Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Elements”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,153 records · Page 64Linked to original sources
PubMed1994

Integration of a vector containing a repetitive LINE-1 element in the human genome.

Mammalian cells contain numerous nonallelic repeated sequences, such as multicopy genes, gene families, and repeated elements. One common feature of nonallelic repeated sequences is that they are homeologous (not perfectly identical). Our laboratory has been studying recombination between homeologous sequences by using LINE-1 (L1) elements as substrates. We showed previously that an exogenous L1 element could readily acquire endogenous L1 sequences by nonreciprocal homologous recombination. In the study presented here, we have investigated the propensity of exogenous L1 elements to be involved in a reciprocal process, namely, crossing-overs. This would result in the integration of the exogenous L1 element into an endogenous L1 element. Of over 400 distinct integration events analyzed, only 2% involved homologous recombination between exogenous and endogenous L1 elements. These homologous recombination events were imprecise, with the integrated vector being flanked by one homologous and one illegitimate junction. This type of structure is not consistent with classical crossing-overs that would result in two homologous junctions but rather is consistent with one-sided homologous recombination followed by illegitimate integration. Contrary to what has been found for reciprocal homologous integration, the degree of homology between the exogenous and endogenous L1 elements did not seem to play an important role in the choice of recombination partners. These results suggest that although exogenous and endogenous L1 elements are capable of homologous recombination, this seldom leads to crossing-overs. This observation could have implications for the stability of mammalian genomes.

Cell Line↗
PubMed2003

Transcription enhancer factor 1 binds multiple muscle MEF2 and A/T-rich elements during fast-to-slow skeletal muscle fiber type transitions.

In adult mouse skeletal muscle, beta-myosin heavy chain (betaMyHC) gene expression is primarily restricted to slow type I fibers; however, its expression can be induced in fast type II fibers in response to a sustained increase in load-bearing work (mechanical overload [MOV]). Our previous betaMyHC transgenic and protein-DNA interaction studies have identified an A/T-rich element (betaA/T-rich -269/-258) that is required for slow muscle expression and which potentiates MOV responsiveness of a 293-bp betaMyHC promoter (beta293wt). Despite the GATA/MEF2-like homology of this element, we found binding of two unknown proteins that were antigenically distinct from GATA and MEF2 isoforms. By using the betaA/T-rich element as bait in a yeast one-hybrid screen of an MOV-plantaris cDNA library, we identified nominal transcription enhancer factor 1 (NTEF-1) as the specific betaA/T-rich binding factor. Electrophoretic mobility shift assay analysis confirmed that NTEF-1 represents the enriched binding activity obtained only when the betaA/T-rich element is reacted with MOV-plantaris nuclear extract. Moreover, we show that TEF proteins bind MEF2 elements located in the control region of a select set of muscle genes. In transient-coexpression assays using mouse C2C12 myotubes, TEF proteins transcriptionally activated a 293-bp betaMyHC promoter devoid of any muscle CAT (MCAT) sites, as well as a minimal thymidine kinase promoter-luciferase reporter gene driven by three tandem copies of the desmin MEF2 or palindromic Mt elements or four tandem betaA/T-rich elements. These novel findings suggest that in addition to exerting a regulatory effect by binding MCAT elements, TEF proteins likely contribute to regulation of skeletal, cardiac, and smooth muscle gene networks by binding select A/T-rich and MEF2 elements under basal and hypertrophic conditions.

Animals↗
PubMed2003

Transcript-selective translational silencing by gamma interferon is directed by a novel structural element in the ceruloplasmin mRNA 3' untranslated region.

Transcript-selective translational control of eukaryotic gene expression is often directed by a structural element in the 3' untranslated region (3'-UTR) of the mRNA. In the case of ceruloplasmin (Cp), induced synthesis of the protein by gamma interferon (IFN-gamma) in U937 monocytic cells is halted by a delayed translational silencing mechanism requiring the binding of a cytosolic inhibitor to the Cp 3'-UTR. Silencing requires the essential elements of mRNA circularization, i.e., eukaryotic initiation factor 4G, poly(A)-binding protein, and poly(A) tail. We here determined the minimal silencing element in the Cp 3'-UTR by progressive deletions from both termini. A minimal, 29-nucleotide (nt) element was determined by gel shift assay to be sufficient for maximal binding of the IFN-gamma-activated inhibitor of translation (GAIT), an as-yet-unidentified protein or complex. The interaction was shown to be functional by an in vitro translation assay in which the GAIT element was used as a decoy to overcome translational silencing. Mutation analysis showed that the GAIT element contained a 5-nt terminal loop, a weak 3-bp helix, an asymmetric internal bulge, and a proximal 6-bp helical stem. Two invariant loop residues essential for binding activity were identified. Ligation of the GAIT element immediately downstream of a luciferase reporter conferred the translational silencing response to the heterologous transcript in vitro and in vivo; a construct containing a nonbinding, mutated GAIT element was ineffective. Translational silencing of Cp, and possibly other transcripts, mediated by the GAIT element may contribute to the resolution of the local inflammatory response following cytokine activation of macrophages.

3' Untranslated Regions↗
PubMed1989

The DAL7 promoter consists of multiple elements that cooperatively mediate regulation of the gene's expression.

Expression of the allantoin system genes in Saccharomyces cerevisiae is induced by allophanate or its analog, oxalurate. This work provides evidence for the involvement of distinct types of cis-acting elements in the induction process. The first element was found to have the properties of an upstream activation sequence (UAS). This element was localized to a 16-base-pair (bp) DNA fragment containing a short 5-bp sequence that occurred repeatedly in the upstream region of DAL7. When present in two or more copies, the 16-bp fragment supported high-level beta-galactosidase production in a CYC1-lacZ expression vector; there was, however, no response to the allantoin pathway inducer. The second element had the properties of a negatively acting element or upstream repression sequence (URS). This element was localized to a 16-bp DNA fragment containing an 8-bp sequence that was repeated four times in the upstream region of DAL7. A fragment containing the 8-bp repeated sequence placed adjacent to the UAS-containing fragment mediated inhibition of the ability of the UAS to support lacZ expression regardless of whether inducer was present. A third element, designated an upstream induction sequence (UIS), was required for response to inducer. The UIS was localized to a small DNA fragment containing an approximately 10-bp sequence that was repeated twice in the upstream region of DAL7. When a fragment containing the 10-bp repeated sequence was placed adjacent to these UAS and URS elements, the construction (UIS-UAS-URS) supported normal oxalurate-mediated induction of beta-galactosidase synthesis. These data are consistent with the suggestion that multiple, cis-acting elements participate in the induction process.

Allantoin↗
PubMed2006

Genome-wide analysis of core promoter elements from conserved human and mouse orthologous pairs.

BACKGROUND: The canonical core promoter elements consist of the TATA box, initiator (Inr), downstream core promoter element (DPE), TFIIB recognition element (BRE) and the newly-discovered motif 10 element (MTE). The motifs for these core promoter elements are highly degenerate, which tends to lead to a high false discovery rate when attempting to detect them in promoter sequences. RESULTS: In this study, we have performed the first analysis of these core promoter elements in orthologous mouse and human promoters with experimentally-supported transcription start sites. We have identified these various elements using a combination of positional weight matrices (PWMs) and the degree of conservation of orthologous mouse and human sequences--a procedure that significantly reduces the false positive rate of motif discovery. Our analysis of 9,010 orthologous mouse-human promoter pairs revealed two combinations of three-way synergistic effects, TATA-Inr-MTE and BRE-Inr-MTE. The former has previously been putatively identified in human, but the latter represents a novel synergistic relationship. CONCLUSION: Our results demonstrate that DNA sequence conservation can greatly improve the identification of functional core promoter elements in the human genome. The data also underscores the importance of synergistic occurrence of two or more core promoter elements. Furthermore, the sequence data and results presented here can help build better computational models for predicting the transcription start sites in the promoter regions, which remains one of the most challenging problems.

Animals↗
PubMed1995

Growth hormone and colony-stimulating factor 1 share multiple response elements in the c-fos promoter.

The c-fos protooncogene is induced by GH rapidly, but transiently. Induction requires C kinase activation and the serum response element, and recent binding studies have also implicated the sis-inducible element (SIE). However, no systematic study of the promoter elements responsible for transactivation by GH has been undertaken. Here we used Chinese hamster ovary K1 cells transiently cotransfected with rabbit GH receptor and c-fos promoter-luciferase constructs to demonstrate that the major region responsible for GH induction is located between 284-396 base pairs upstream of the transcription start site. Full induction by GH requires all of the known elements located in this region to be intact, including the SIE or signal transducer and activator of transcription binding element. We also report novel negative elements located around -216 upstream of the start site that reduce induction by GH and provide gel shift evidence for factors binding in this region. Cotransfection of Chinese hamster ovary K1 cells with c-fms and c-fos promoter constructs followed by the addition of CSF-1 revealed that these same c-fos elements contribute to transactivation by c-fms. Serum also uses the same elements to induce c-fos expression, except for the SIE. These results indicate that GH receptor and c-fms tyrosine kinase operate through multiple common response elements to regulate c-fos gene expression despite their structural differences.

Animals↗
PubMed1997

Role of basic-helix-loop-helix transcription factors in Sertoli cell differentiation: identification of an E-box response element in the transferrin promoter.

Sertoli cells are critical for testicular function and maintenance of the spermatogenic process. The induction of Sertoli cell differentiation in the embryo promotes testicular development and male sex determination. The progression of Sertoli cell differentiation during puberty promotes the onset of spermatogenesis. The maintenance of optimal Sertoli cell differentiation in the adult is required for spermatogenesis to proceed. The current study was designed to investigate the transcriptional regulation of Sertoli cell differentiation through the analysis of a previously identified marker of differentiation, transferrin gene expression. Sertoli cells produce transferrin to transport iron to developing spermatogenic cells sequestered within the blood-testis barrier. The transferrin promoter was characterized and found to contain two critical response elements, designated Sertoli element 1 (SE1) and Sertoli element 2 (SE2). Through sequence analysis, SE2 was found to contain an E-box response element, which has been shown to respond to basic-helix-loop-helix (bHLH) transcription factors. The bHLH proteins are a class of transcription factors associated with the induction and progression of cell differentiation. bHLH proteins dimerize through the conserved helix-loop-helix region and bind DNA through the basic region. Nuclear extracts from Sertoli cells were found to cause an E-box gel shift when the cells were stimulated to differentiate in culture, but not under basal conditions. The SE2 gel shift of Sertoli nuclear extracts was competed with excess unlabeled SE2 or E-box DNA fragments. Several Sertoli nuclear proteins associate with the SE2 gel shifts, including 70-, 42-, and 25-kDa proteins. Therefore, the critical SE2 element in the transferrin promoter is an E-box element capable of binding bHLH transcription factors. The ubiquitously expressed E12 bHLH protein dimerizes with numerous cell-specific bHLH factors. A Western blot analysis demonstrated that E12 was present in Sertoli cell nuclear extracts and associated with the SE2 gel shift. A ligand blot of Sertoli cell nuclear extracts with radiolabeled E12 had apparent bHLH proteins when the cells were stimulated to differentiate. The E-box sequence in the SE2 fragment of the transferrin promoter was CATCTG and was similar in gel shifts to the consensus E-box elements (CANNTG) previously characterized. A bHLH inhibitory factor (Id) competed and inhibited formation of the Sertoli cell nuclear extract E-box gel shift. To extend this observation, Id protein was overexpressed in cultured Sertoli cells. A transferrin promoter chloramphenicol acetyltransferase construct was used to monitor Sertoli cell function. The presence of Id suppressed the activation of the promoter induced by Sertoli differentiation factors. Therefore, the inhibition of Sertoli bHLH factors by Id suppressed Sertoli cell differentiated function, as measured by transferrin expression. An E-box-chloramphenicol acetyltransferase construct was also found to be active in Sertoli cells when cells were induced to differentiate. Screening the computerized nucleotide data bases demonstrated that putative E-box response elements are present in the promoters of a large number of Sertoli cell differentiated genes. In summary, a critical E-box response element has been identified in the transferrin promoter that can be activated by bHLH factors (e.g. E12) present in Sertoli cells. Inhibition of Sertoli bHLH factors by Id suppresses Sertoli cell differentiated function (i.e. transferrin expression), suggesting that bHLH transcription factors may be important in regulating Sertoli cell differentiated functions.

Animals↗
PubMed2001

The POU homeodomain protein Oct-1 binds Cis-regulatory element essential for the human GnRH upstream promoter activity in JEG-3 cells.

In previous studies, we have localized four specific nuclear protein-binding elements in the human GnRH upstream promoter. To test whether these four elements are reproductive tissue specific, we placed the four elements upstream to a thymidine kinase (TK) promoter/luciferase reporter gene, and transfected the constructs into human placental choriocarcinoma (JEG-3) cells. The 272-bp fragment (-994 to -723) containing the four elements can drive heterologous TK promoter expression in JEG-3 cells about 15 times more than that of basal TK promoter activity. Deletion of element 4 (E4, -987/-968) significantly decreased (4-fold) the luciferase activity. Further deletion of the other elements (E3 individual, -960/-940 or E3 and E2 in combination, -919/-896) only slightly decreased the luciferase activity. In contrast, deletion of element 1 (E1, -876/-851) caused a 2-fold loss of luciferase activity and elimination of E2 and E3 only lost less than 2-fold of the luciferase activity. Study performed with 5' end deletion of this region confirmed these observations. Furthermore, E4 DNA-protein complex can be supershifted by Oct-1 antibody, indicating that Oct-1 binds to E4. These results clearly demonstrated that all four elements are required to confer tissue-specific expression of the hGnRH gene in JEG-3 cells. However, the E4 is the most important for the tissue-specific expression of the hGnRH gene in JEG-3 cells. Oct-1 factor binds with E4 element and may be involved in the mediation of the human GnRH upstream promoter activity.

DNA-Binding Proteins↗
PubMed1998

Identification of trophoblast-specific regulatory elements in the mouse placental lactogen II gene.

Placental lactogen II, the major ligand for the PRL receptor during the second half of gestation in rodents, is synthesized specifically by placental trophoblast giant cells. A transient transgenic analysis has been used to localize the giant cell-specific regulatory region within the mouse placental lactogen II gene to sequences between -1340 and -2019 upstream of the transcriptional start site. More precise mapping of the regulatory elements has been accomplished by transfection of promoter constructs into Rcho-1 trophoblast cells, resulting in the characterization of two positive regulatory elements in the -1471 to -1340 region; two other regulatory elements have been implicated but not further characterized, a negative regulatory element between -2019 and -1778 and another positive element within the region from -1340 to -569. Both of the characterized positive regulatory elements are recognized by factors that are enriched in differentiated giant cells compared with proliferative trophoblasts, and these factors are either absent or at low levels in fibroblasts. The complexes that form on the two elements are distinct and neither element competes with the other for factor binding, thus implicating at least two different regulatory elements in late-gestational trophoblast giant cell-specific gene expression.

Animals↗
PubMed2000

A novel glucocorticoid receptor binding element within the murine c-myc promoter.

In the course of analyzing the murine c-myc promoter response to glucocorticoid, we have identified a novel glucocorticoid response element that does not conform to the consensus glucocorticoid receptor-binding sequence. This c-myc promoter element has the sequence CAGGGTACATGGCGTATGTGTG, which has very little sequence similarity to any known response element. Glucocorticoids activate c-myc/reporter constructs that contain this element. Deletion of these sequences from the c-myc promoter increases basal activity of the promoter and blocks glucocorticoid induction. Insertion of this element into SV40/reporters inhibits basal reporter gene activity in the absence of glucocorticoids. Glucocorticoids stimulate activity of reporters that contain this element. Recombinant glucocorticoid receptor binds to this element in vitro. An unidentified cellular repressor also binds to this element. The activated glucocorticoid receptor displaces this protein(s). We conclude that the glucocorticoid receptor binds to the c-myc promoter in competition with this protein, which is a repressor of transcription. To our knowledge, no glucocorticoid response element with such properties has ever been reported.

Animals↗
PubMed1992

Analysis of functional cooperativity between individual transcription-stimulating elements in the proximal region of the rat prolactin gene.

The proximal region of the rat PRL gene contains at least five transcription-stimulating elements that are located within a 170-basepair region up-stream of the TATA box. These cis-acting elements include four binding sites for the pituitary-specific transcription factor Pit-1 as well as another site for an unidentified factor. In this study interactions between different DNA elements have been examined through the construction of PRL-luciferase fusion genes containing mutations that disrupt various combinations of the individual DNA elements. In general, the disruption of multiple factor-binding sites had a much more than additive effect on expression of the luciferase constructs. Interestingly, comparison of the effects of disrupting pairs of binding sites demonstrated substantial differences in the effects of different combinations of mutations, suggesting that cooperative interactions may reflect specific interactions. Mutations that disrupted all five cis-elements of the PRL proximal region essentially abolished transcription from the proximal promoter. This finding suggests that there are no other DNA elements within the proximal 200 basepairs of the PRL gene that can independently stimulate transcription. Although there is strong functional cooperativity between different cis-elements in the PRL gene, DNase footprint studies failed to detect cooperative binding between different Pit-1 elements. Overall, the findings demonstrate that the normal transcription of the PRL gene involves strong cooperative interactions between individual DNA elements in the proximal region.

Animals↗
PubMed1993

A composite hormone response element mediates the transactivation of the rat oxytocin gene by different classes of nuclear hormone receptors.

Transcription factors of the steroid/thyroid hormone receptor superfamily are mediators of development and regulation of the brain. Previous studies have shown that the hypothalamic oxytocin (OT) gene is a potential target of these receptors, since its promoter is stimulated by estrogens and thyroid hormone. Here it is shown that the rat OT promoter is stimulated (at least 20-fold) by retinoic acid through two distinct regions in the 5'-flanking region. The major retinoic acid response element was located between nucleotides -172 and -148 and a minor one between nucleotides -112 and -77, as concluded from the transactivation of 5'-deletion mutants and binding to promoter elements by the retinoic acid receptor. Since the -172/-148 element also conferred estrogen and thyroid hormone responsiveness, it can be considered a composite hormone response element. This element contains a natural variant of the direct repeat of the half-site AGGTCA with spacing zero (DR-0) as well as a palindrome. Analysis of the core sequences of this element by site-directed mutagenesis showed that each of the three TGACC motifs integral to this element contributes to the multihormone sensitivity, but the contribution of each motif is different for the individual receptors. In neonatal rats, vitamin A deficiency and retinoic acid supplementation did not cause changes in hypothalamic OT mRNA levels and OT peptide levels in the pituitary gland and plasma. Gel-retarded protein-DNA complexes were formed between the composite hormone response element and extracts of the hypothalamic supraoptic and paraventricular nuclei. The composite hormone response element has a unique configuration and integrates responses of multiple members of the steroid/thyroid hormone receptor superfamily.

Animals↗
PubMed1993

Identification of promoter elements in the mouse 21-hydroxylase (Cyp21) gene that require a functional cyclic adenosine 3',5'-monophosphate-dependent protein kinase.

The constitutive and cAMP-induced expression of the mouse steroid 21-hydroxylase gene (Cyp21) are impaired in adrenal cell mutants harboring mutations in cAMP-dependent protein kinase (cAMPdPK). These requirements for a functional cAMPdPK have been mapped to the proximal 330 basepairs of the Cyp21 promoter. This study attempts to identify specific promoter elements of Cyp21 that require cAMPdPK for constitutive activity by comparing their abilities to enhance the expression of a reporter gene in Y1 adrenocortical tumor cells and Y1 Kin mutants defective in cAMPdPK activity. As determined in transient transfection assays, Cyp21 promoter elements at -65, -140, -170, -210, and -280 each enhanced the expression of a human GH reporter gene in parent Y1 cells. The relative order of effectiveness of each of these elements was: -170 >> -280 > -140 > -65 > or = -210. The -170 element was 25-fold more effective in enhancing gene expression from the reporter construct in Y1 cells than in Kin mutant cells; the elements at -65, -140, and -210 were 3-fold more effective in Y1 cells than in Kin mutant cells; the -280 element was equally effective in the parent and Kin mutant clones. These studies suggest that the promoter elements at -170, -65, -140, and -210 mediate the requirement for a functional cAMPdPK in the expression of Cyp21. As determined by gel mobility shift assays with these elements, the dependence of the Cyp21 promoter elements on a functional cAMP-dependent protein kinase did not result from decreased expression or binding affinities of their respective DNA-binding proteins.(ABSTRACT TRUNCATED AT 250 WORDS)

Adrenal Cortex↗
PubMed1993

Nerve growth factor induces transcription of NGFIA through complex regulatory elements that are also sensitive to serum and phorbol 12-myristate 13-acetate.

The expression of NGFIA (also known as egr1, zif268, TIS8, krox24, and d2) is rapidly and transiently increased by nerve growth factor (NGF) in PC12 cells. The 5'-region of this gene includes four serum response elements (SREs), a cAMP-like response element, an AP1-like response element, and an SP1-binding site. From deletion analysis of chloramphenicol acetyltransferase reporter constructs, we have established that the first 106 basepairs 5' of the transcriptional start site are sufficient for induction of NGFIA by NGF in PC12 cells; deletion beyond this point results in dramatically reduced induction of the gene. Using defined mutations in the NGFIA promoter and NGFIA-thymidine kinase hybrid promoters, we have defined three elements (SRE1, SRE2, and AP1-like) in the first 106 basepairs of upstream DNA, each of which contributes to induction of NGFIA by NGF. Cooperation by two of these elements (i.e. the two SREs or one SRE and the AP1-like element) is sufficient to confer transcriptional induction by NGF, but the combination of all three elements increased induction by NGF more effectively than a pair of elements. This suggests that the response of NGFIA to NGF is mediated by a cis-acting sequence that is composed of at least three distinct elements. An oligonucleotide composed of SRE1 and SRE2 that can confer the ability for NGF induction to heterologous promoter constructs complexes with proteins in PC12 cell nuclear extracts, but the protein-DNA complexes do not appear to be altered by NGF treatment, as measured by DNA mobility shift assays. We have also established that the regulatory region of NGFIA that mediates NGF induction also mediates the induction by serum and phorbol 12-myristate 13-acetate, suggesting that multiple signal transduction pathways must converge on these sequences to regulate the expression of this gene.

Animals↗
PubMed1999

fatvg encodes a new localized RNA that uses a 25-nucleotide element (FVLE1) to localize to the vegetal cortex of Xenopus oocytes.

Vegetally localized transcripts have been implicated in a number of important biological functions, including cell fate determination and embryonic patterning. We have isolated a cDNA, fatvg, which encodes a localized maternal transcript that exhibits a localization pattern reminiscent of Vg1 mRNA. fatvg is the homologue of a mammalian gene expressed in adipose tissues. The fatvg transcript, unlike Vg1 which localizes strictly through the Late pathway, also associates with the mitochondrial cloud that is characteristic of the METRO or Early pathway. This suggests that fatvg mRNA may utilize both the METRO and Late pathways to localize to the vegetal cortex during oogenesis. We have dissected the cis-acting localization elements of fatvg mRNA and compared these elements with Vg1 mRNA. Our results indicate that, like most localized RNAs, in a variety of systems, transcripts of fatvg contain localization elements in the 3'UTR. The 3'UTR of fatvg mRNA contains multiple elements that are able to function independently; however, it functions most efficiently when all of the elements are present. We have defined a short 25-nucleotide element that can direct vegetal localization as a single copy. This element differs in sequence from previously described Vg1 localization elements, suggesting that different localization elements are involved in the localization of RNAs through the Late pathway.

3' Untranslated Regions↗
PubMed2004

A new structural element containing glycine-rich proteins and rhamnogalacturonan I in the protoxylem of seed plants.

The water pipes of elongating plant organs are the result of programmed cell death and are formed by the walls of dead and empty protoxylem elements. These protoxylem elements are passively elongated many times by the surrounding tissue before they are replaced and collapse. Well-known adaptations for this unique task include the characteristic secondary wall thickenings, forming rings and helices. A new, clearly distinct structural element containing glycine-rich proteins is now visualized for the first time, using confocal laser scanning microscopy in the mature protoxylem of elongating organs of seed plants. This structural element is arranged along the longitudinal axis of the protoxylem elements. It interconnects the secondary wall thickenings within and between protoxylem elements, as well as the protoxylem with other cell types such as xylem parenchyma cells and metaxylem elements. The structural element is stable against detergent extractions, proteinase, pectinase and cellulase hydrolysis, and is closely associated with rhamnogalacturonan-I, a pectic polysaccharide. The results clearly demonstrate that the cell wall of protoxylem cells is a highly dynamic and complex structure. The typical polysaccharide-rich primary wall of living and elongating plant cells is progressively modified and finally replaced by a protein-rich wall in the dead and passively stretched protoxylem elements. These glycine-rich walls originated early in the evolution of the seed plants as confirmed by the analysis of genomic information.

Amino Acid Sequence↗
PubMed1979

Autoshaping with common and distinctive stimulus elements, compact and dispersed arrays.

Four groups of pigeons were trained with a standard autoshaping procedure in which a brief fixed-duration interval always followed by a grain delivery alternated with a longer variable-duration interval never associated with grain delivery. One of two stimuli was always presented during each interval. One of them contained three black dots and a black star on a green background; the other contained four black dots on a green background. The four elements of each stimulus were arranged in a more compact array for two groups and in a more dispersed array for the other two groups. Which of the two stimuli preceded grain delivery was counterbalanced within each pair of groups. The speed of occurrence of the first autoshaped peck was not affected by whether the stimulus containing the distinctive star element preceded grain delivery, but autoshaping was faster when the stimulus arrays were compact than when they were dispersed. During 560 response-independent training trials that followed the first autoshaped peck, this pattern reversed; both discriminative control over responding and the relative frequency of pecking the stimulus that preceded grain delivery were greater for the two groups where this stimulus contained the discriminative element than for the two groups where it contained only common elements. During subsequent testing with stimuli containing only a single element each, the distinctive feature was responded to proportionately more often by the two groups for which it had been an element of the stimulus preceding grain delivery than by the two groups for which it had been an element of the stimulus complex that never was associated with grain delivery. These data add further support to the hypothesis that the initial occurrence of autoshaped responding and its subsequent maintenance are not affected by the same variables. They also suggest that automaintenance is as sensitive as response-dependent training to the presence or absence of a distinctive stimulus element among several common elements and that this sensitivity appears to be independent of the specific method used for presenting the stimuli during automaintenance.

Journal Article↗
PubMed2006

Essential and non-essential elements in eight tissue types from subsistence-hunted bowhead whale: nutritional and toxicological assessment.

OBJECTIVES: To assess essential/non-essential elements in bowhead whale. STUDY DESIGN: Analyzes of tissues for key elements and comparing them to published food guidelines. METHODS: Using national and international guidelines calculate percent (%) "Recommended Daily Allowance" of essential elements in 100 g portion of bowhead tissues. For non-essential elements, determine maximal tissue consumption based on average element concentrations and provisional tolerable weekly intake; and minimal risk level. RESULTS: Liver and kidney are rich in essential/non-essential elements and have the greatest concentration of cadmium (Cd) among tissues studied, while mercury (Hg), lead (Pb) and arsenic (As) are relatively low. Kidney of bowhead whale is consumed in very limited amounts (limited tissue mass compared to muscle and maktak); liver is consumed rarely. Other tissues, except blubber, are excellent sources of many essential elements, without the abundance of liver and kidney Cd. CONCLUSIONS: Renal Cd concentrations are most restrictive for consumption on a tissue mass basis. Better understanding of Cd bioavailability, food processing, and actual consumption rates and patterns, are critical to providing improved guidance. Compared to store-bought meat, bowhead whale had comparable concentrations of elements in the tissues studied, with a few noted differences. The occasional blubber substitute, Crisco, was nearly devoid of trace element content.

Adipose Tissue↗