Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Elements”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,117 records · Page 62Linked to original sources
PubMed1999

Nuclear protein binding at the beta-myosin heavy chain A/T-rich element is enriched following increased skeletal muscle activity.

In adult mouse skeletal muscle, beta-myosin heavy chain (betaMyHC) gene expression is primarily restricted to slow-type I fibers but can be induced in fast-type II fibers by mechanical overload (MOV). Our previous transgenic analyses have delimited an 89-base pair (bp) MOV-responsive region (-293 to -205), and shown that mutation of the MCAT and C-rich elements within this region did not abolish betaMyHC transgene induction by MOV. In this study we describe an A/T-rich element (betaA/T-rich; -269 5'-GGAGATATTTTT-3' -258) located within this 89-bp region that, only under MOV conditions, revealed enriched binding as characterized by electrophoretic mobility shift assays and dimethyl sulfate and diethyl pyrocarbonate interference footprinting. Direct, competition, and supershift electrophoretic mobility shift assays revealed highly enriched specific binding activity at the betaA/T-rich element that was antigenically distinct from GATA-4, MEF2A-D, SRF, and Oct-1, nuclear proteins that were previously shown to bind A/T-rich elements. In vitro translated GATA-4, MEF2C, SRF, and Oct-1 bound to consensus GATA, MEF2, SRE, and Oct-1 elements, respectively, but not to the betaA/T-rich element. Two-dimensional UV cross-linking of the bromodeoxyuridine-substituted betaA/T-rich element with mechanically overloaded plantaris (MOV-P) nuclear extract detected two proteins (44 and 48 kDa). Our results indicate that the betaA/T-rich element may function in vivo as a betaMyHC MOV-inducible element during hypertrophy of adult skeletal muscle by binding two distinct proteins identified only in MOV-P nuclear extract.

AT Rich Sequence↗
PubMed2002

Two initiator-like elements are required for the combined activation of the human apolipoprotein C-III promoter by upstream stimulatory factor and hepatic nuclear factor-4.

Human apoC-III (-890/+24) promoter activity is strongly activated by hepatic nuclear factor (HNF)-4 through its binding to the proximal (-87/-72) element B. This site overlaps the binding site for an activity that we identified as the ubiquitously expressed upstream stimulatory factor (USF) (Ribeiro, A., Pastier, D., Kardassis, D., Chambaz, J., and Cardot, P. (1999) J. Biol. Chem. 274, 1216-1225). In the present study, we characterized the relationship between USF and HNF-4 in the activation of human apoC-III transcription. Although USF and HNF-4 binding to element B is mutually exclusive, co-transfection experiments in HepG2 cells surprisingly showed a combined effect of USF and HNF-4 in the transactivation of the (-890/+24) apoC-III promoter. This effect only requires the proximal region (-99/+24) of the apoC-III promoter and depends neither on USF binding to its cognate site in element B nor on a USF-dependent facilitation of HNF-4 binding to its site. By contrast, we found by electrophoretic mobility shift assay and footprinting analysis two USF low affinity binding sites, located within the proximal promoter at positions -58/-31 (element II) and -19/-4 (element I), which are homologous to initiator-like element sequence. Co-transfection experiments in HepG2 cells show that a mutation in element II reduces 2-fold the USF transactivation effect on the proximal promoter of apoC-III and that a mutation in element I inhibits the combined effect of USF and HNF-4. In conclusion, these initiator-like elements are directly involved in the transactivation of the apoC-III promoter by USF and are necessary to the combined effect between USF and HNF-4 for the apoC-III transcription.

Apolipoprotein C-III↗
PubMedDate not supplied

Systemic absorption of selenious acid and elemental selenium aerosols in rats.

Absorption of Se from the nasal passages, lungs, gastrointestinal tract, and skin was studied in Fischer-344 rats. Radiolabeled selenious acid and elemental Se particles were administered by inhalation, gavage, nasal instillation, and iv injection. Selenious acid was always absorbed into the general circulation more rapidly and to a greater extent than elemental Se. By 4 h after inhalation of selenious acid and elemental Se aerosols, 94% of the selenious acid and 57% of the elemental Se deposited in lungs was absorbed into blood. Of the selenious acid instilled into nasal passages, 18% was absorbed into blood; 16% of the elemental Se was absorbed. Gastrointestinal absorption was 87% for selenious acid and 50% for elemental Se. Selenious acid solutions were also painted onto the pelts of rats. From 10 to 30% of the selenious acid was absorbed through the skin. Following inhalation or injection of either Se compound, most of the Se was excreted in the urine. Significantly more Se appeared in feces of animals receiving elemental Se by gavage than animals receiving selenious acid. Results indicate that if people were to absorb inhaled Se from the upper respiratory tract in a manner similar to that of rats, one-third more selenious acid would be absorbed into the general circulation than elemental Se. All Se deposited in the lungs would be absorbed into blood. However, selenious acid would be absorbed more rapidly than elemental Se.

Absorption↗
PubMed2001

A role for actin, Cdc1p, and Myo2p in the inheritance of late Golgi elements in Saccharomyces cerevisiae.

In Saccharomyces cerevisiae, Golgi elements are present in the bud very early in the cell cycle. We have analyzed this Golgi inheritance process using fluorescence microscopy and genetics. In rapidly growing cells, late Golgi elements show an actin-dependent concentration at sites of polarized growth. Late Golgi elements are apparently transported into the bud along actin cables and are also retained in the bud by a mechanism that may involve actin. A visual screen for mutants defective in the inheritance of late Golgi elements yielded multiple alleles of CDC1. Mutations in CDC1 severely depolarize the actin cytoskeleton, and these mutations prevent late Golgi elements from being retained in the bud. The efficient localization of late Golgi elements to the bud requires the type V myosin Myo2p, further suggesting that actin plays a role in Golgi inheritance. Surprisingly, early and late Golgi elements are inherited by different pathways, with early Golgi elements localizing to the bud in a Cdc1p- and Myo2p-independent manner. We propose that early Golgi elements arise from ER membranes that are present in the bud. These two pathways of Golgi inheritance in S. cerevisiae resemble Golgi inheritance pathways in vertebrate cells.

Actins↗
PubMed1994

Characterization of the proximal promoter and two silencer elements in the CYP2C11 gene expressed in rat liver.

The cytochrome P450 gene CYP2C11, expressed in the liver of male rats, is transcriptionally regulated in a dual fashion by the sexually dimorphic secretion pattern of growth hormone. To enable analysis of transcriptional regulatory DNA elements, rat genomic sequences were cloned. DNase I hypersensitivity analysis of rat liver nuclei revealed the existence of two hypersensitive sites whose presence in the vicinity of the transcription start site correlates to high transcriptional activity of the gene. Deletion mutants of the 5' flank were fused to reporter genes and transiently transfected into HepG2 cells or into primary adult rat hypatocytes. Transfection experiments in combination with DNase I footprinting analysis in vitro led to the identification of two negative regulatory regions spanning nucleotides -1,230 to -1,188 and -409 to -368 and designated (SIL1200) and (SIL400), respectively. When placed in front of the heterologous thymidine kinase promoter, SIL1200 and SIL400 reduced the activity of the chloramphenicol acetyl transferase reporter gene to 13% and 23% of the control value, respectively. No sex-dependent binding of liver nuclear extracts to the two silencers could be detected by in vitro footprinting or gel retardation assays. However, a sex-dependent footprint consistently stronger with male liver nuclear extracts than with female extracts was observed in the -320 to -294 region. A significant level of identity was found between the DNA sequence corresponding to this footprint and that of orphan steroid receptor elements as well as with that of a basal transcription element common to several CYP2C genes. However, the identity of a potential trans-acting factor binding between -320 and -294 or response of this element to growth hormone is as yet unknown. A sex- and GH secretory profile-dependent protein-DNA interaction in vitro was observed in the -107 to -95 region. In spite of the sequence similarity that exists between this region and the consensus binding site for HNF-1, this region does not bind HNF-1 alpha. This element acted as a repressor on the heterologous thymidine kinase promoter. To date, the two silencer elements and possibly also the HNF-1-like element are the only functional elements defined in the CYP2C11 gene, and it is conceivable that induction of the gene involves derepression of the silencer elements.

Animals↗
PubMed1997

High frequency cDNA recombination of the saccharomyces retrotransposon Ty5: The LTR mediates formation of tandem elements.

Retroelement cDNA can integrate into the genome using the element-encoded integrase or it can recombine with preexisting elements using the recombination system of the host. Recombination is a particularly important pathway for the yeast retrotransposon Ty5 and accounts for approximately 30% of the putative transposition events when a homologous substrate is carried on a plasmid and approximately 7% when the substrate is located at the chromosomal URA3 locus. Characterization of recombinants revealed that they are either simple replacements of the marker gene tandem elements. Using an assay system in which the donor element and recombination substrates are separated, we found that the long terminal repeats (LTRs) are critical for tandem element formation. LTR-containing substrates generate tandem elements at frequencies more than 10-fold higher than similarly sized internal Ty5 sequences. Internal sequences, however, facilitate tandem element formation when associated with an LTR, and there is a linear relationship between frequencies of tandem element formation and the length of LTR-containing substrates. We propose that recombination is initiated between the LTRs of the cDNA and substrate and that internal sequences promote tandem element formation by facilitating sequence alignment. Because of its location in subtelomeric regions, recombinational amplification of Ty5 may contribute to the organizations of chromosome ends.

Chromosomes, Fungal↗
PubMed2002

Chromosomal elements evolve at different rates in the Drosophila genome.

Recent results indicate that the rate of chromosomal rearrangement in the genus Drosophila is the highest found so far in any eukaryote. This conclusion is based chiefly on the comparative mapping analysis of a single chromosomal element (Muller's element E) in two species, D. melanogaster and D. repleta, representing the two farthest lineages within the genus (the Sophophora and Drosophila subgenera, respectively). We have extended the analysis to two other chromosomal elements (Muller's elements A and D) and tested for differences in rate of evolution among chromosomes. With this purpose, detailed physical maps of chromosomes X and 4 of D. repleta were constructed by in situ hybridization of 145 DNA probes (gene clones, cosmids, and P1 phages) and their gene arrangements compared with those of the homologous chromosomes X and 3L of D. melanogaster. Both chromosomal elements have been extensively reshuffled over their entire length. The number of paracentric inversions fixed has been estimated as 118 +/- 17 for element A and 56 +/- 8 for element D. Comparison with previous data for elements E and B shows that there are fourfold differences in evolution rate among chromosomal elements, with chromosome X exhibiting the highest rate of rearrangement. Combining all results, we estimated that 393 paracentric inversions have been fixed in the whole genome since the divergence between D. repleta and D. melanogaster. This amounts to an average rate of 0.053 disruptions/Mb/myr, corroborating the high rate of rearrangement in the genus Drosophila.

Animals↗
PubMed2002

Dasheng: a recently amplified nonautonomous long terminal repeat element that is a major component of pericentromeric regions in rice.

A new and unusual family of LTR elements, Dasheng, has been discovered in the genome of Oryza sativa following database searches of approximately 100 Mb of rice genomic sequence and 78 Mb of BAC-end sequence information. With all of the cis-elements but none of the coding domains normally associated with retrotransposons (e.g., gag, pol), Dasheng is a novel nonautonomous LTR element with high copy number. Over half of the approximately 1000 Dasheng elements in the rice genome are full length (5.6-8.6 kb), and 60% are estimated to have amplified in the past 500,000 years. Using a modified AFLP technique called transposon display, 215 elements were mapped to all 12 rice chromosomes. Interestingly, more than half of the mapped elements are clustered in the heterochromatic regions around centromeres. The distribution pattern was further confirmed by FISH analysis. Despite clustering in heterochromatin, Dasheng elements are not nested, suggesting their potential value as molecular markers for these marker-poor regions. Taken together, Dasheng is one of the highest-copy-number LTR elements and one of the most recent elements to amplify in the rice genome.

Centromere↗
PubMed1990

Transcriptional regulatory elements of the RAS2 gene of Saccharomyces cerevisiae.

We have analyzed a series of 5' deletions of the RAS2 gene to investigate its complex transcriptional regulation in the yeast Saccharomyces cerevisiae. Two positive transcriptional regulatory elements were identified. Element A regulates two of the three clusters of RAS2 transcripts. This element is capable of activating a heterologous promoter and contains two copies of the sequence CCTCGCCCC. Although one copy is sufficient for partial transcriptional activation, both copies are required for maximal RAS2 induction. Deletion of one copy resulted in a reduced level of RAS2 mRNA, selective loss of cluster II transcripts and reduced ability to activate the heterologous CYC1 promoter. Each of the 9 bp C rich repeats of element A is part of a sequence with extensive homology to a transcriptional regulatory element upstream of the human epidermal growth factor receptor (EGFR) gene. Element B contains a tandem duplication of a 21 nucleotide sequence TACATATATATATATCTTAG and activates cluster I RAS2 transcripts in the absence of Element A. The physiological role of these deletions was determined by assaying their ability to support growth on a nonfermentable carbon source. RAS2 promoter deletions containing either element A or B were able to overcome this growth defect characteristic of ras2 mutants cells. Deletion of both elements resulted in an insufficient amount of RAS2 protein for growth on a non-fermentable carbon source.

Base Sequence↗
PubMed1995

A compilation of composite regulatory elements affecting gene transcription in vertebrates.

Over the past years, evidence has been accumulating for a fundamental role of protein-protein interactions between transcription factors in gene-specific transcription regulation. Many of these interactions run within composite elements containing binding sites for several factors. We have selected 101 composite regulatory elements identified experimentally in the regulatory regions of 64 genes of vertebrates and of their viruses and briefly described them in a compilation. Of these, 82 composite elements are of the synergistic type and 19 of the antagonistic type. Within the synergistic type composite elements, transcription factors bind to the corresponding sites simultaneously, thus cooperatively activating transcription. The factors, binding to their target sites within antagonistic type composite elements, produce opposing effects on transcription. The nucleotide sequence and localization in the genes, the names and brief description of transcription factors, are provided for each composite element, including a representation of experimental data on its functioning. Most of the composite elements (3/4) fall between -250 bp and the transcription start site. The distance between the binding sites within the composite elements described varies from complete overlapping to 80 bp. The compilation of composite elements is presented in the database COMPEL which is electronically accessible by anonymous ftp via internet.

Animals↗
PubMed1996

Molecular structure of a gypsy element of Drosophila subobscura (gypsyDs) constituting a degenerate form of insect retroviruses.

We have determined the nucleotide sequence of a 7.5 kb full-size gypsy element from Drosophila subobscura strain H-271. Comparative analyses were carried out on the sequence and molecular structure of gypsy elements of D.subobscura (gypsyDs), D.melanogaster (gypsyDm) and D.virilis (gypsyDv). The three elements show a structure that maintains a common mechanism of expression. ORF1 and ORF2 show typical motifs of gag and pol genes respectively in the three gypsy elements and could encode functional proteins necessary for intracellular expansion. In the three ORF1 proteins an arginine-rich region was found which could constitute a RNA binding motif. The main differences among the gypsy elements are found in ORF3 (env-like gene); gypsyDm encodes functional env proteins, whereas gypsyDs and gypsyDv ORF3s lack some motifs essential for functionality of this protein. On the basis of these results, while gypsyDm is the first insect retrovirus described, gypsyDs and gypsyDv could constitute degenerate forms of these retroviruses. In this context, we have found some evidence that gypsyDm could have recently infected some D.subobscura strains. Comparative analyses of divergence and phylogenetic relationships of gypsy elements indicate that the gypsy elements belonging to species of different subgenera (gypsyDs and gypsyDv) are closer than gypsy elements of species belonging to the same subgenus (gypsyDs and gypsyDm). These data are congruent with horizontal transfer of gypsy elements among different Drosophila spp.

Amino Acid Sequence↗
PubMed1997

A conserved core element is functionally important for maize mitochondrial promoter activity in vitro.

We have previously used a homologous in vitro transcription system to define functional elements of the maize mitochondrial atpA promoter. These elements comprise a central domain extending from -7 to +5, relative to the transcription start site, and an upstream domain of 1-3 bp that is purine rich and centered around positions -11 to -12. Within the central domain lies an essential 5 bp core element. These elements are conserved in many mitochondrial promoters, but their functionality has only been tested for atpA. In this study we have introduced mutations into the corresponding elements of two cox3 promoters and show that while the core element is essential for cox3 promoter activity, upstream element mutations have little or no effect. To define the minimal sequence required for in vitro promoter activity a series of short cloned oligonucleotides corresponding to the atpA promoter was used. While some activity was seen with a 14 bp sequence, full activity required 26 bp, suggesting that elements other than the core and upstream region can influence promoter strength. Another series of clones showed that altered spacing between the upstream and core elements of atpA had a significant effect on promoter activity. These results further define important features of the plant mitochondrial transcriptional machinery.

Base Composition↗
PubMed1998

Multiple parameters determine the specificity of transcriptional response by nuclear receptors HNF-4, ARP-1, PPAR, RAR and RXR through common response elements.

A number of nuclear receptors, including retinoic acid receptors (RARs), retinoid-X receptors (RXRs), hepatocyte nuclear factor 4 (HNF-4), chicken ovalbumin upstream promoter transcription factor I (COUP-TFI), apolipoprotein regulatory protein 1 (ARP-1) and peroxisome proliferator-activated receptor (PPAR), bind to response elements comprised of two core motifs, 5'-RG(G/T)TCA, or a closely related sequence separated by 1 nt (DR1 elements). The potential role of the precise sequence of the core motif as well as the spacer nucleotide in determining specificity and promiscuity of receptor-response element interactions was investigated. We show here that nucleotides at base positions 1, 2 and 4 of the core motif as well as the spacer nucleotide determine the binding preference of HNF-4 and ARP-1 homodimers and RAR:RXR and PPAR:RXR heterodimers. In transfection experiments transcriptional activation by HNF-4 and PPAR:RXR and repression by ARP-1 correlated with the relative in vitro binding affinity provided the element was located within the proper promoter context. Furthermore, promoter context also determined whether an element that binds to HNF-4 and PPAR:RXR with equal affinity functions as an HNF-4 response element or PPAR response element. Thus, apart from the element-specific differences in affinity for the receptors, additional promoter-specific transcription factors that interact with HNF-4 and PPAR:RXR determine the specificity of transcriptional response through DR1-type elements.

Animals↗
PubMed2001

UP element-dependent transcription at the Escherichia coli rrnB P1 promoter: positional requirements and role of the RNA polymerase alpha subunit linker.

The UP element stimulates transcription from the rrnB P1 promoter through a direct interaction with the C-terminal domain of the RNA polymerase alpha subunit (alphaCTD). We investigated the effect on transcription from rrnB P1 of varying both the location of the UP element and the length of the alpha subunit interdomain linker, separately and in combination. Displacement of the UP element by a single turn of the DNA helix resulted in a large decrease in transcription from rrnB P1, while displacement by half a turn or two turns totally abolished UP element-dependent transcription. Deletions of six or more amino acids from within the alpha subunit linker resulted in a decrease in UP element-dependent stimulation, which correlated with decreased binding of alphaCTD to the UP element. Increasing the alpha linker length was less deleterious to RNA polymerase function at rrnB P1 but did not compensate for the decrease in activation that resulted from displacing the UP element. Our results suggest that the location of the UP element at rrnB P1 is crucial to its function and that the natural length of the alpha subunit linker is optimal for utilisation of the UP element at this promoter.

Base Sequence↗
PubMed1995

Studies on the transposition rates of mobile genetic elements in a natural population of Drosophila melanogaster.

In an isolated population of Drosophila melanogaster on Ishigaki Island the chromosomal distribution of several retrotransposons, including copia, 412, 297, 17.6, I, and jockey elements, was examined by in situ hybridization. In this population the cosmopolitan inversion, In(2L)t, is known to exist in high frequency. One major haplotype concerning the occupied sites of the transposable elements was identified in the In(2L)t-carrying chromosomes. This haplotype is suggested to be the ancestral one. The age of the inversion in this local population was estimated to be 1,400 generations. The transposition rates of these elements were estimated based on the age of the inversion and the number of the elements lost and gained. The excision rates were in the range from 9.13 x 10(-5) to 2.25 x 10(-4) per site per generation. They were similar each other in the copia-like elements as well as in the LINE-like elements. The rate was higher in the copia-like elements than in the LINE-like elements. Insertions occurred in the range from 6.79 x 10(-4) to 9.05 x 10(-4) per element per generation. It is herein shown that both insertions and excisions occurred at a significantly higher rate in this population than in the laboratory.

Animals↗
PubMed1995

Evolutionary stability of the R1 retrotransposable element in the genus Drosophila.

R1 is a non-long terminal repeat (non-LTR) retrotransposable element that inserts into a specific sequence of insect 28S ribosomal RNA genes. We have previously shown that this element has been maintained through vertical transmission in the melanogaster species subgroup of Drosophila. To address whether R1 elements have been vertically transmitted for longer periods of evolutionary time, the analysis has been extended to 11 other species from four species groups of the genus Drosophila (melanogaster, obscura, testecea, and repleta). All sequenced elements appeared functional on the basis of the preservation of their open-reading frames and consistently higher rate of substitution at synonymous sites relative to replacement sites. The phylogenetic relationships of the R1 elements from all species analyzed were congruent with the species phylogenies, suggesting that the R1 elements have been vertically transmitted since the inception of the Drosophila genus, an estimated 50-70 Mya. The stable maintenance of R1 through the germ line appears to be the major mechanism for the widespread distribution of these elements in Drosophila. In two species, D. neotestecea of the testecea group and D. takahashii of the melanogaster group, a second family of R1 elements was also present that differed in sequence by 46% and 31%, respectively, from the family that was congruent with the species phylogeny. These second families may represent occasional horizontal transfers or, alternatively, they could reflect the ability of R1 elements to diverge into new families within a species and evolve independently.

Animals↗
PubMed1990

Molecular characterization of a repeat element causing large-scale size variation in the mitochondrial DNA of the sea scallop Placopecten magellanicus.

The scallop Placopecten magellanicus has the largest reported animal mitochondrial DNA (average 35 kb) and exhibits large inter- and intraindividual length variation owing to the varying copy number of a repeated element. We have characterized the repeat array by using restriction mapping and sequence analysis. The repeated element consists of 1,442 bp flanked on either side by the sequence ACTTTCC in a direct orientation. The array contains two to eight copies of the repeated element arranged in a direct orientation and in tandem. Only complete copies of the element are present in the array. The repeat element contains three regions with characteristic nucleotide sequences: a 10-bp inverted repeat shown to extrude into a cruciform in a supercoiled DNA plasmid, a 120-bp tract rich in G/C (70%) and adjacent to the inverted repeat, and periodically interspersed homopolymer runs of A and T occurring near the middle of the element which induce DNA curvature in dimeric constructs of the element. The element appears to be unique to P. magellanicus. The structural properties of the repeat element and its organization in an array of repeats may be important in explaining the generation and maintenance of large-scale mitochondrial DNA size variation observed in many animal species.

Animals↗
PubMedDate not supplied

An unusual repetitive element from highly virulent isolates of Leptosphaeria maculans and evidence of its transfer to a weakly virulent isolate.

A 5,238-bp repetitive DNA element from a highly virulent isolate of Leptosphaeria maculans has been cloned and sequenced. The element is present in approximately 80 copies per haploid genome and hybridizes to every chromosome resolved by pulse field gel electrophoresis. The sequence is composed of 66% A+T and has numerous, very short, direct and inverted repeats. No RNA complementary to the element was detected in log phase cultures, and no open reading frames of significant length are present in the sequence. It has no structural similarity to other repetitive elements or significant homology to database sequences. We have designated the element LMR1. Southern blot hybridization indicated that the element is present in all isolates of L. maculans that are highly virulent to Brassica napus and B. rapa. The general structure of the element was conserved among isolates of different mating type, pathogenicity group, and geographic origin, as determined by both Southern blot analysis and primer-directed DNA amplification. LMR1 did not hybridize to DNA from weakly virulent strains of L. maculans, with the exception of one isolate. Phylogenetic analyses of restriction fragment length polymorphism and rDNA sequence indicated that the highly virulent and weakly virulent strains of L. maculans are not monophyletic. Therefore, the presence of the LMR1 element in a weakly virulent isolate may indicate that a rare transfer event has occurred. Surprisingly, the weakly virulent isolate that contains LMR1 is more pathogenic on B. napus and B. juncea than a similar isolate that lacks the element.

Ascomycota↗