Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Streptococcus”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,135 records · Page 63Linked to original sources
PubMed1992

Aminoglycoside-resistant Streptococcus and Enterococcus species isolated from bovine mammary secretions.

A total of 117 isolates representing four Streptococcus species and 20 isolates representing two Enterococcus species from bovine mammary secretions were examined for resistance to streptomycin, kanamycin, and gentamicin. Resistance to streptomycin (85.4%) was most prevalent, followed by kanamycin (19%) and gentamicin (2.2%). Minimum inhibitory concentration of streptomycin for most organisms examined ranged from 16 to 250 micrograms/ml. For kanamycin, the minimum inhibitory concentration for most organisms was .5 to 62.5 micrograms/ml. Minimum inhibitory concentration for gentamicin was lower than for kanamycin. Two strains each of Streptococcus uberis and Enterococcus faecalis had minimum inhibitory concentration for streptomycin of greater than 2000 micrograms/ml, and two strains of E. faecalis had similar minimum inhibitory concentration for kanamycin. The minimum bactericidal concentration for all organisms was one to four times higher than minimum inhibitory concentration. None of the organisms evaluated was found to carry plasmids. Transfer of antibiotic resistance in plasmid-free strains was not achieved by mobilization with the aid of plasmid pAD1, indicating the absence of conjugative transposons. These data suggest that expression of aminoglycoside resistance of Streptococcus and Enterococcus species of bovine origin is likely due to factors other than plasmids or conjugative transposons.

Animals↗
PubMed2002

A case of streptococcus pyogenes endophthalmitis following cataract surgery.

A small number of cases of bacterial endophthalmitis due to Streptococcus pyogenes, a Gram positive organism, have previously been reported. In this case, rapidly progressive Streptococcus pyogenes endophthalmitis was developed five years after cataract surgery which had been. The previous cataract surgery was combined with intraocular lens implantation by trans-scleral suspension technique. Treatment included enucleation and intravenous antibiotic injection. In this case of delayed Streptococcus pyogenes endophthalmitis after extracapsular cataract extraction. It seems probable that progressive erosion of the suture material resulted in exogenous endophthalmitis.

Aged↗
PubMed2006

Streptococcus suis endocarditis and colon carcinoma: a case report.

Streptococcus bovis has classically been associated with colorectal carcinomas in literature. Curiously enough, no other Streptococcus species have hitherto been associated with such a malignancy or any other tumors. This report presents a case of early-stage colorectal carcinoma diagnosed in a patient with infection with the related Streptococcus species S suis. A discussion of possible pathogenetic implications follows.

Adenocarcinoma↗
PubMed1990

[Induction and functional analysis of gamma delta TCR-bearing T cells from human tonsil by Streptococcus pyogenes stimulation].

The killer cell characteristics of gamma delta TCR-bearing T cells induced from human tonsil by streptococcus pyogenes stimulation were examined. Immunohistologic staining of tonsil showed that gamma delta TCR-bearing T cells were mainly located in the interfollicular area connected with stratified squamous epithelium. Streptococcus pyogenes could induce the proliferation of gamma delta TCR-bearing T cells from tonsil in the presence of low-dose of IL-2. This streptococcus pyogenes-induced gamma delta TCR-bearing T cell proliferation was likely to be independent on the IL-2/IL-2R system since an obvious inhibition was not observed with anti-IL-2 and anti-IL-2R mAbs. More importantly, these gamma delta TCR-bearing T cells exhibited cell-mediated cytotoxic activity in a 4 hr 51 Cr-release assay. In addition, immunocytochemical staining revealed that these cells contained a killer protein perforin. These results demonstrate that gamma delta TCR-bearing T cells from tonsil exhibit typical killer cell characteristics. These data also suggest that gamma delta TCR-bearing T cells in human tonsil may play a cytotoxic role in protecting the integrity of tonsil from infection.

Cytotoxicity, Immunologic↗
PubMed2005

Dental caries experience and salivary levels of Streptococcus mutans and Lactobacilli in 13-15 years old children of Belgaum city, Karnataka.

The present cross-sectional study was carried out in 372 school going children of Belgaum aged 13-15 years. The sample was selected by two stage random sampling method. The aim of the study was to estimate the salivary levels of Streptococcus mutans and Lactobacilli and to study the relationship between these microorganisms and dental caries experience. The DMFT was recorded according to the WHO criteria(1997).The microbial load was estimated from a single saliva sample obtained from the children. The mean DMFT recorded was 2.41. Streptococcus mutans was detected in 87.37% and Lactobacilli in only 36.71% of the sample. Statistically, highly significant relation was found between Streptococcus mutans and DMFT categories (chi2=125.36, P<0.001), while Lactobacilli was not statistically related to DMFT categories (chi2=8.78, P>0.05).

Adolescent↗
PubMed2002

Streptococcus equisimilis infection in striped skunks (Mephitis mephitis) in Saskatchewan.

Three radio-collared striped skunks (Mephitis mephitis) found dead during a field study of winter ecology of striped skunks near Willowbrook, Saskatchewan, Canada were examined. Streptococcus equisimilis was identified as the primary agent causing necrotizing purulent pneumonia in one skunk and suppurative meningoencephalitis in another. Both Streptococcus equisimilis and Streptococcus canis were isolated from lesions of purulent myocarditis and pyothorax in the third skunk. These are apparently the first reported cases of S. equisimilis infection in striped skunks and suggest that this opportunistic pathogen may be a significant cause of mortality under some conditions.

Animals↗
PubMed2000

Antibiotic susceptibility of Streptococcus pneumoniae in Karachi.

OBJECTIVE: To evaluate, record and analyse the comparative activity of a range of oral antibiotics against Streptococcus pneumoniae. SETTING: Specimen collected at a private laboratory and some received from different hospitals and clinics. MATERIALS: The specimen comprised of Sputum, Throat Swabs, C.S.F., Pus, Pleural fluid, Ear Swabs, Eye Swabs, Bronchial Wash, Prostatic discharge and Antral Secretions. METHODS: The isolates were tested for their antibiotic susceptibility using the E-test by the methods described in the study protocol. The groups of antibiotics tested were Amoxicillin--Clavulanate, Clarithromycin, Cefaclor, Cefuroxime, Ceftriaxone and Penicillin. RESULTS: A total of 116 strains of Streptococcus pneumoniae were isolated and susceptibility to Amoxicillin-Clavulanate was 100%, 99.1% strains were susceptible to Cefuroxime and 0.9% were intermediate. Susceptibility to Penicillin was 80.2% and 19.8% of the strains were in intermediate category, while susceptibility to Clarithromycin was 89.7%, 1.7% were in intermediate region and 8.6% of the strains were resistant to this antibiotic. The susceptibility pattern of Cefaclor was not calculated as there is no current NCCLS--97 Cefaclor breakpoints available. CONCLUSION: The percentage of drug resistant Streptococcus pneumoniae was negligible in Karachi during the study period, however it is important to monitor the susceptibility pattern to keep a check on an increase in the number of DRSP as reported at different centres in Turkey, Saudi Arabia, Singapore, Thailand, Hong Kong and Indonesia.

Anti-Bacterial Agents↗
PubMed1975

[Studies on the relationship of temperent phages and bacteriocines of streptococcus faecium (author's transl)].

Two bacteriocins (enterocin E1A and E1B) as well as a complete bacteriophage (PE1) were produced by Streptococcus faecium strain E1. Although the phage could be demonstrated by electron microscopy it was not possible to observe phages or phage-like particles in the purified preparation of the large enterocin E1B. Phage PE1 had a much smaller activity spectrum than that of enterocin E1A and E1B, inhibiting only one strain of Streptococcus faecium and one strain of Streptococcus salivarius. The enterocins were not neutralized by antiphage sera, thereby suggesting that the enterocins and the phage are chemically unrelated.

Animals↗
PubMed2000

Necrotizing fasciitis and toxic shock-like syndrome caused by group B streptococcus.

A recent increase in reports of necrotizing fasciitis resulting from group B streptococcus has alerted physicians to a possible concomitant increase of toxic shock-like syndrome. We report the second case of group B streptococcus causing necrotizing fasciitis and toxic shock-like syndrome. A black woman, aged 52 years, with newly diagnosed diabetes mellitus had necrotizing fasciitis type II of the left groin. Hypotension, elevated bilirubin and liver enzymes, and adult respiratory distress syndrome rapidly developed. Because group B streptococcus was isolated from a normally sterile site, the patient's condition met the criteria for toxic shock-like syndrome. Extensive surgical debridement, hyperbaric oxygen therapy, and intravenous antibiotic therapy (including clindamycin) were required for complete recovery. The antitoxin effects of hyperbaric oxygen therapy and clindamycin should be further investigated for the treatment of such patients.

Anti-Bacterial Agents↗
PubMed1999

[A surveillance study on penicillin-resistant Streptococcus pneumoniae in China].

OBJECTIVES: To find out if there are penicillin-resistant Streptococcus pneumoniae and the resistance rate in China. METHODS: 989 pediatric patients with respiratory tract infections aged from 6 months to 3 years from two pediatric units were enrolled. Perthroat swabs were immediately streaked onto blood agar plates and incubated overnight. Pneumococci were identified and isolated. Antibiotic susceptibility was assessed by the disk diffusion method and MIC determination according to Protocol and NCCLS. RESULTS: Of the 51 Streptococcus pneumoniae isolates, 5 strains had zones > or = 20 mm. Two of the 5 strains had penicillin MICs > or = 0.1 mg/L (2 and 4 mg/L) and considered to be fully resistant to penicillin(4%). The resistance rate to ceftriaxone and cefotaxime was 0 and 4% respectively. For the other 10 antimicrobial agents, the resistance rates were as follows: ampicillin 12%, piperacillin 26%, furbenicillin 14%, cefuroxime 6%, erythromycin 54%, clarithromycin 52%, meleumycin 64%, roxithromycin 52%, chloramphenicol 32%, and tetracycline 100%. CONCLUSIONS: The study suggested that penicillin resistant Streptococcus Pneumoniae strains also exist, and the cross-resistance is a significant phenomenon in China.

Ampicillin Resistance↗
PubMed1999

[Antimicrobial resistance in Streptococcus pneumoniae in Beijing and molecular typing of penicillin-resistant strains].

OBJECTIVE: To investigate antimicrobial resistance of Streptococcus pneumoniae in Beijing and molecular epidemiology of penicillin-resistant pneumococci strains. METHODS: The resistance to beta-lactam and non-beta-lactam antibiotics of 244 nasopharyngeal isolates of Streptococcus pneumoniae collected from September to November 1997 in 8 day-care centers in Beijing was studied by Etest and agar dilution method. Serotyping was done by "capsular swelling" technique. BOX-PCR technique was used to detect the DNA of resistant strains. RESULTS: 24.8% (244/985) of the children carried Streptococcus pneumoniae. The agreement between the MICs obtained by Etest and agar dilution for penicillin and ceftriaxone was > 93.7%. By Etest, 3/244 (1.3%) strains were resistant to penicillin(MICs, 3 micrograms/ml) and 32/244(13.1%) strains in termedinte (MICs, 0.094-0.25 microgram/ml). Penicillin-susceptible strains were also susceptible to the other 4 tested beta-lactams. In penicillin non-susceptible strains, 11.4% (4/35) isolates were resistant to the other beta-lactams. The resistant rates of erythromycin, tetracycline, chloramphenicol and trimethoprim-sulfamethoxazole (TMP-SMZ) were 74.0%, 87.6%, 47.8%, 63.3%, respectively. All of the strains were susceptible to vancomycin and rifampin. 119/244(48.7%) strains isolated were multiresistant to tetracycline, erythromycin and TMP/SMZ. Serotype 6A(33.6%), 19F(16.8%), 23F(15.1%), 15(11.2%), 6B(4.3%) were most common. 57.1% (20/35) penicillin non-susceptible strains were of serotype 23F and had similar or identical multiresistance and BOX patterns. CONCLUSION: In Beijing, the prevalence of penicillin-resistant pneumococci was obviously lower than that of neighboring countries, but resistant rate to non-beta-lactams was high. The epidemic multiresistant 23F clone found in day-care centers was different from the Spanish clone.

Anti-Bacterial Agents↗
PubMed2001

Salivary Streptococcus mutans and Lactobacillus sp levels in cardiac children.

This study assesses salivary conditions of 20 children with cardiac disease comparing with a control group of 15 healthy children. The results showed that there was no difference between the groups on salivary flow, buffer capacity and the level of Streptococcus mutans (Sm). The test group i.e., children with cardiac disease, showed a lower level of Lactobacillus sp. The association between the usage of antibiotics and the risk of developing caries, measuring the level of Streptococcus mutans and Lactobacillus sp., showed that children taking antibiotics frequently had a significant lower level of Lactobacillus sp (p<0.05) than healthy children. This association was not found on relation to the levels of Streptococcus mutans.

Adolescent↗
PubMed2001

[Effects of Streptococcus sanguis on blood composition, blood pressure and cardiac dysfunction in rabbis].

OBJECTIVE: To investigate effect of streptococcus sanguis on blood cell and cardiopulmonary changes. METHODS: 133-79 strains of streptococcus sanguis (aggregation positive) were infused intravenously into rabbits. Before and 5, 10, 20, 30, 45, 60 min after infuse platelets count, leukocytes count, blood pressure and ECG were measured. RESULTS: After infused intravenously, both platelets and leukocytes count decreased remarkably (P < 0.01, n = 12). The ECG showed ST segment depression (> 0.06 mV). Diphasic blood pressure occurred (first hypertensive then hypotensive). CONCLUSIONS: Streptococcus sanguis 133-79 strains in circulation system might cause myocardia ischemia, blood pressure changes, peripheral circulation platelets and leukocytes decrease remarkably.

Animals↗
PubMed2002

Streptococcus mutans levels and caries prevalence in low-income schoolchildren.

Previous studies have shown that persons having high Streptococcus mutans levels in the saliva are "at risk" for dental caries. Most investigators agree, that if high levels of S. mutans were identified early in the life of at-risk children, dental decay could be reduced or eliminated through intervention. The purpose of this study is to show an association between S. mutans levels and caries prevalence in a sample of elementary school children. The study group consisted of 242 school children, ages 5-13 years. The subjects were divided into two age groups, 5-8 years and 9-13 years. Approximately 59 percent were African Americans. The sample of 242 children were equally females and males, 50 percent in each group. The Dentocult SM Test was used to make S. mutans determinations. The df-t index was used to determine the number of decayed and filled teeth of children ages 5-8 years; the DMF-T Index estimated the number of decayed, missing or filled teeth of children ages 9-13 years. Dental caries were found in 58 percent of the children (mean = 2.67, and range of 1-11). Approximately 47 percent of the children with caries had high S. mutans levels (100K-1M). Females had higher S. mutans levels than males in the 9-13 age group, p < .05. Analysis of Variance Test indicated that S. mutans levels for older females (ages 9-13) were significantly higher than those observed in males the same age (p < .01). This trend was not observed in younger children, ages 5-8 years. In addition, no significant difference or interaction was noted by sex for S. mutans levels and decayed or filled teeth (df-t) for younger children. We conclude that high levels of Streptococcus mutans are related to increased number of decayed teeth and conversely, low Streptococcus mutans levels are related to fewer dental caries. This study was supported in part by Colgate-Palmolive Company and the National Dental Association Foundation, Inc.

Adolescent↗
PubMed2001

[B Streptococcus and other pathogenic bacteria colonization in hospitals in the Gdańsk Metro Area].

A survey of group B Streptococcus and other pathogenic bacteria colonization was carried out on 658 neonates in 8 neonatal wards of hospitals in the Gdańsk Metro Area and the district of Gdańsk. Out of pathogenic bacteria Haemophilus and enteric bacteria the most frequently were isolated. The percentage of Staphylococcus aureus was relatively low (19.4). The group B Streptococcus frequency in throat was established as 3.8% and ranging from 1.7 to 8.8% in particular wards. In two cases group B streptococcus were not isolated. In probes taken from anus of newborn tested typical enteric flora dominated and E coli and Klebsiella sp were the most frequently encountered. Profile and frequency of bacterial colonization indicated that epidemiological situation in majority of particular wards in similar.

Escherichia coli↗
PubMed2002

[In vitro susceptibility of streptococcus pneumoniae strains isolated from lower respiratory infections in Instituto Nacional del Tórax (INT)].

BACKGROUND: The rising antimicrobial resistance of streptococcus pneumoniae, requires permanent surveillance. Antimicrobial treatments of invasive infections must be modified accordingly. AIM: To assess the in vitro antimicrobial susceptibility of streptococcus pneumoniae strains isolated from lower respiratory infections. MATERIAL AND METHODS: Seventy five strains isolated during three periods in consecutive years were studied. In vitro susceptibility towards penicillin, erythromycin and ceftriaxone was studied using E-test technique minimal inhibitory concentrations. RESULTS: Five percent of strains were penicillin resistant and 11% had an intermediate sensitivity. Erythromycin resistance was observed in 1.3% of strains. Eight percent of strains had an intermediate sensitivity towards ceftriaxone and no resistance was observed. Comparing susceptibility in the three studied periods, it remained low and stable. CONCLUSIONS: High and intermediate resistance of Streptococcus pneumoniae towards penicillin is less prevalent than in other countries. A close surveillance must be maintained (Rev Méd Chile 2002; 130: 304-8).

Adult↗
PubMed2000

[Effect of calcium on adherence of Streptococcus mutans MT6R(serotype c) surface protein P1].

OBJECTIVE: To study effects of calcium on the adherence of Streptococcus mutans MT6R(serotype c) surface protein P1 to saliva-coated hydroxyapatite(S-HA). METHODS: The surface protein P1 of Streptococcus mutans MT6R was purified by PAGE and labeled with 131I(131I-P1). The adherence amount of 131I-P1 to S-HA in different calcium concentration liquid was measured. RESULTS: The amount of 131I-P1 adherence to S-HA in 0, 0.1, 0.25, 0.5, 1.0, 1.5, 2.0 mmol/L, and calcium was 7175 + 183, 7516 + 192, 8850 + 215, 9335 + 204, 10087 + 228, 10179 + 224 and 10200 + 317 cpm, respectively(P < 0.01). The calcium concentration from 0 to 1.0 mmol/L, the amount of 131I-P1 adherence was increased statistically(P < 0.05), calcium concentration from 1.0 mmol/L to 2.0 mmol/L, the amount of 131I-P1 adherence was increased unstatistically(P > 0.05). CONCLUSION: Calcium promoted the adherence of surface protein P1 to the S-HA. This result suggested that calcium was involved in the adherence of Streptococcus mutans MT6R (serotype c) surface protein P1.

Bacterial Adhesion↗
PubMed1999

[Preparation of Streptococcus sanguis DIG-labeled DNA probes and clinical application].

OBJECTIVE: To investigate oral Streptococci nif gene. METHODS: According to the 800 base pairs(bp) sequence, a couple of special prime was designed, which were 5'TAGTTGAAGCGATTAAAGCG 3' and 5' TCGTCGTGAAAGCCAAA 3'. DIG-labeled DNA probes of ATCC10556 800 bp DNA fragment and 559 bp DNA fragment were made. By using Southern blotting and dot blotting, more than 30 bacterial strains were checked. RESULTS: 559 bp sequence was according with the reported results, and the Southern blot results showed that S34 sr, S34 no 1 strains had homologicous sequence with ATCC10556, two strains of Streptococcus sanguis were weak positive, and other strains were negative. CONCLUSION: Streptococcus sanguis ATCC10556 strain contained exactly nif gene and nif gene may be the special gene of Streptococcus sanguis ATCC 10556.

Base Sequence↗