Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “inverted terminal repeat”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,117 records · Page 62Linked to original sources
PubMed1995

Transcriptional analyses of the unique short segment of EHV-1 strain Kentucky A.

The unique short (Us) segment of the genome of equine herpesvirus type 1 (EHV-1) strain KyA is comprised of six open reading frames (ORFs) that encode: a) a homolog of the Us2 protein of herpes simplex virus type 1 (HSV-1); b) a serine threonine protein kinase that is a homolog of the HSV-1 Us3 protein; c) a homolog of pseudorabies virus glycoprotein gX and HSV-2 gG; d) a novel glycoprotein, EUS4, not encoded by other herpesviruses sequenced to date; e) a homolog of HSV-1 gD; and f) a homolog of HSV-1 Us9. The KyA strain is a deletion mutant that lacks Us sequences encoding gI, gE, and a potential 10 kD polypeptide, and thus may be useful as a parent virus for the generation of live virus vaccines. To complete the elucidation of the transcriptional program of the Us segment, Northern blot hybridization and S1 nuclease analyses were performed on poly(A)(+)-selected RNA isolated from infected cells maintained under early (phosphonoacetic acid-block) and late conditions. The findings revealed that the gene (EUS2 ORF) encoding the protein kinase is expressed as an early 2.9 kb transcript that overlaps and is 3' coterminal with a 1.6 kb early transcript that encodes the gG/gX homolog (EUS3 ORF). Two transcripts of 1.6 kb and 5.8 kb are 5' coterminal and may both encode the novel glycoprotein gene EUS4. The 1.6 kb transcript terminates at a poly(A) signal site downstream of the EUS4 ORF, and the 5.8 kb transcript terminates within the inverted repeat (IR) segment. Overall, the transcriptional program of the EHV-1 KyA Us segment is complex and exhibits similarities to that of HSV-1 Us segment: a) transcripts arise from both DNA strands; b) some transcripts, including those mapping at the termini of the Us segment, extend into the IR segments and are 3' coterminal with the 1.2 kb IR6 transcript; c) at least one transcript reads through a functional polyadenylation signal; d) some transcripts encoding genes that lie in different reading frames exist as a family of overlapping mRNAs, some in an anti-sense manner. Lastly, of the six Us genes of the EHV-1 KyA strain, only those encoding the EHV-1 protein kinase and the HSV-2 gG/gX homolog are members of the early kinetic class.

Base Sequence↗
PubMed1993

SIRE-1, a long interspersed repetitive DNA element from soybean with weak sequence similarity to retrotransposons: initial characterization and partial sequence.

Gm776 is a 776-bp subregion of a member of an interspersed family of relatively homogeneous repetitive DNA elements from soybean (Glycine max). The fragment was originally amplified from soybean DNA by the polymerase chain reaction using a single 22-nucleotide primer, and consequently terminates in an inverted repeat. The elements defined by Gm776 are at least 10.6 kb in length and constitute a family of 500-800 members per haploid genome. The family has been designated SIRE-1 (soybean interspersed repetitive element 1). Overlapping regions of Gm776 exhibit suggestive DNA sequence similarity to Ta1 and Ty1, copia-like retrotransposons from Arabidopsis thaliana and Saccharomyces cerevisiae, respectively. However, there are no similarities at the amino acid level, and the regions of similarity are not functionally related.

Base Sequence↗
PubMed2003

Regulatory C protein of the EcoRV modification-restriction system.

The C gene product of the modification-restriction system PvuII binds to its own promoter (C box) and stimulates transcription of both the C gene and the endonuclease gene. According to our data the same regulatory mechanism is realized in the EcoRV system. It was found that upstream of the EcoRV endonuclease gene two ATG codons give rise to two open reading frames (ORF1 and ORF2) ending at the same point inside the endonuclease gene. Two DNA fragments corresponding to ORF1 and ORF2 were cloned, and the homogenous products of proteins encoded by them were found to be DNA-binding proteins. A specific DNA sequence (C box) recognized by the proteins was determined with DNAse I footprinting. The C box CCCATTTTGGGTTATCCCATTTTGGG is located inside ORF1 and, similar to the PvuII C box consisting of tandem repeats of 11 nucleotides, is divided by four nucleotides. In its turn each of the repeats contains inverted repeats of four terminal nucleotides. The EcoRV C box sequence differs both from the PvuII C box sequence and from the proposed consensus sequence of C boxes in other modification-restriction systems.

Base Sequence↗
PubMed2003

Isolation and analysis of a new hopper hAT transposon from the Bactrocera dorsalis white eye strain.

A new hopper element belonging to the hAT transposon family was isolated from the white eye mutant strain of the Oriental fruit fly, Bactrocera dorsalis. Using the original hopper element sequence from the wild type Kahuku strain as a template, the new hopper was isolated by inverse and direct PCR. Nucleotide sequence analysis reveals a 3131 bp element with terminal and subterminal inverted repeat sequences, an 8 bp duplicated insertion site, and a conceptual translation yielding a single uninterrupted 650 amino acid open reading frame. The white eye hopper has structure more consistent with function than the Kahuku element, indicating that hopper is not an ancient relic. The hopper element remains distantly related to other known hAT elements including those from insects, and presently it is most similar to Activator-related elements discovered in the human genome. DNA hybridization studies indicate, however, that elements closely related to hopper exist in another bactrocerid species, the melonfly, B. cucurbitae.

Amino Acid Sequence↗
PubMed1984

Complete nucleotide sequence of the E. coli glutathione synthetase gsh-II.

The nucleotide sequence of the cloned DNA, 1,478 bp in length coding for glutathione synthetase (GSH-II) of E. coli B has been determined. Amino acid and nucleotide sequence analyses have assigned the open reading frame for GSH-II, starting with the ATG near its 5' terminus. The molecular weight calculated from the predicted amino acid sequence is 35,559 daltons, being in good agreement with that of a GSH-II subunit estimated by the SDS-PAGE method. Several signal sequences conserved in the promoter regions of E. coli were found in the non-coding regions of the gsh-II gene. They include the Shine-Dalgarno sequence, the Pribnow box and the sequence conserved in the "-35 region" with a preferable spacing from each other for an efficient transcription. Downstream from the termination codon, the inverted repeat sequences were present, followed by 6 successive T's. These structural features found in the non-coding regions have suggested to be involved in regulatory functions for the gsh-II gene expression.

Amino Acid Sequence↗
PubMed1985

Complete nucleotide sequence of the E. coli N-acetylneuraminate lyase.

The nucleotide sequence of the cloned DNA, 1,243 bp in length coding for N-acetylneuraminate lyase (N-acetylneuraminate pyruvate lyase; NPL) of Escherichia coli has been determined. Nucleotide sequence and amino acid analysis have assigned the open reading frame for NPL, starting with the ATG near its 5'terminus. The molecular weight calculated from the predicted amino acid sequence was 32,640 daltons, being in good agreement with that of a NPL subunit estimated by the SDS-PAGE method and amino acid composition. Several signal sequences conserved in the promoter regions of E. coli were found in the npl gene. They were the Shine-Dalgarno sequence, the Pribnow box and the sequence coserved in the "-35 region" and they were separated to each other with preferable spacing for an efficient transcription. Downstream from the termination codon, the inverted repeat sequence was present, followed by 4 successive T's.

Amino Acid Sequence↗
PubMed1986

Nucleotide sequence of the gene responsible for D-xylose uptake in Escherichia coli.

The nucleotide sequence of the cloned DNA, 363 bp in length, has been determined. It can complement the mutation of Escherichia coli having a decreased activity of D-xylose uptake at low temperature. Nucleotide sequence analysis found one possible reading frame coding for a polypeptide consisting of 61 amino acids. Several signal sequences conserved in the promoter regions of E. coli were found in the upstream regions of the open frame. This included the Shine-Dalgarno sequence, the Pribnow box, and the sequence conserved in the "-35 region" with a preferable spacing from each other for an efficient transcription. Downstream from the termination codon, the inverted repeat sequence was present, followed by 3 successive T's.

Bacterial Proteins↗
PubMed1989

Sequence and characteristics of IS900, an insertion element identified in a human Crohn's disease isolate of Mycobacterium paratuberculosis.

The complete sequence of an insertion element IS900 in Mycobacterium paratuberculosis is reported. This is the first characterised example of a mycobacterial insertion element. IS900 consists of 1451bp of which 66% is G + C. It lacks terminal inverted and direct repeats, characteristic of Escherichia coli insertion elements but shows a degree of target sequence specificity. A single open reading frame (ORF 1197) coding for 399 amino acids is predicted. This amino acid sequence, and to a lesser extent the nucleotide sequence, show significant homologies to IS110, an insertion element of Streptomyces coelicolor A3(2). It is proposed that IS900, IS110, and similar insertion elements recently identified in disease isolates of Mycobacterium avium are members of a phylogenetically related family. IS900 will provide highly specific markers for the precise identification of Mycobacterium paratuberculosis, useful in defining its relationship to animal and human diseases.

Amino Acid Sequence↗
PubMed1980

Nucleotide sequences at the ends of the mercury resistance transposon, Tn501.

The nucleotide sequences at the ends of the mercury-resistance transposon, Tn501, have been determined. The terminal sequences are inverted repeated sequences 38 nucleotide pairs in length, which differ in 3 nucleotide pairs. The transposon is flanked by directly repeated sequences of 5 nucleotide pairs, originating from a single pentanucleotide sequence in the recipient replicon. There is no obvious homology between recipient replicons at the site of insertion of the transposon. The structures of the ends of Tn501 are compared with those of other transposons and insertion sequences. The use of Tn501 to locate an EcoRI site within a genetically defined sequence of interest is discussed.

Base Sequence↗
PubMed2000

Genetic linkage of the vanB2 gene cluster to Tn5382 in vancomycin-resistant enterococci and characterization of two novel insertion sequences.

VanB-type vancomycin resistance is encoded by the vanB gene cluster, which disseminates by horizontal gene transfer and clonal spread of vancomycin-resistant enterococci (VRE). Genetic linkage of the vanB gene cluster to transposon Tn5382 and the insertion sequences IS16 and IS256-like has previously been shown. In this study linkage of defined vanB gene cluster subtypes to these elements was examined. All the vanB2 subtype strains studied (n=14) revealed co-hybridization of vanB and Tn5382, whereas the strains of vanB1 (n=8) and vanB3 (n=1) subtypes were Tn5382 negative. Conjugative cotransfer of the vanB2 gene cluster and Tn5382 was demonstrated for two strains. DNA sequencing of the vanX(B)-ORFC region in vanB2 strains confirmed that the vanB2 gene cluster is an integral part of Tn5382. No general pattern of linkage was observed with regard to IS16 and IS256-like. Two novel insertion sequences were identified in specific vanB2 subtype strains. (i) A 1611 bp element (ISEnfa110) was detected in the left flank of Tn5382. Its insertion site, lack of terminal inverted and direct repeats, and two conserved motifs in its putative transposase all conform to the conventions of the IS110 family. (ii) A 787 bp element (ISEnfa200) was detected in the vanS(B)-vanY(B) intergenic region. Its ORF encoded a putative protein with 60-70% identity to transposases of the IS200 family. No further copies of ISEnfa110 were found by colony hybridization of 181 enterococcal isolates, whereas ISEnfa200 was found in four additional vanB2 strains from the USA. The five strains had identical ISEnfa200 element insertion sites, and Tn5382 was located downstream from a pbp5 gene conferring high-level ampicillin resistance. These isolates showed related PFGE patterns, suggesting possible clonal spread of a VRE strain harbouring a Tn5382-vanB2-ISEnfa200 element linked to a pbp5 gene conferring ampicillin resistance.

Animals↗
PubMed1989

A novel family of potentially mobile DNA elements encoding site-specific gene-integration functions: integrons.

A family of novel mobile DNA elements is described, examples of which are found at several independent locations and encode a variety of antibiotic resistance genes. The complete elements consist of two conserved segments separated by a segment of variable length and sequence which includes inserted antibiotic resistance genes. The conserved segment located 3' to the inserted resistance genes was sequenced from Tn21 and R46, and the sequences are identical over a region of 2026 bases, which includes the sulphonamide resistance gene sull, and two further open reading frames of unknown function. The complete sequences of both the 3' and 5' conserved regions of the DNA element have been determined. A 59-base sequence element, found at the junctions of inserted DNA sequences and the conserved 3' segment, is also present at this location in the R46 sequence. A copy of one half of this 59-base element is found at the end of the sull gene, suggesting that sull, though part of the conserved region, was also originally inserted into an ancestral element by site-specific integration. Inverted or direct terminal repeats or short target site duplications, both of which are characteristics of class I and class II transposons, are not found at the outer boundaries of the elements described here. Furthermore, the conserved regions do not encode any proteins related to known transposition proteins, except the DNA integrase encoded by the 5' conserved region which is implicated in the gene insertion process. Mobilization of this element has not been observed experimentally; mobility is implied from the identification of the element in at least four independent locations, in Tn21, R46 (IncN), R388 (IncW) and Tn1696. The definitive features of these novel elements are (i) that they include site-specific integration functions (the integrase and the insertion site); (ii) that they are able to acquire various gene units and act as an expression cassette by supplying the promoter for the inserted genes. As a consequence of acquiring different inserted genes, the element exists in a variety of forms which differ in the number and nature of the inserted genes. This family of elements appears formally distinct from other known mobile DNA elements and we propose the name DNA integration elements, or integrons.

Amino Acid Sequence↗
PubMed1993

The primary structure of branched-chain alpha-oxo acid dehydrogenase from Bacillus subtilis and its similarity to other alpha-oxo acid dehydrogenases.

The bfmB mutant of Bacillus subtilis requires branched short-chain carboxylic acids for growth because the organism is known to be defective in branched-chain alpha-oxo acid dehydrogenase. The DNA in the region of bfmB has now been cloned and sequenced, and the gene has been analyzed. The results show that there are three open reading frames in the area, each of which is preceded by a putative ribosome binding site, and the last of which is followed by a putative transcription termination site with inverted repeats. The amino acid sequences deduced by analysis of the reading frames are highly similar (with 32-49% identity) to the E1 alpha, El beta and E2 components of pyruvate, 2-oxoglutarate and branched-chain alpha-oxo acid dehydrogenases from different sources. The thiamin diphosphate binding, putative subunit interaction and phosphorylation sites of the E1 alpha of four reported branched-chain alpha-oxo acid dehydrogenases from different sources are very similar to those of the first open reading frame (E1 alpha) of bfmB. A similar result is also obtained with the lipoyl-binding site (lysine) and its domain of the E2 component of alpha-oxo acid dehydrogenases from different sources. The present data, along with the reported biochemical data, lead to the conclusion that bfmB encodes a branched-chain alpha-oxo acid dehydrogenase, which is composed of E1 alpha, E1 beta and E2 genes. This organization is identical to that of the 2-oxoglutarate dehydrogenase in B. subtilis.

3-Methyl-2-Oxobutanoate Dehydrogenase (Lipoamide)↗
PubMed1995

Analysis of the sequence of a new cryptic plasmid, pRJF2, from a rumen bacterium of the genus Butyrivibrio: comparison with other Butyrivibrio plasmids and application in the development of cloning vector.

A small cryptic plasmid, pRJF2, from Butyrivibrio fibrisolvens strain OB157 was isolated and sequenced. The plasmid is similar in organisation to the previously sequenced Butyrivibrio plasmid, pRJF1, with two open reading frames, ORF1 and ORF2, flanking a region tentatively identified as the replication origin, and a region of unknown function defined by terminal 79 bp invert repeats. The sequences of ORF1, ORF2, and the presumptive replication origin are highly conserved. The sequence between the 79, bp invert repeats is not, and is therefore presumed to be of lesser functional significance, although the 5' and 3' termini are still highly conserved. The functional importance for plasmid replication of these regions was tested by constructing potential shuttle vectors, each lacking one or more of the regions of interest. When the region between the invert repeats was deleted and replaced by the erythromycin resistance gene from pAM beta 1 together with pUC18, to produce the 7.9 kb chimaeric plasmid pYK4, the construct was successfully transformed into E. coli and B. fibrisolvens by electroporation, and was stably maintained in both hosts. Both ORF1 and ORF2 were required for successful transformation of B. fibrisolvens.

Amino Acid Sequence↗
PubMed2004

Salmonella enterica serovar Paratyphi C carries an inactive shufflon.

Salmonella enterica serovar Typhi uses type IVB pili to facilitate bacterial self-association, but only when the PilV proteins (potential minor pilus proteins) are not synthesized. This pilus-mediated event may be important in typhoid fever pathogenesis. We initially show that S. enterica serovar Paratyphi C strains harbor a pil operon very similar to that of serovar Typhi. An important difference, however, is located in the shufflon which concludes the pil operon. In serovar Typhi, the Rci recombinase acts upon two 19-bp inverted repeats to invert the terminal region of the pilV gene, thereby disrupting PilV synthesis and permitting bacterial self-association. In serovar Paratyphi C, however, the shufflon is essentially inactive because each of the Rci 19-bp substrates has acquired a single base pair insertion. A PilV protein is thus synthesized whenever the pil operon is active, and bacterial self-association therefore does not occur in serovar Paratyphi C. The data thus suggest that serovar Typhi bacterial self-association using type IVB pili may be important in the pathogenesis of epidemic enteric fever.

Antigens, Bacterial↗
PubMed1990

Structural and functional characterization of tnpI, a recombinase locus in Tn21 and related beta-lactamase transposons.

A novel discrete mobile DNA element from Tn21 from the plasmid R100.1 is described, and its mobilization function was confirmed experimentally. In addition, the element behaves as a recombinase-active locus (tnpI) which facilitates insertions of antibiotic resistance genes as modules or cassettes at defined hot spots or integration sites. A similar tnpI sequence was detected by DNA hybridization in a series of beta-lactamase transposons and plasmids and localized on their physical maps. The genetic function of the locus cloned from Tn21 into pACYC184 was tested for conduction and integration into the plasmids R388 and pOX38Km, and the results suggested recombinase-integrase activity and recA independence. DNA sequence analysis of the tnpI locus revealed no inverted or direct terminal repeats or transposition features of class I and class II transposons. The coding capacity revealed three putative open reading frames encoding 131, 134, and 337 amino acids. Orf3 encoded a putative polypeptide product of 337 amino acids that shared highly significant identity with the carboxyl region of integrase proteins. A comparison and an alignment of the tnpI locus from Tn21 and its flanking sequences identified similar sequences in plasmids and in transposons. The alignment revealed discrete nucleotide changes in these tnpI-like loci and a conserved 3' and 5' GTTA/G hot spot as a duplicated target site. Our data confirm the remarkable ubiquity of tnpI associated with antibiotic resistance genes. We present a model of transposon modular evolution into more complex multiresistant units via tnpI and site-specific insertions, deletions, and DNA rearrangements at this locus.

Amino Acid Sequence↗
PubMed2001

Identification and characterization of Tn4656, a novel class II transposon carrying a set of toluene-degrading genes from TOL plasmid pWW53.

It has been reported that the toluene-degrading (xyl) genes from Pseudomonas putida plasmid pWW53 are able to translocate to broad-host-range drug resistance plasmid RP4, and pWW53-4 is one of the smallest RP4 derivatives (H. Keil, S. Keil, R. W. Pickup, and P. A. Williams, J. Bacteriol. 164:887-895, 1985). Our investigation of pWW53-4 in this study demonstrated that such a translocated region that is 39 kb long is a transposon. This mobile element, Tn4656, was classified as a class II transposon since its transposition occurred by a two-step process: transposase (TnpA)-mediated formation of the cointegrate and resolvase (TnpR)-mediated site-specific resolution of the cointegrate at the two copies of the res site. The Tn4656 TnpA and TnpR functions encoded in the rightmost 4-kb region were found to be exchangeable with those specified by other Tn1721-related class II transposons, including another toluene transposon, Tn4653. Sequence analysis of the transposition-related genes and sites of Tn4656 also supported the hypothesis that this transposon is closely related to the Tn1721-related transposons. The lower transposition frequency of Tn4656 has been suggested to be due to the unique nucleotide sequence of one of the terminal 39-bp inverted repeats.

Bacterial Proteins↗
PubMed1999

Evolution of a functionally related lactate dehydrogenase and pyruvate decarboxylase pseudogene complex in maize.

A large proportion of the maize genome is repetitive DNA (60-80%) with retrotransposons contributing significantly to the repetitive DNA component. The majority of retrotransposon DNA is located in intergenic regions and is organized in a nested fashion. Analysis of an 8.2-kb segment of maize genomic DNA demonstrated the presence of three retrotransposons of different reiteration classes in addition to lactate dehydrogenase and pyruvate decarboxylase pseudogenes. Both of the pseudogenes were located within a defective retrotransposon element (LP-like element) which possessed identical long terminal repeats (LTRs) with inverted repeats at each end, a primer binding site, a polypurine tract, and generated a 5-bp target site duplication. A model describing the events leading to the formation of the LP-like element is proposed.

Base Sequence↗
PubMed1990

Evidence of introduction by molecular cloning of artificial inverted sequence at the 5' terminus of the sense strand of rat insulin-like growth factor-I cDNA.

A cDNA of insulin-like growth factor (IGF)-I mRNA was obtained from a rat liver cDNA library. This cDNA contained a 5' terminal sequence of 48 base pairs complementary to a sequence in the 3' terminal region (an inverted repeat sequence) except for one nucleotide insertion in the 3' region. Base sequence analysis of this cDNA, northern blot analysis of rat liver mRNA using a probe specific to 5' region of cDNA, base sequence studies of the 5' upstream region of a clone of the rat IGF-I gene, and some other studies suggested strongly that the inverted repeat sequence of the IGF-I cDNA used was introduced artificially during preparation of the cDNA library.

Amino Acid Sequence↗