Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “DNA Fragmentation”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,153 records · Page 64Linked to original sources
PubMed1995

The accessibility of thiophosphorylated groups in DNA fragments to the enzymatic activity of ligases and restriction endonuclease Bbs I.

The aim of this paper was to test the possibility to ligate and hydrolyse DNA sequences containing thiomodified ends and bonds. T4 DNA ligase was shown to ligate DNA fragments regardless of whether it contains phosphorylated or thiophosphorylated 5'-end. But the cleavage of an internally thiomodified phosphodiester bond was found to be totally inhibited when using the non-palindromic restrictase Bbs I. The special properties of this restriction endonuclease should allow the development of an oriented cloning strategy when combined with T4 ligase and a thiophosphorylation of DNA fragments.

Base Sequence↗
PubMedDate not supplied

[Restriction variability of amplified chloroplast DNA fragments in genus Nicotiana].

Restriction analysis of amplificated chloroplast DNA fragments has allowed us to determine the source of cytoplasm for several natural diploids and amphidiploids of the genus Nicotiana. N. corymbosa or species of Trygonophyllae section donated cytoplasm to N. bigelovii and N. clevelandii, while N. arentsii inherited cytoplasm from N. undulata during the evolution of the genus. Plastomes of Repandae and Nudicaules species orginated from now extinct species of Trygonophyllae section.

Base Sequence↗
PubMed2002

Interaction of Hoechst 33258 and echinomycin with nucleosomal DNA fragments containing isolated ligand binding sites.

We have examined the interaction of Hoechst 33258 and echinomycin with nucleosomal DNA fragments which contain isolated ligand binding sites. A 145 base pair fragment was prepared on the basis of the sequence of tyrT DNA, which contained no CpG or (A/T)(4) binding sites for these ligands. Isolated binding sites were introduced into this fragment at discrete locations where the minor groove is known to face toward or away from the protein core when reconstituted onto nucleosome core particles. The interaction of ligands with target sites on these nucleosomal DNA fragments was assessed by DNase I footprinting. We find that Hoechst 33258 can bind to single nucleosomal sites which face both toward and away from the protein core, without affecting the nucleosome structure. Hoechst binding is also observed on nucleosomal fragments which contain two or more drug binding sites, though in these cases the footprints are accompanied by the presence of new cleavage products in positions which suggest that the ligand has caused a proportion of the DNA molecules to adopt a new rotational positioning on the protein surface. Hoechst 33258 does not affect nucleosome reconstitution with any of these fragments. In contrast, the bifunctional intercalating antibiotic echinomycin is not able to bind to single nucleosomal CpG sites. Echinomycin footprints are observed on nucleosomal fragments containing two or more CpG sites, but there are no changes in the cleavage patterns in the remainder of the fragment. Echinomycin abolishes nucleosome reconstitution when included in the reconstitution mixture.

Base Sequence↗
PubMed1985

Identification of an Rts1 DNA fragment conferring temperature-dependent instability to vector plasmids.

The multiphenotypic drug resistance factor Rts1 expresses a temperature-dependent instability characteristic. This plasmid was digested with the restriction enzyme BamHI. A DNA fragment with a molecular weight of 5.6 MDa (the H fragment) was inserted into plasmid pBR322 (pFK896) or into pSC105 (pYH156) at the BamHI site. These plasmids were unstable at 42 degrees C but stable at 32 degrees C. A restriction-enzyme map of the H fragment was constructed and the instability phenotype (Tdi) was localized to a DNA fragment with 0.5 MDa molecular weight. The temperature-dependent loss of the unstable plasmid pFK896 is abrupt and no gradual plasmid loss of this multicopy recombinant plasmid is observed. The possibility that the Tdi phenotype is due to overgrowth of R- cells was eliminated.

Ampicillin↗
PubMed1995

Gossypol-induced apoptotic DNA fragmentation correlates with inhibited protein kinase C activity in spermatocytes.

After exposure of cultured rat spermatocytes to gossypol acetic acid for five hours, DNA fragmentation in a ladder pattern was found in the medium and supernatants of cell lysates. The concentrations of gossypol used for the induction of apoptosis ranged from 100 microM to 300 microM. Within this dose range, gossypol was also found to be effective at inhibiting protein kinase C (PKC) activity. This inhibitory effect was demonstrated by measuring the PKC residing in cytosolic and particulate fractions. However, the gossypol-induced inhibition of PKC activity was protected by phorbol 12,13-dibutyrate (PDBu), an activator of PKC. Furthermore, the presence of PDBu prevented gossypol-induced DNA fragmentation. These results suggest that spermatocyte apoptosis induced by gossypol is correlated with the reduction of PKC activity, and that maintenance of PKC basal activity is essential for protecting the spermatocyte from apoptosis.

Animals↗
PubMed1996

G protein-mediated neuronal DNA fragmentation induced by familial Alzheimer's disease-associated mutants of APP.

Missense mutations in the 695-amino acid form of the amyloid precursor protein (APP695) cosegregate with disease phenotype in families with dominantly inherited Alzheimer's disease. These mutations convert valine at position 642 to isoleucine, phenylalanine, or glycine. Expression of these mutant proteins, but not of normal APP695, was shown to induce nucleosomal DNA fragmentation in neuronal cells. Induction of DNA fragmentation required the cytoplasmic domain of the mutants and appeared to be mediated by heterotrimeric guanosine triphosphate-binding proteins (G proteins).

Alzheimer Disease↗
PubMed1998

Plasma membrane phospholipid asymmetry precedes DNA fragmentation in different apoptotic cell models.

Biochemical alterations occurring in many cell types during apoptosis include the loss of plasma membrane phospholipid asymmetry and nuclear DNA fragmentation. Annexin V staining detects phosphatidylserine translocation into the outer plasma membrane layer occurring during cell death, while the in situ tailing (IST or TUNEL) reaction labels the DNA strand breaks typical of apoptosis. To compare the time course of these processes we investigated methylprednisolone-induced apoptosis of rat thymocytes, topoisomerase inhibitor-induced apoptosis in the human histiocytic lymphoma cell line U937, and serum deprivation-induced apoptosis in the rat pheochromocytoma cell line, PC12. At all time points, FACS analysis and quantitative fluorescence light microscopy showed a higher proportion of annexin V-positive than IST-positive cells, with significantly different time courses in the apoptotic cell models investigated (Anova test). Results were confirmed by confocal microscopy. Our data indicate that the exposure of phosphatidylserine, a potential phagocyte recognition signal on the cell surface of apoptotic cells in vivo, precedes DNA strand breaks during apoptosis in different cell types.

Animals↗
PubMed1976

Isolation of native DNA fragments containing structural genes at the beginning, in the middle or at the end of the coding strand.

A method for the isolation of the DNA fragments containing structural genes at the beginning, in the middle and at the end of the coding strand is described. It involves mechanical or enzymatic shearing, exonuclease treatment, hybridization with mRNA and subsequent retention of DNA-mRNA complex on poly(U)-Sepharose. Hybridization of the DNA fragments with mRNA takes place with high specificity and isolated material is enriched in structural genes. Applications of this method for gene isolation are discussed.

Animals↗
PubMed2000

DNA fragmentation, gliosis and histological hallmarks of Alzheimer's disease.

The extent of DNA fragmentation analysed using the TUNEL technique was evaluated in post-mortem human brain tissue. Twenty-four patients with clinical and histopathological diagnosis of Alzheimer's disease (AD) and a short post-mortem delay were analysed. We report an increase in the count of TUNEL-labelled cells as the pathology of AD intensifies. Our results point out a significant correlation between neurofibrillary tangle and senile/neuritic plaque score and TUNEL-labelled cells. Patients with two copies of apolipoprotein (Apo) Eepsilon4 allele had highest number of histopathological hallmarks lesions of AD, whereas the ApoE genotype did not significantly influence the density of TUNEL-positive cells. No significant correlation was found between beta-amyloid protein load and TUNEL-labelled cells. There was no relationship between the age at death, age at onset, extent of astrogliosis or microgliosis and TUNEL-labelled cells in our material.

Aged↗
PubMed2000

Protective effect of nicotine through nicotinic acetylcholine receptor alpha 7 on hypoxia-induced membrane disintegration and DNA fragmentation of cultured PC12 cells.

To investigate the effect of nicotine on hypoxic neuronal damage, cultured PC12 cells were exposed to hypoxia for 9 h and then reoxygenated for 72 h. The cells were stained by propidium iodide (PI), a marker of cell membrane disintegration and the TUNEL method, which indicates DNA fragmentation. In control cultures, the ratio of PI-positive cells to total cells progressively increased during and after exposure to hypoxia, constituting 39% of total cells at 72 h posthypoxia. This increase in PI-positive cells was completely inhibited by nicotine until 12 h posthypoxia, and was partially and dose-dependently inhibited thereafter. The ratio of TUNEL-positive cells to total cells started to increase at 24 h posthypoxia and reached 36% at 72 h in control cultures. This ratio was also dose-dependently inhibited by nicotine. These inhibitory effects of nicotine on the increase in PI-positive and TUNEL-positive cells were abolished by the addition to the medium of alpha-bungarotoxin, an antagonistic ligand for nicotinic acetylcholine receptor (AChR) alpha7. These findings suggest that nicotine inhibits, through AChR alpha7, hypoxia-induced cell membrane disintegration and DNA fragmentation of cultured PC12 cells exposed to hypoxia.

Animals↗
PubMed1994

Cytochemical identification of programmed cell death in the fusing fetal mouse palate by specific labelling of DNA fragmentation.

The process of palate fusion was examined in 13- and 14-day-old mouse fetuses by using in situ staining for nuclear DNA fragmentation (TUNEL method) and immunofluorescent staining for keratin, with special reference to the disruption of the midline epithelial seam. TUNEL-positive cells were found in the disappearing midline seam and the oral and nasal epithelial triangles at some late stages of palate fusion, but not in the palatal shelves prior to contact or in the intact midline epithelial seam. It seems that DNA fragmentation or apoptosis is required for the midline epithelial seam to disrupt, but may not be necessary for initial contact of palatal shelves or for the epithelial fusion of opposing palatal shelves. A similar sign of apoptotic cell death was observed in the disappearing epithelial seam between the fusing nasal septum and dorsal palate. We have demonstrated that apoptotic programmed cell death does occur at some stages of palate fusion, although the present results do not exclude the possibility of epithelial-mesenchymal transformation and the oral and nasal migration of midline epithelial cells.

Animals↗
PubMed2005

Cell-death mechanisms in the IPLB-LdFB insect cell line: a nuclear located Bcl-2-like molecule as a possible controller of 2-deoxy-D-ribose-mediated DNA fragmentation.

In the IPLB-LdFB insect cell line, oncosis and apoptosis are the two pre-mortal processes, whereas necrosis is the post-mortem condition. As found in mammals, adenosine triphosphate depletion of insect cells by oligomycin A induces oncosis. The apoptotic inducer 2-deoxy-D: -ribose (dRib) provokes cell death through an intrinsic apoptotic pathway similar to that observed in mammalian models and results in oligonucleosomal DNA fragmentation. The addition to insect cells of an anti-Bcl-2 polyclonal antibody known to prevent dRib-mediated apoptosis abolishes DNA fragmentation, whereas cytochrome c release and the increase in a caspase 3-like activity are still detectable. These and previous findings suggest a double role for the Bcl-2-like molecule in IPLB-LdFB, i.e. the maintenance of mitochondrial integrity and the control of apoptotic machinery at the nuclear level.

Animals↗
PubMed1988

[Subcloning of DNA fragments of the simian adenovirus SA7 oncogene in bacteriophage M13].

The XmaI/PstI and XmaI DNA fragments of adenovirus SA7 oncogene and the adjacent region (16.7% of the physical map of SA7 left end DNA) were recloned in M13 bacteriophages mp8 and mp9 in order to obtain the singlestranded fragments EIa and EIb from the DNA region of monkey adenovirus SA7 located on the recombinant plasmid pASP carrying the DNA APstI fragment including the adenovirus SA7 oncogene.

Adenoviridae↗
PubMed2007

The interference of rosmarinic acid in the DNA fragmentation induced by osmotic shock.

The induction of cell death in human erythroleukemic cells (K562) by sorbitol shows the typical apoptotic changes in ultrastructural morphology, including blebbing, chromatin condensation and nuclear membrane breakdown. Using a cytofluorimetric approach, we found that sorbitol induced production of reactive oxygen species (ROS) followed by DNA fragmentation in leukemic cells. In this study, we investigated effect of curcumin and rosmarinic acid on cell viability in three different cell lines: erythroleukemia K562, papillary NPA, and anaplastic ARO thyroid cancers. Curcumin was able to induce apoptosis in a concentration- and time dependent manner in three cell lines, while rosmarinic acid was less effective on this process. To examine this possibility in cellular system, this study evaluated the capacities of both compounds acting as antioxidant inhibiting sorbitol-induced apoptosis. K562, NPA and ARO cells were pre-incubated with 25 microM rosmarinic acid to allow the uptake and then the cell lines were treated with 1 M sorbitol. Afterwards, the cells were subjected to agarose gel electrophoresis to assess the DNA fragmentation. In conclusion, the antioxidant activity of rosmarinic acid is able to inhibit sorbitol-induced apoptosis.

Antioxidants↗
PubMed2004

Detection of DNA fragmentation and apoptotic proteins, and quantification of uncoupling protein expression by real-time RT-PCR in adipose tissue.

Better understanding of the mechanisms involved in adipose tissue growth and metabolism is critical for the development of more effective treatments for obesity. However, because of its high lipid and low protein content, adipose tissue can present unique problems in some experimental procedures. We describe three protocols that provide new or improved methods for analysis of DNA, RNA, and protein from different adipose tissues. The first protocol provides a simple and rapid method for separation of fragmented DNA and visualization of apoptotic DNA laddering without the need for radioisotopes. This technique allows for an estimate of the amount of DNA fragmentation, and hence, apoptosis. The second protocol details subcellular fractionation of adipose tissue for the extraction of protein in the mitochondrial and cytosol fractions and the measurement of apoptotic protein (Bcl-2 and Bax) levels in each fraction. The last protocol involves extraction of total RNA from adipose tissue and the measurement of uncoupling protein mRNA using real-time RT-PCR, a method that has not previously been used to measure expression of uncoupling proteins in adipose tissue.

Adipose Tissue↗
PubMed1972

A DNA fragment of Herpes simplex 2 and its transcription in human cervical cancer tissue.

A human cervical tumor, free of detectable infectious herpes simplex 2 virus, contained a fragment comprising 39% of herpes viral DNA. Renaturation kinetics indicate that an average of 1 to 3.5 DNA fragments of herpes simplex virus are present per cell, depending on the ploidy of the cells in this particular tumor. Virus-specific sequences were found linked to highly repetitive sequences of host DNA, which reassociated under conditions designed to preclude reassociation of viral sequences. The tumor also contained RNA transcripts complementary to 5% of the viral DNA. The fraction of viral DNA template transcribed in the cervical tumor is considerably less than that transcribed in productively infected cells (50%).

DNA, Neoplasm↗
PubMed1989

A facile duplex-hairpin interconversion through a cruciform intermediate in a linear DNA fragment.

The duplex of d(GGTACGCGCGTGCGCGATGG) and d(CCATCGCGCGTGCGCGTACC) containing an inverted repeat has been studied by spectroscopic and electrophoretic techniques. Prior to melting this DNA fragment, like many other palindromes, transforms into hairpin structures but with four non-self-complementary bases ("dangling ends") at their termini. Most surprisingly, it is found that these dangling ends promote an unusually facile hairpin-duplex interconversion in contrast to very slow ones found in all the "blunt end" palindromes studied so far. Kinetic studies provide evidence, for the first time in a linear DNA fragment, that a cruciform intermediate is involved in the hairpin to duplex interconversion.

Animals↗
PubMed2006

Nuclear Akt associates with PKC-phosphorylated Ebp1, preventing DNA fragmentation by inhibition of caspase-activated DNase.

Akt promotes cell survival through phosphorylation. The physiological functions of cytoplasmic Akt have been well defined, but little is known about the nuclear counterpart. Employing a cell-free apoptotic assay and NGF-treated PC12 nuclear extracts, we purified Ebp1 as a factor, which contributes to inhibition of DNA fragmentation by CAD. Depletion of Ebp1 from nuclear extracts or knockdown of Ebp1 in PC12 cells abolishes the protective effects of nerve growth factor, whereas overexpression of Ebp1 prevents apoptosis. Ebp1 (S360A), which cannot be phosphorylated by PKC, barely binds Akt or inhibits DNA fragmentation, whereas Ebp1 S360D, which mimics phosphorylation, strongly binds Akt and suppresses apoptosis. Further, phosphorylated nuclear but not cytoplasmic Akt interacts with Ebp1 and enhances its antiapoptotic action independent of Akt kinase activity. Moreover, knocking down of Akt diminishes the antiapoptotic effect of Ebp1 in the nucleus. Thus, nuclear Akt might contribute to suppressing apoptosis through interaction with Ebp1.

Adaptor Proteins, Signal Transducing↗