expression of M-cadherin protein in myogenic cells during prenatal mouse development and differentiation of embryonic stem cells in culture.

Molecules regulating morphogenesis by cell-cell interactions are the cadherins, a class of calcium-dependent adhesion molecules. One of its members, M-cadherin, has been isolated from a myoblast cell line (Donalies et al. [1991] Proc. Natl. Acad. Sci. U.S.A. 88:8024-8028). In mouse development, expression of M-cadherin mRNA first appears at day 8.5 of gestation (E8.5) in somites and has been postulated to be down-regulated in developing muscle masses (Moore and Walsh [1993] Development 117:1409-1420). Affinity-purified polyclonal M-cadherin antibodies, detecting a protein of approximately 120 kDa, were used to study the cell expression pattern of M-cadherin protein. It was first visualized in somites at E10 1/3 and could be confined to desmin positive, myotomal cells. At all subsequent prenatal stages, M-cadherin was only found in myogenic cells of somitic origin. The detection of the protein at E10 1/3 suggests a translational delay of M-cadherin mRNA of 1 to 2 days (E8.5 vs. E10 1/3). This was further supported by the finding that during differentiation of ES cell line BLC6 into skeletal muscle cells in culture, expression of M-cadherin mRNA can be detected 2 days prior to M-cadherin protein. During prenatal development, the pattern of M-cadherin expression changes: In E10 1/3 embryos and also in myotomal cells of later stages, M-cadherin is evenly distributed on the cell surface. In developing muscle masses (tested at E16 to E18), however, M-cadherin protein becomes clustered most likely at sites of cell-cell contact as indicated by double-labelling experiments: M-cadherin-staining is the positive image of laminin negative areas excluding the presence of a basal lamina at M-cadherin positive sites. Furthermore, M-cadherin is coexpressed with the neuronal cell adhesion molecule N-CAM which has been shown to mediate cell-cell contact in myogenic cells. In summary, our results are in line with the idea that M-cadherin might play a central role in myogenic morphogenesis.

Amino Acid Sequence↗
PubMed1995

Electrical activity and calcium influx regulate ion channel development in embryonic Xenopus skeletal muscle.

The development of electrical excitability involves complex coordinated changes in ion channel activity. Part of this coordination appears to be due to the fact that the expression of some channels is dependent on electrical activity mediated by other channel types. For example, we have previously shown that normal potassium current development in embryonic skeletal muscle cells of the frog Xenopus laevis is dependent on sodium channel activity. To examine the interrelationships between the development of different ionic currents, we have made a detailed study of electrical development in cultured Xenopus myocytes using whole-cell patch-clamp recording. The initial expression of potassium, sodium, and calcium currents is followed by a brief period during which the densities of potassium currents decrease, while at the same time sodium and calcium current densities continue to increase, which may increase electrical excitability during this time. The normal developmental increase in both potassium and sodium currents is inhibited by the sodium channel blocker tetrodotoxin, suggesting that electrical activity normally stimulates the expression of both these currents. These effects of electrical activity appear to be mediated via activation of voltage-gated calcium channels. We suggest that the developmental acquisition of sodium and calcium channels by these cells, possibly coupled with a transient decrease in potassium current density, lead to an increase in electrical excitability and calcium entry, and that this calcium entry provides a critical developmental cue controlling the subsequent development of mature electrical properties.

Animals↗
PubMed1996

Cloning of a trout fast skeletal myosin heavy chain expressed both in embryo and adult muscles and in myotubes neoformed in vitro.

In fish, little is known about the isoforms of myosin heavy chain in developing muscle. Two cDNA libraries from whole skeletal muscle of embryo (eyed stage) (A) and from white muscle of 300 g body weight immature trout (B) were constructed. Three cDNA clones were isolated and characterised as encoding for a fast skeletal myosin heavy chain. Two cDNA clones A1 (1534 bp) and B6 (2203 bp) which were extracted from the two different libraries had the same nucleotide sequence including the 3' untranslated region. The third cDNA B8 (1606 bp) shared 98% identity with the others. The latter could possibly be an allelic isoform of the B6. Northern blot analysis revealed that the fast skeletal MyoHC transcripts were expressed throughout development from myotube appearance to the white muscle present at older stages (adult). These results suggest that this myosin heavy chain is present throughout muscle development in fish and are consistent with the hyperplastic growth of fish muscle. The amino acid sequence of the trout myosin heavy chain diverged from its mammalian and avain counterpart with respect to a higher level of glycine which could be related to an environmental adaptation by increasing thermal instability of the molecule.

Amino Acid Sequence↗
PubMed1996

Myosin isoform transitions in four rabbit muscles during postnatal growth.

Four rabbit muscles (i.e. semimembranosus proprius, psoas major, biceps femoris and longissimus lumborum), differing in their fibre type composition in the adult, were investigated during postnatal development. Muscle samples were taken at 1, 7, 14, 21, 28, 35, 49 and 77 days of age. Complementary techniques were used to characterize myosin heavy chain (MHC) isoform transitions, i.e. SDS-PAGE, immunocytochemistry and conventional histochemistry. Good accordance was found between electrophoretic and immunocytochemical techniques. Our results show that rabbit muscles were phenotypically immature at birth. At 1 day of age, perinatal isoform represented 70-90% of the total isoform content of the muscles. Two generations of myofibres could be observed on the basis of their morphology and reaction to specific antibodies. In all muscles, primary fibres expressed slow MHC. In contrast, secondary generation of fibres never expressed slow MHC in future fast muscles, while half of them expressed slow MHC in the future slow-twitch muscle, the semimembranosus proprius. During the postnatal period, all muscles displayed a transition from embryonic to perinatal MHC isoforms, followed by a transition from perinatal to adult MHC isoforms. These transitions occured mainly during the first postnatal month. The embryonic isoform was no longer expressed after 14 days, except in longissimus where it disappeared after 28 days. On the contrary, large differences were found in the timing of disappearance of the perinatal isoform between the four muscles. The perinatal isoform disappeared between 28 and 35 days in semimembranosus proprius and 35 and 49 days in psoas and biceps femoris. Interestingly, the perinatal isoform was still present in 6% of the fibres in longissimus at 77 days, the commercial slaughter age, denoting a great delay in the maturation. Fate of each generation of fibres differed between muscles.

Aging↗