Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Response Elements”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,135 records · Page 63Linked to original sources
PubMed1994

Inhibition of HIV-1 multiplication in a human CD4+ lymphocytic cell line expressing antisense and sense RNA molecules containing HIV-1 packaging signal and Rev response element(s).

Moloney murine leukemia virua (MoMuLV)-derived retroviral vectors were engineered to express human immunodeficiency virus type 1 (HIV-1) packaging (psi) signal and Rev response element (RRE) sequences in either sense or antisense orientation. The RRE sequences were expressed under the control of the herpes simplex virus (HSV) thymidine kinase (tk) promoter fused to the HIV-1 trans-activation-responsive (TAR) element, while the psi signal sequences were expressed under control of the HSV tk promoter. Both RRE and psi signal sequences were expressed as part of the 3' untranslated region of the neomycin phosphotransferase (neo) mRNA. The constructs were used to transfect/infect packaging cell lines and the retroviral vector particles released were used to infect a human CD4+ lymphocyte-derived MT4 cell line. The stable MT4 transformants, harboring proviral vector DNA expressing one to two copies of HIV-1 RRE and psi signal in either antisense or sense orientation, were each tested for their susceptibility to HIV-1 infection. Compared to the results obtained with the control cells lacking any of the test DNA sequences, the rate of HIV-1 production remained unaltered in RRE1+ (sense RNA containing a single copy of RRE) RNA-containing cells, whereas it was delayed in cells expressing both RRE2+ (sense RNA containing two copies of RRE) and RRE1- (antisense RNA containing a single copy of RRE) RNA-expressing cells. In cells expressing HIV-1 psi signal, HIV-1 production remained unaltered in psi + RNA-expressing cells, whereas it was delayed by up to 30 days in psi - RNA-expressing cells.(ABSTRACT TRUNCATED AT 250 WORDS)

Base Sequence↗
PubMed1994

Identification of a TPA-responsive element mediating preferential transactivation of the galanin gene promoter in chromaffin cells.

The gene encoding the neuropeptide galanin is upregulated by second messenger signal transduction pathways in bovine chromaffin cells. To identify its transcriptional regulatory elements, 5'-flanking sequences of the galanin gene were transiently transfected into primary cultures of bovine chromaffin cells within reporter gene constructs. Multiple regions of the galanin 5' flank seem to be necessary for basal activity. The most promoter-proximal of these regions contains a sequence (TGACG) -66 to -62 nucleotides upstream from the transcriptional start site which mediates stimulation by 12-O-tetradecanoylphorbol-13-acetate (TPA), as demonstrated by site-directed mutagenesis and cis-activation experiments. This cis-regulatory element mediates preferential TPA stimulation of transcription from the galanin promoter in chromaffin cells compared with bovine endothelial or HeLa cells. DNA-protein binding assays indicate that an oligonucleotide that includes the galanin TPA-responsive element (GTRE) binds specifically to proteins from nuclear extracts of chromaffin cells. TPA treatment persistently increases this binding activity in chromaffin but not in endothelial cells. Mutation of the galanin promoter within the -66 to -62 region renders it unresponsive to transcriptional stimulation by TPA, and a correspondingly mutated oligonucleotide fails to bind chromaffin cell nuclear proteins in a gel-shift assay. Chromaffin cell nuclear extracts also contain proteins that bind consensus TPA-responsive (TRE) and cyclic AMP-responsive (CRE) elements. GTRE, TRE, and CRE oligonucleotides all compete more efficiently for protein binding to their labeled congeners than for protein binding to either of the other labeled oligonucleotides, suggesting that the GTRE, TRE, and CRE oligonucleotides, suggesting that the GTRE, TRE, and CRE oligonucleotides each bind unique as well as common proteins, likely to be members of the Jun/Fos and cAMP-responsive element-binding protein/activating transcription factors (CREB/ATF) families of transcription factors, in chromaffin cells.

Adrenal Medulla↗
PubMed2001

Estrogen receptor interaction with estrogen response elements.

The estrogen receptor (ER) is a ligand-activated enhancer protein that is a member of the steroid/nuclear receptor superfamily. Two genes encode mammalian ER: ERalpha and ERbeta. ER binds to specific DNA sequences called estrogen response elements (EREs) with high affinity and transactivates gene expression in response to estradiol (E(2)). The purpose of this review is to summarize how natural and synthetic variations in the ERE sequence impact the affinity of ER-ERE binding and E(2)-induced transcriptional activity. Surprisingly, although the consensus ERE sequence was delineated in 1989, there are only seven natural EREs for which both ERalpha binding affinity and transcriptional activation have been examined. Even less information is available regarding how variations in ERE sequence impact ERbeta binding and transcriptional activity. Review of data from our own laboratory and those in the literature indicate that ERalpha binding affinity does not relate linearly with E(2)-induced transcriptional activation. We suggest that the reasons for this discord include cellular amounts of coactivators and adaptor proteins that play roles both in ER binding and transcriptional activation; phosphorylation of ER and other proteins involved in transcriptional activation; and sequence-specific and protein-induced alterations in chromatin architecture.

Animals↗
PubMed2000

Polypyrimidine tract-binding protein-associated splicing factor is a negative regulator of transcriptional activity of the porcine p450scc insulin-like growth factor response element.

The porcine P-450 cholesterol side-chain cleavage enzyme gene (P450scc) contains a 30-bp region [insulin-like growth factor response element (IGFRE)] that mediates insulin-like growth factor I (IGF-I)-stimulated gene expression and binds Sp1. In this study, we showed that polypyrimidine tract-binding protein (PTB)-associated splicing factor (PSF), an RNA-binding component of spliceosomes, binds to the IGFRE. Southwestern analysis with an IGFRE oligonucleotide showed that a protein (from Sp1-immunodepleted HeLa extract) fractionated on SDS-PAGE at 100 kDa. Microsequence analysis of 100-kDa band HeLa proteins detected PSF. DNA affinity chromatography, using an IGFRE mutant oligonucleotide that does not bind Sp1, isolated a protein that immunoreacted with PSF antibody. Deoxyribonuclease I (DNase I) footprint analysis showed recombinant PSF binds 5' of the Sp1-binding GC box of the IGFRE, and mutant oligonucleotides further delineated this region to a palindrome, CTGAGTC. Functional analysis of these mutants by transfection experiments in a cell line overexpressing the IGF-I receptor (NWTb3) found that an inability to bind PSF significantly increased the IGFRE transcriptional activity, while retaining responsiveness to IGF-I. Moreover, transfection of expression vectors for Sp1 and PSF in porcine granulosa cells found that Sp1 expression stimulated IGFRE transcriptional activity while PSF inhibited activity even with coexpression of Sp1. In conclusion, we identified PSF as an independent, inhibitory regulator of the transcriptional activity of the porcine P450scc IGFRE.

Animals↗
PubMed1995

Polyamine-mediated conformational perturbations in DNA alter the binding of estrogen receptor to poly(dG-m5dC).poly(dG-m5dC) and a plasmid containing the estrogen response element.

The binding estrogen receptor (ER) to the upstream regions of estrogen-responsive genes, the estrogen response elements (ERE), is of fundamental importance in the regulation of gene expression by estradiol. Multiple cell-specific factors affect ER-ERE binding and modulate the responses of estradiol. We studied the role of polyamines in the recognition of ER, a ligand-activated transcription factor, with a left-handed Z-DNA forming polynucleotide as well as with a plasmid containing ERE. Polyamines are cellular organic cations with multiple functions in cell growth and differentiation. Polyamines induce Z-DNA conformation in alternating purine-pyrimidine sequences. To understand the role of polyamine-induced DNA conformational transition in ER-DNA interaction, we studied the binding of partially purified rabbit uterine ER to poly(dG-m5dC).poly(dG-m5dC). The induction of Z-DNA in the polynucleotide was monitored by circular dichroism and ultraviolet spectroscopic measurements. Binding of ER to poly(dG-m5dC).poly(dG-m5dC) increased from 15% to approx. 50-60% in the presence of 7.5 mM putrescine, 0.5 mM spermidine or 0.25 mM spermine. Maximal binding of ER to the polynucleotide was observed near the midpoint of the B-DNA to Z-DNA transition of the polynucleotide. N1-acetyl spermidine and N1-acetyl spermine facilitated the B-DNA to Z-DNA transition and the binding of ER although they were less effective than the unacetylated analog. Co(NH3)6(3+), a trivalent inorganic cation, also provoked the B-DNA to Z-DNA transition of the polynucleotide and increased its binding to ER. At higher polyamine concentrations, there was an inhibition of ER binding to the polynucleotide. In the presence of polyamines, the binding of ER to a plasmid containing ERE was 2-3-fold higher than that to a control plasmid devoid of ERE. Polyamine-induced facilitation of ER-ERE binding was also confirmed by gel mobility shift assay. Our data indicate that conformational perturbations, similar to that of the early stages of B-DNA to Z-DNA transition, are important in the recognition of ER and ERE.

Animals↗
PubMed1990

Three GCN4 responsive elements act synergistically as upstream and as TATA-like elements in the yeast TRP4 promoter.

The yeast TRP4 promoter contains three responsive elements (GCREs) for the 'general control' transcriptional activator GCN4, which are arranged in two upstream elements, UAS1 (GCRE1) and UAS2 (GCRE2 and GCRE3). A point mutation analysis of these elements revealed that all three GCREs are required for GCN4-dependent transcription, but none are involved in basal transcription. Basal transcription and GCN4-dependent transcription use completely different initiator elements in the TRP4 promoter. UAS1 acts synergistically with UAS2 to activate the GCN4-dependent transcription of TRP4. A consensus TATA box can functionally replace the UAS2 element to allow normal GCN4-dependent transcription, suggesting that UAS2 is analogous to the TATA element of other promoters. GCN4 might therefore activate transcription by exhibiting two alternative functions within the natural TRP4 promoter.

Alleles↗
PubMed1994

Binding of an HIV Rev peptide to Rev responsive element RNA induces formation of purine-purine base pairs.

The Rev responsive element (RRE) is an RNA secondary structural element within the env gene of HIV and is the binding site for the viral Rev protein. Formation of the Rev-RRE complex is involved in regulation of splicing and transport of mRNA from the nucleus. To understand the structural basis for the specific recognition of RRE by Rev, we have studied a model system for this interaction using NMR. We have obtained a specific 1:1 complex between an RNA derived from stem IIB of RRE, which contains the highest affinity Rev binding site, and a modified Rev34-50 peptide, which binds the RRE as an alpha-helix [Tan, R., et al. (1993) Cell 73, 1031-1040]. Binding of the peptide was accompanied by a conformational change in the RNA, which resulted in the formation of additional base pairs not present in the free RNA. Two of these induced base pairs are purine-purine pairs within the internal loop of RRE, which had been previously proposed on the basis of biochemical experiments [Bartel, D.P., et al. (1991) Cell 67, 529-536]. The formation of non-Watson-Crick base pairs, interactions in the major groove, and protein-induced conformational changes may prove to be common characteristics of RNA recognition of proteins.

Amino Acid Sequence↗
PubMed1995

Ligand-dependent antagonism by retinoid X receptors of inhibitory thyroid hormone response elements.

The role of retinoid X receptors (RXRs) on negative thyroid hormone response elements (nTREs) is not well understood. In this report, we demonstrate that an orientation-specific monomeric thyroid hormone receptor (T3R) DNA-binding site mediates thyroid hormone inhibition in the thyrotropin beta subunit gene (TSH-beta) from human and murine species. Unlike positive TREs, addition of the ligand 9-cis retinoic acid (9-cis RA) to cells transfected with a T3R beta 1 expression vector significantly reduces thyroid hormone inhibition of the TSH-beta gene, indicating that endogenous retinoid receptors antagonize T3R function. Cotransfection of an RXR-alpha but not a retinoic acid receptor-alpha expression vector further antagonizes thyroid hormone inhibition, but only in the presence of 9-cis RA. Antagonism by RXR requires both an intact DNA- and ligand-binding domain. Removal of monomeric T3R binding to the TSH-beta nTRE also requires both RXR domains. A model is proposed whereby monomeric T3R is removed from a nTRE by RXR occupied by its ligand 9-cis RA. This is the first report of 9-cis RA-dependent antagonism of thyroid hormone inhibition via negative TREs.

Animals↗
PubMed1996

Identification of a conserved and functional iron-responsive element in the 5'-untranslated region of mammalian mitochondrial aconitase.

Iron-responsive elements (IREs) are RNA stem-loop motifs found in genes of iron metabolism. When cells are iron-depleted, iron regulatory proteins (IRPs) bind to IREs in the transcripts of ferritin, transferrin receptor, and erythroid amino-levulinic acid synthetase. Binding of IRPs to IRE motifs near the 5' end of the transcript results in attenuation of translation while binding to IREs in the 3'-untranslated region of the transferrin receptor results in protection from endonucleolytic cleavage. Iron deprivation results in activation of IRE binding activity, whereas iron replete cells lose IRE binding activation. Here, we report the identification of a conserved IRE in the 5'-untranslated region of the transcript of the citric acid cycle enzyme mitochondrial aconitase from four different mammalian species. The IRE in the transcript of mitochondrial aconitase can mediate in vitro translational repression of mitochondrial aconitase by IRPs. Furthermore, levels of mitochondrial aconitase are decreased in mice maintained on a low iron diet, whereas levels of mRNA remain unchanged. The decrease in levels of mitochondrial aconitase is likely due to activation of IRP binding and consequent attenuation of translation. Thus, expression of the iron-sulfur protein mitochondrial aconitase and function of the citric acid cycle may be regulated by iron levels in cells.

Aconitate Hydratase↗
PubMed1993

The herpes simplex virus thymidine kinase gene promoter contains a novel thyroid hormone response element.

Thyroid hormone (T3) receptors (T3Rs) regulate transcription by binding to T3 response elements (TREs) located within promoter regions of T3-regulated genes. In rat pituitary GH4C1 cells, expression of a reporter containing herpes simplex virus thymidine kinase (TK) gene sequences (-105/+51) linked to the chloramphenicol acetyltransferase gene was stimulated 4- to 5-fold by T3. Linker scanning mutants of the TK promoter revealed that regions around -80 containing a CTF/NF-1 recognition sequence and around -10 are both required for regulation by T3. Endogenous T3Rs from GH4C1 cells labeled with [125I]T3 bound only to TK promoter DNA fragments containing the -10 region. The -22/-2 sequence (TK-TRE) contains half-sites oriented as an inverted repeat separated by 6 basepairs that are identical to and similar to an optimized TRE half-site. Purified chicken T3R alpha 1 forms apparent monomeric and dimeric complexes on the 32P-labeled TK-TRE, as found previously with an inverted repeat of the optimized TRE (TREp) with no basepair gap. T3 enhances the formation and alters the mobility of these complexes on both elements. When positioned up-stream of a heterologous promoter-chloramphenicol acetyltransferase reporter, the TK-TRE conferred T3 regulation by endogenous T3R in GH4C1 cells and by cotransfected chicken T3R alpha 1 in HeLa cells. The TK-TRE does not bind and is not activated by retinoic acid receptor. T3Rs and nuclear proteins from GH4C1, HeLa, and COS1 cells form heterodimers on the TK-TRE which differ in abundance and mobility from heterodimers formed on the TREp. The identification of a TRE in the TK promoter raises the possibility that T3R or related proteins may play important roles in regulating the life cycle of herpes simplex virus.

Animals↗
PubMed1991

Formation of a small ribonucleoprotein particle between Tat protein and trans-acting response element in human immunodeficiency virus-infected cells.

The trans-acting response element (TAR) within the long terminal repeat of human immunodeficiency virus (HIV) is present in all 5' termini of HIV mRNAs and is recognized by the viral Tat protein. Now we describe that the 59-nucleotide-long TAR-RNA exists as a ribonucleoprotein particle in polysomal and heterogeneous nuclear RNP fractions of HIV-1-infected HeLa-T4+ cells. Applying an immunoprecipitation technique this Tat.TAR complex could be isolated from total cell extracts as well as from polysomal or heterogeneous nuclear RNP fractions. The chain length and the identity of the TAR-RNA were established by RNase protection assays while the Tat protein was confirmed by Western blotting technique. The TAR-RNA in this complex was sequenced and found to comprise nucleotides +2 to +61 and hence includes the 3-nucleotide bulge (nucleotides +23 to +25) and the loop sequence of the TAR stem-and-loop structure. The Tat.TAR complex is present in cells at low abundance (12.5 x 10(3) copies/cell). In contrast to the TAR-containing mRNAs, which decay very rapidly after incubation of cells with actinomycin D (half-life of approximately 120 min) the half-life of TAR in the Tat.TAR complex is greater than 180 min. Alignment studies revealed that TAR-RNA (positive strand) has a potential binding ability to the U5 region within the long terminal repeat (DNA negative strand; nucleotides +107 to +147); a complementary binding with a continuous homology of 16 nucleotides was identified. It is proposed that the Tat.TAR complex functions as a small ribonucleoprotein particle during transcription initiation of HIV mRNA.

Base Sequence↗
PubMed1998

Plasticity- and neurodegeneration-linked cyclic-AMP responsive element modulator/inducible cyclic-AMP early repressor messenger RNA expression in the rat brain.

In order to explore the role of CREM (cyclic-AMP responsive element modulator) gene expression in the function of the central nervous system, the gene transcripts were investigated in the rat brain in several conditions linked to increased neuronal activity. Up-regulation of CREM messenger RNA levels in the hippocampus was found to follow intraperitoneal administration of kainate (10 mg/kg). This increase was observed in both the dentate gyrus and hippocampus proper (CA subfields) and reached its maximum at 6 h after the treatment. Intrahippocampal injection of N-methyl-D-aspartate (200 nmol) resulted in elevated CREM messenger RNA expression as well. A similar increase of the messenger RNA abundance was also observed in the retrosplenial cortex after treating the female rats with a high dose (5 mg/kg) of dizocilpine maleate, an N-methyl-D-aspartate receptor antagonist. All these conditions are linked to neuronal excitation and neurodegeneration. However, an increase in CREM messenger RNA accumulation was also observed in the visual cortex after exposure of dark-adapted animals to the light, a procedure linked to neuronal plasticity. In the latter condition, it was found that CREM messenger RNA reached its highest levels at 6 h, i.e. later than the maximal increase of expression of immediate early genes such as c-fos, jun B and zif268, observed 45 min following the onset of visual stimulation. The ICER (inducible cyclic-AMP early repressor) form of CREM messenger RNA was identified to be induced by the light exposure. Finally, it was also found that cycloheximide, an inhibitor of protein synthesis, overinduces CREM/ICER gene expression. Together, these data suggest that CREM/ICER may be responsive to neuronal activation. Furthermore, given that CREM products have been shown previously to down-regulate expression of immediate early genes in vitro, they suggest that ICER may function as a molecular switch involved in down-regulation of immediate early gene expression in the rat brain.

Animals↗
PubMed2004

Glycogen synthase kinase-3 regulates IGFBP-1 gene transcription through the thymine-rich insulin response element.

BACKGROUND: Hepatic expression of several gene products involved in glucose metabolism, including phosphoenolpyruvate carboxykinase (PEPCK), glucose-6-phosphatase (G6Pase) and insulin-like growth factor binding protein-1 (IGFBP-1), is rapidly and completely inhibited by insulin. This inhibition is mediated through the regulation of a DNA element present in each of these gene promoters, that we call the Thymine-rich Insulin Response Element (TIRE). The insulin signalling pathway that results in the inhibition of these gene promoters requires the activation of phosphatidylinositol 3-kinase (PI 3-kinase). However, the molecules that connect PI 3-kinase to these gene promoters are not yet fully defined. Glycogen Synthase Kinase 3 (GSK-3) is inhibited following activation of PI 3-kinase. We have shown previously that inhibitors of GSK-3 reduce the activity of two TIRE-containing gene promoters (PEPCK and G6Pase), whose products are required for gluconeogenesis. RESULTS: In this report we demonstrate that in H4IIE-C3 cells, four distinct classes of GSK-3 inhibitor mimic the effect of insulin on a third TIRE-containing gene, IGFBP-1. We identify the TIRE as the minimum requirement for inhibition by these agents, and demonstrate that the target of GSK-3 is unlikely to be the postulated TIRE-binding protein FOXO-1. Importantly, overexpression of GSK-3 in cells reduces the insulin regulation of TIRE activity as well as endogenous IGFBP-1 expression. CONCLUSIONS: These results implicate GSK-3 as an intermediate in the pathway from the insulin receptor to the TIRE. Indeed, this is the first demonstration of an absolute requirement for GSK-3 inhibition in insulin regulation of gene transcription. These data support the potential use of GSK-3 inhibitors in the treatment of insulin resistant states such as Type 2 diabetes mellitus, but suggest that it will be important to identify all TIRE-containing genes to assess potential side effects of these agents.

Animals↗
PubMed1999

An atypical iron-responsive element (IRE) within crayfish ferritin mRNA and an iron regulatory protein 1 (IRP1)-like protein from crayfish hepatopancreas.

A putative crayfish iron-responsive element (IRE) is present in the 5'-untranslated region of the crayfish ferritin mRNA. The putative crayfish IRE is in a cap-proximal position and shares most of the structural features of the consensus IRE, but the RNA stem-loop structure contains a bulge of a guanine instead of a cytosine at the expected position, so far thought to be a hallmark of IREs. By using an electromobility shift assay this IRE was shown to specifically bind purified recombinant human iron regulatory protein 1 (IRP1) as well as a factor(s) present in a homogenate of crayfish hepatopancreas, likely to be a crayfish IRP1 homologue. With mutations in the crayfish IRE, the affinity of IRP to IRE was drastically decreased. A cDNA encoding an IRP1-like protein was cloned from the hepatopancreas of crayfish. This protein has sequence similarities to IRP, and contains all the active-site residues of aconitase, two putative RNA-binding regions and a putative contact site between RNA and IRP. These results show that a crayfish IRE, lacking the bulged C, can bind IRP1 in vitro and that an IRP1-like protein present in crayfish hepatopancreas may have both aconitase and RNA-binding activities.

Amino Acid Sequence↗
PubMed2004

Nrf2 transcriptionally activates the mafG gene through an antioxidant response element.

Nrf2 accumulates in nuclei upon exposure to oxidative stress, heterodimerizes with a small Maf protein, and activates the transcription of stress target genes through antioxidant response elements (AREs). We found that diethyl maleate (DEM), a well known activator of Nrf2, induces one of the small Maf genes, mafG. To elucidate roles MafG might play in the oxidative stress response, we examined transcriptional regulation of the mouse mafG gene. MafG utilizes three independent first exons that are each spliced to second and third coding exons. Among the small maf genes, mafG showed the strongest response to DEM, and of the three first exons, the highest -fold induction was seen with the proximal first exon (Ic). Importantly, one ARE (Ic-ARE) is conserved in the promoter flanking exon Ic of the human and mouse mafG genes. The Nrf2/MafG heterodimer bound the Ic-ARE and activated transcription, whereas DEM failed to activate mafG in nrf2-null mutant cells. Chromatin immunoprecipitation further revealed that both Nrf2 and small Maf proteins associate with the Ic-ARE in vivo. These results demonstrate that mafG is itself an ARE-dependent gene that is regulated by an Nrf2/small Maf heterodimer and suggest the presence of an autoregulatory feedback pathway for mafG transcriptional regulation.

Animals↗
PubMed2003

Identification of a Vitamin D response element in the human insulin receptor gene promoter.

The present study was designed to explore the possible presence and location of Vitamin D response elements (VDREs) in the human insulin receptor (hIR) gene promoter. To this end, the -1819 to -271 bp fragment of the hIR promoter (wild type promoter) and progressive 5' deletions of this promoter (up to -1473 and -876 bp) were linked to the luciferase pGL2-basic vector to construct the reported plasmids: phIR (-1819)-GL2, phIR(-1473)-GL2 and phIR(-876)-GL2, respectively. U-937 cells were transiently transfected with these plasmids, and then the cells were either untreated or treated for 24h with 10(-8) M 1,25-dihydroxyvitamin D(3) (1,25D(3)). Luciferase determinations revealed that, while the activity of the wild promoter was increased 1.6-fold by the hormone, the activities of progressive 5' deletions of this promoter were enhanced 1.7-, and 1.6-fold, respectively. Thus, the region extending from -876 to -271bp of the hIR promoter, appears to contain VDREs, and to be sufficient for induction by 1,25D(3). In order to identify these potential VDREs, we performed a computer search of candidate sequences by homology with a consensus VDRE sequence. This search yielded a sequence located between -761 and -732 bp (5'CGTCGGGCCTGTGGGGCGCCTCCGGGGGTC3'), which includes an overlapping AP-2 like sequence, as a good candidate. Electrophoretic mobility shift assays revealed that the Vitamin D receptor (VDR) specifically recognized this sequence, since a VDR-DNA complex was able to compete with the unlabeled probe and was cleared by the specific anti-VDR antibody 9A7. These data represent the first identification of a VDRE in the hIR gene promoter.

Cell Line↗
PubMed2000

Mechanism of neomycin and Rev peptide binding to the Rev responsive element of HIV-1 as determined by fluorescence and NMR spectroscopy.

Rev is an essential HIV-1 regulatory protein that binds the Rev responsive element (RRE) within the env gene of the HIV-1 RNA genome and is involved in transport of unspliced or partially spliced viral mRNA from the cell nucleus to the cytoplasm. Previous studies have shown that a short alpha-helical peptide derived from Rev (Rev 34-50), and a truncated form of the RRE sequence provide a useful in vitro system to study this interaction while still preserving the essential aspects of the native complex. We have selectively incorporated the fluorescent probe 2-aminopurine 2'-O-methylriboside (2-AP) into the RRE sequence in nonperturbing positions (A68 and U72) such that the binding of both Rev peptide and aminoglycoside ligands could be characterized directly by fluorescence methods. Rev peptide binding to the RRE-72AP variant resulted in a 2-fold fluorescence increase that provided a useful signal to monitor this binding interaction (K(D) = 20 +/- 7 nM). Using stopped-flow kinetic measurements, we have shown that specific Rev peptide binding occurs by a two-step process involving diffusion-controlled encounter, followed by isomerization of the RNA. Using the RRE-68AP and -72AP constructs, three classes of binding sites for the aminoglycoside neomycin were unambiguously detected. The first site is noninhibitory to Rev binding (K(D) = 0.24 +/- 0.040 microM), the second site inhibited Rev binding in a competitive fashion (K(D) = 1. 8 +/- 0.8 microM), and the third much weaker site (or sites) is attributed to nonspecific binding (K(D) >/= 40 microM). Complementary NMR measurements have shown that neomycin forms both a specific binary complex with RRE and a specific ternary complex with RRE and Rev. NMR data further suggest that neomycin occupies a similar high-affinity binding site in both the binary and ternary complexes, and that this site is located in the lower stem region of RRE.

2-Aminopurine↗
PubMed1996

Receptors for interleukin (IL)-10 and IL-6-type cytokines use similar signaling mechanisms for inducing transcription through IL-6 response elements.

The cytoplasmic domain of the receptor for interleukin 10 (IL-10R) contains two box 3 sequence motifs that have been identified in the signal-transducing receptor subunits for IL-6-type cytokines and noted to be required for activating STAT3 and inducing transcription through IL-6-responsive elements. To determine whether the IL-10R has signaling functions similar to IL-6R in cells normally expressing these receptors, leukocytes of the B-, T-, and NK-cell lineages were treated with either cytokine. Both cytokines activated factors that bound to the sis-inducible element and included STAT1 and STAT3. The cell response to IL-10 characteristically differed from that to IL-2/IL-15, IL-4, and interferon gamma. The signaling capabilities of the IL-10R for activating specific STAT proteins and inducing gene transcription were defined by reconstitution of receptor functions in transfected tissue culture cells. COS-1 cells, co-expressing the human IL-10R and individual STAT proteins, confirmed a preference of the IL-10R for STAT3 and STAT1. Unlike many hematopoietin receptors, the IL-10R did not detectably activate STAT5. The IL-10R, together with reporter gene constructs containing different IL-6-responsive gene elements, reconstituted in hepatoma cells an induction of transcription by IL-10 that was comparable to that by IL-6. This regulation could not be appreciably modified by enhanced expression of STAT proteins. The similar actions of IL-10R and IL-6R on the induction of endogenous IL-6-responsive genes were demonstrated in hepatoma cells stably expressing the IL-10R. These receptor functions required the presence of the box 3 motifs, as shown by the analysis of the mouse IL-10R constructs containing progressively truncated cytoplasmic domains. The data demonstrate that the IL-10R, unlike other members of the interferon receptor family, is highly effective in recruiting the signaling pathways of IL-6-type cytokine receptors.

Acute-Phase Proteins↗