SEARCH · Search PubMed

Results for “reference genome”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

SourceResearch connectionFrom yearThrough year

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,099 records · Page 61Linked to original sources

PubMed1999

Genomes were forged by massive bombardments with retroelements and retrosequences.

Retroposition is an efficient route to move coding regions around the genome 'in search' of novel regulatory elements and to shotgun regulatory elements into the genome 'in search' of new target genes. The templates for such retrogenes are mRNAs, and for regulatory retronuons (nuon = any definable nucleic acid sequence) usually small non-mRNAs (snmRNAs). An example in support of the 'master gene' model for SINEs (short interspersed repetitive elements) is provided with neuronal BC1 RNA. Furthermore, an alternative explanation of LINE (long interspersed repetitive elements) involvement in the generation of SINEs is given. I will also argue that the status of transposable elements with respect to the host resembles more symbiosis than parasitiasis and that host defense is often lenient as if even to 'tolerate or support' retronuons. Finally the paradox of evolution's lack of foresight and the future exaptive use of retronuons is being dealt with by referring to W.F. Doolittle's 'Hierarchical Approaches to Genome Evolution'.

Animals↗

PubMed2025

Whole-genome sequencing-based pathogen characterization for streptococcal infection directly from positive blood culture samples.

Clinical laboratories are increasingly using diagnostic tests directly on positive blood cultures, which may lead to fewer attempts to recover bacterial isolates. Consequently, public health laboratories can benefit from assays that directly process blood culture samples without requiring submission of clinical isolates to determine additional pathogen features not identified by clinical tests, such as vaccine serotype and bacterial genomic relatedness, for surveillance and outbreak response purposes. In partnership with the Minnesota Active Bacterial Core surveillance (ABCs) site, we identified blood culture samples positive for ABCs streptococcal pathogens and characterized them by a direct whole-genome sequencing from blood culture (dWGS) assay. The dWGS results were compared with the results of a reference method (WGS of isolates from the same cultures) to evaluate concordance in pathogen features and genome assemblies. Of the 97 eligible blood culture samples, 83 (86%) passed dWGS quality control criteria and were subjected to a total of 655 dWGS-based tests, which yielded 651 (99.3%) evaluable results. The percent agreement with reference results was 100% (83/83) for M protein gene (emm)/capsular types and 100% (81/81) for multilocus sequencing types. For genotypic antimicrobial susceptibility testing prediction, the percent prediction agreement was 100% (487/487), false resistant prediction rate was 0% (0/417), and the false susceptible prediction rate was 0% (0/66). Assemblies of pathogen genomes from the same patient differed by 1.08 ± 1.68 (mean ± SD) sites per genome. The dWGS assay can extract high-quality, important streptococcal strain characteristics directly from positive blood culture samples to support evolving public health needs.IMPORTANCEWhole-genome sequencing (WGS) technologies have emerged as a transformative toolkit used by public health microbiology laboratories to detect and characterize pathogens. The surveillance of bacterial diseases often relies on clinical laboratories to submit pathogen isolates to regional or national public health laboratories, which have the capacity to routinely conduct WGS-based strain characterization. Clinical laboratories are increasingly using diagnostic tests directly on positive blood cultures, which may lead to fewer attempts to recover bacterial isolates. The study evaluated a direct whole-genome sequencing from blood culture (dWGS) assay that directly processes blood culture samples. The dWGS assay recovered high quality, important streptococcal strain characteristics, including vaccine serotypes and whole-genome assemblies, without requiring submission of clinical isolates. Thus, the dWGS assay represents a promising tool for addressing the evolving needs of public health laboratories in the metagenomics era.

Humans↗

PubMedDate not supplied

Validation of the suppressive subtractive hybridization method in Mycoplasma agalactiae species by the comparison of a field strain with the type strain PG2.

The subtractive suppressive hybridization (SSH), a method that allows the identification of sequences that are present in one genome (tester) but not in the other (driver), is a promising technique for the comparison of Mycoplasma agalactiae pathogenic strains. The optimal conditions for SSH were established by subtracting the M. agalactiae type strain PG2 DNA from the M. agalactiae strain 5632 DNA. Because these two strains possess different vpma gene repertoires, 5632-specific vpma sequences (and possibly other 5632-specific sequences) were predicted to be retrieved by SSH. The subtracted tester DNA was PCR-amplified and cloned into the pGEM-T easy E. coli vector. Two independent libraries were generated and used to prepare individual probes that were tested by Southern blot with genomic DNA from various field isolates and mycoplasma reference strains. Sequence analysis of two overlapping clones showed that they potentially code for a large carboxyterminal portion of a new vpma ORF. Several DNA fragments homologous to insertion sequences were also found in 5632 and related strains. These preliminary data suggest that SSH is a powerful method to investigate differences between mycoplasma strains, and may be applied to molecular epidemiology, diagnostic, and host specificity or pathogenicity determinant discovery.

Animals↗

PubMed2004

Metabolic and genomic diversity of rhizobia isolated from field standing native and exotic woody legumes in southern Ethiopia.

Eighty-seven rhizobial strains isolated from root nodules of field standing native and exotic woody legumes in southern Ethiopia were characterized using the Biolog method and AFLP fingerprinting technique. Cluster analysis of the metabolic and genomic fingerprints revealed 18 and 25 groups, respectively, demonstrating considerable diversity in rhizobial population indigenous to Ethiopian soils. While 25 strains (29%) were linked to members of Agrobacterium, Bradyrhizobium, Mesorhizobium, Rhizobium or Sinorhizobium, the bulk of the strains formed several distinct groups in both methods and did not relate to reference species included in the study. In contrast to exotic species which formed symbiosis with strains of only one specific genomic group, indigenous host species nodulated by metabolically and genomically diverse groups. The results in this study support the view, that long-term association between the symbionts allows gradual differentiation and diversity in compatible rhizobial population resident in native soils. Lack of significant metabolic and genomic relatedness to the reference strains in our results suggested that test strains in our collection probably included 'unique' types, which belong to several yet undefined rhizobial species.

Albizzia↗

PubMed2026

Seqwin: ultrafast identification of signature sequences in microbial genomes.

MOTIVATION: Polymerase chain reaction (PCR) enables rapid, cost-effective diagnostics but requires prior identification of genomic regions that allow sensitive and specific detection of target microbial groups, herein referred to as microbial signature sequences. We introduce Seqwin, an open-source framework designed to automate microbial genome signature discovery. Tens of thousands of microbial genomes are now available for a single species, limiting the application of existing manual and automated approaches for identifying signatures. Modern approaches that are capable of leveraging all available microbial genomes will ensure sensitive and accurate DNA signature identification and enable robust pathogen detection for clinical, environmental, and public health applications. RESULTS: Seqwin builds weighted pan-genome minimizer graphs and uses a traversal algorithm to identify signature sequences that occur frequently in target genomes but remain rare in non-targets. Unlike earlier tools that depend on strict presence or absence of sequences, Seqwin accommodates natural sequence variation and scales to very large genome collections. When applied to genomes from C. difficile, M. tuberculosis, and S. enterica, Seqwin recovered more high-quality signatures than alternative methods with lower computational burden. Seqwin's analysis of nearly 15 000 S. enterica genomes yielded over 200 candidate signatures in three minutes. Seqwin provides an open-source solution for the long-standing need for scalable microbial signature discovery and diagnostic assay design. AVAILABILITY AND IMPLEMENTATION: Seqwin is available on GitHub (https://github.com/treangenlab/Seqwin) and can be installed via Bioconda (https://bioconda.github.io/recipes/seqwin/README.html). Benchmarking datasets, outputs, and scripts are available on Zenodo (https://doi.org/10.5281/zenodo.19874011).

Software↗

PubMed2002

Identification, analysis, and utilization of conserved ortholog set markers for comparative genomics in higher plants.

We have screened a large tomato EST database against the Arabidopsis genomic sequence and report here the identification of a set of 1025 genes (referred to as a conserved ortholog set, or COS markers) that are single or low copy in both genomes (as determined by computational screens and DNA gel blot hybridization) and that have remained relatively stable in sequence since the early radiation of dicotyledonous plants. These genes were annotated, and a large portion could be assigned to putative functional categories associated with basic metabolic processes, such as energy-generating processes and the biosynthesis and degradation of cellular building blocks. We further demonstrate, through computational screens (e.g., against a Medicago truncatula database) and direct hybridization on genomic DNA of diverse plant species, that these COS markers also are conserved in the genomes of other plant families. Finally, we show that this gene set can be used for comparative mapping studies between highly divergent genomes such as those of tomato and Arabidopsis. This set of COS markers, identified computationally and experimentally, may further studies on comparative genomes and phylogenetics and elucidate the nature of genes conserved throughout plant evolution.

Amino Acid Sequence↗

PubMed1995

Campylobacter hyointestinalis subsp. lawsonii subsp. nov., isolated from the porcine stomach, and an emended description of Campylobacter hyointestinalis.

The taxonomic relationships of seven isolates obtained from porcine stomachs (the "CHY" group), which resembled (but were distinct from) the type strain and other reference strains of Campylobacter hyointestinalis, were examined by using phenotypic and genomic methods. The phenotypic characteristics and ultrastructure of the new organisms were characteristic of Campylobacter species, although they could be distinguished from all previously described taxa. A numerical analysis of 38 phenotypic characters revealed that the new isolates formed a distinct group at a similarity level of 90.1% and could be clearly distinguished from reference strains representing 20 related taxa, principally species and subspecies belonging to the genera Campylobacter, Arcobacter, and Helicobacter. DNA-DNA hybridization studies revealed that the porcine stomach strains were genomically homogeneous (levels of relatedness, 84 to 90%), although the levels of DNA homology with type and reference strains of C. hyointestinalis were relatively high (56 to 71%). Differences in the DNA base compositions of the CHY group and C. hyointestinalis strains were also observed. Our data indicate that the new porcine isolates should be considered members of a subspecies of C. hyointestinalis, for which we propose the name Campylobacter hyointestinalis subsp. lawsonii subsp. nov. The type strain is strain CHY 5 (= LMG 14432 = NCTC 12901 = CCUG 34538). The description of C. hyointestinalis is emended accordingly, and a description of Campylobacter hyointestinalis subsp. hyointestinalis subsp. nov. is given.

Animals↗

PubMed2004

Genome scanning for interspecific differentiation between two closely related oak species [Quercus robur L. and Q. petraea (Matt.) Liebl.].

Interspecific differentiation values (G(ST)) between two closely related oak species (Quercus petraea and Q. robur) were compiled across different studies with the aim to explore the distribution of differentiation at the genome level. The study was based on a total set of 389 markers (isozymes, AFLPs, SCARs, microsatellites, and SNPs) for which allelic frequencies were estimated in pairs of populations sampled throughout the sympatric distribution of the two species. The overall distribution of G(ST) values followed an L-shaped curve with most markers exhibiting low species differentiation (G(ST) < 0.01) and only a few loci reaching >10% levels. Twelve percent of the loci exhibited significant G(ST) deviations to neutral expectations, suggesting that selection contributed to species divergence. Coding regions expressed higher differentiation than noncoding regions. Among the 389 markers, 158 could be mapped on the 12 linkage groups of the existing Q. robur genetic map. Outlier loci with large G(ST) values were distributed over 9 linkage groups. One cluster of three outlier loci was found within 0.51 cM; but significant autocorrelation of G(ST) was observed at distances <2 cM. The size and distribution of genomic regions involved in species divergence are discussed in reference to hitchhiking effects and disruptive selection.

Crosses, Genetic↗

PubMed2026

Long-read transcriptomics corrects Trichomonas vaginalis intron annotations and refines transcript-end features.

BACKGROUND: Trichomonas vaginalis causes the most prevalent non-viral sexually transmitted infection worldwide. Despite its large genome (181.5 Mb; 36,310 predicted protein-coding genes in NYU_TvagG3_2), intron annotations remain limited and inconsistently validated. A recent short-read RNA-seq study reported 63 putative active introns, but short reads can misassign splice boundaries and cannot resolve complete transcript structures. METHODS: We integrated Oxford Nanopore direct RNA sequencing (DRS), ONT cDNA long-read sequencing, and Illumina RNA-seq to refine intron annotations, transcript-end features, and UTR boundaries in T. vaginalis. Candidate introns were validated by targeted PCR and Sanger sequencing, and representative splicing events were further assessed using public SRA datasets. RESULTS: Starting from 31 historically annotated introns, motif-guided long-read screening and orthogonal validation identified 17 additional validated introns, increasing the curated set to 48 confirmed introns. Among these 17 events, three were previously unrecognized in the current NYU_TvagG3_2 reference annotation. We also corrected five reported loci, including two false-positive introns, two splice-coordinate misannotations, and one gene-sequence error. DRS further supported transcript termination site mapping, UAAA polyadenylation-signal profiling relative to poly(A) addition sites, and single-molecule poly(A)-tail estimation. StringTie mixed-mode assemblies provided updated UTR boundaries for intron-bearing transcripts and transcripts without curated introns. CONCLUSIONS: This study provides a rigorously validated, long-read-refined resource of intron annotations, UTR boundaries, and UAAA-guided transcript-end features for T. vaginalis, together with a reproducible workflow for non-model protists. These refinements improve the current reference annotation and support future studies of functional genomics, parasite biology, pathogenesis, and diagnostic development.

Trichomonas vaginalis↗

PubMed2000

How quantitative is quantitative PCR with respect to cell counts?

Quantitative diagnostic PCR systems based upon rDNA targeted primer and probe combinations were developed for the detection of Escherichia coli, Pseudomonas aeruginosa, Pseudomonas fluorescens, Pseudomonas alcaligenes, enterococci, Staphylococcus aureus, and Staphylococcus epidermidis. Primers and probes were designed in silico using the ARB software package (TU Munich) in combination with Primer Design software of PE Applied Biosystems. Purified genomic DNA or bacterial cells of target and reference organisms were used for the evaluation of the PCR assays applying the TaqMan technique on an ABI PRISM TM 7700 Sequence Detection System (PE Applied Biosystems). Sensitive, reliable and reproducible quantification of target rDNA could be achieved applying primer-probe combinations that mediate in vitro amplification of DNA fragments smaller than 100 base pairs. Large amounts of non target DNA (1 mg per sample) remarkably affected the quantification potential of the approach resulting in an underestimation of the amounts of target DNA. One of the principal goals was to use quantitative PCR to study the correlation of gene and cell numbers depending on the growth behavior of target organisms and to explore the potential to estimate cell numbers from target DNA quantification. A clear correlation of rDNA quantification and bacterial growth was observed, however, cell numbers cannot directly be estimated from quantitative PCR data, given that the cellular genome content varies with the growth phase of the organisms. In the case of Escherichia coli the cell numbers which could be assigned to a certain number of rDNA targets varied reasonably depending upon the growth phase of batch cultures.

Bacteria↗

PubMed1991

A new human hypervariable locus (K29) maps to the q37.3 region of chromosome 2 and reveals a fingerprint.

A human genomic library was screened with a 30-base oligomer corresponding to the 5' end of the human calretinin cDNA. A clone that contains a minisatellite composed of 21 imperfect repeats of a 37-bp sequence was isolated. The consensus (GAGGGAGGAACTGGGACGCGTGCATGTTTGCATTCTC) incidentally shares 14 consecutive matches with the oligomer used as a probe, and it was shown that the clone did not belong to the calretinin locus. The minisatellite, named K29, was used as a probe on Southern blots at high stringency. After HaeIII, MboI, or HinfI digestion, it detected a single hypervariable locus, with 65% heterozygosity among Caucasian individuals. The probe used at low stringency revealed a fingerprint, with an average of four bands in addition to the locus-specific pattern. Mendelian inheritance was assessed on pedigrees. The K29 minisatellite was mapped by in situ hybridization to the very end of the long arm of chromosome 2 (2q37.3 band), at close proximity of the Fra2J locus, and is referred to as the D2S88 locus in the genome database.

Base Sequence↗

PubMed1993

Plasmid based differentiation and detection of Coxiella burnetii in clinical samples.

A "nested" PCR approach with primers based on conserved plasmid sequences was used for the highly sensitive and specific detection of Coxiella (C.) burnetii in clinical samples collected from cattle, dogs, cats and humans. Results were in good agreement with those obtained from Capture-ELISA and isolation of the organism in BGM cell culture. We also tested primers with sequences derived from genomic DNA and sequences based on 16S rRNA. In addition, we applied PCR for the differentiation of C. burnetii plasmid types from 28 isolates originating from the USA, Europe and South Africa. Reference isolates Nine Mile RSA493, Dugway 5J108-111 and all European isolates tested were recognized only by primers specific for the QpH1 plasmid. One isolate from a goat abortion in Namibia reacted identically to the reference isolate Priscilla Q177 bearing the QpRS plasmid. Reference isolate S Q217 with plasmid sequences integrated into the genome reacted with none of the plasmid-specific primer pairs.

Animals↗

PubMed2001

Nomenclature of the human immunoglobulin lambda (IGL) genes.

'Nomenclature of the Human Immunoglobulin Lambda (IGL) Genes', the 18th report of the 'IMGT Locus in Focus' section, provides the first complete list of all the human IGL genes. The total number of human IGL genes per haploid genome is 87--96 (93--102 if the orphons are included), of which 37--43 genes are functional. IMGT/Human Genome Organization (HUGO) gene names and definitions of the human IGL genes on chromosome 22q11.2 and IGL orphons on chromosomes 8 and 22 are provided with the gene functionality and the number of alleles, according to the rules of the IMGT Scientific chart, with the accession numbers of the IMGT reference sequences and with the accession ID of the Genome Database GDB and NCBI LocusLink databases, in which all the IMGT human IGL genes have been entered. The tables are available at the IMGT Marie-Paule page of IMGT, the international ImMunoGeneTics database (http://imgt.cines.fr) created by Marie-Paule Lefranc, Université Montpellier II, CNRS, France.

Alleles↗

PubMed2026

Characterization of a draft chromosome-scale genome assembly for the mutton snapper, Lutjanus analis.

BACKGROUND: The mutton snapper (Lutjanus analis) is a reef fish commonly found in tropical waters of the Western Atlantic Ocean. Genomic studies of this species are needed to support conservation efforts and breeding programs. OBJECTIVE: Here, we report the development of a chromosome-scale reference assembly for the mutton snapper and conduct an initial comparative genomic analysis with other lutjanids. METHODS: The genome of one mutton snapper specimen was sequenced using PAC-Bio HiFi long reads and Illumina short reads. Contigs and scaffolds were assembled in the Flye pipeline and anchored using Hi-C proximity guided assembly. Gene prediction and functional annotations were obtained in AUGUSTUS and eggNOG-mapper, respectively. The mutton snapper genome was compared to those of other lutjanids to infer gene family evolution and chromosome synteny conservation. RESULTS: Assembly and polishing yielded 946 contigs and 926 scaffolds (N50 of 3.16 Mb, complete BUSCO score 98.1%) that were anchored using Hi-C scaffolding in 24 draft chromosomes. The anchored assembly featured a N50 of 42.47 Mb and contained 97.6% of the unanchored assembly length. The 24 mutton snapper chromosomes showed a one-to-one syntenic relationship with their counterparts in medaka, and other Lutjanids. AUGUSTUS predicted 29,023 genes, 24,335 of which (83.85%) could be functionally annotated. Gene family evolution analysis revealed 1,014 significantly expanded or contracted hierarchical ortholog groups in mutton snapper. Expansions and contractions were linked to several biological functions including growth, oocyte maturation, and response to exogenous stressors. CONCLUSION: The draft genome will be a valuable tool for forthcoming applied genomic studies of mutton snapper.

Animals↗

PubMed1993

Genomic heterogeneity among French Rhizobium strains isolated from Phaseolus vulgaris L.

Levels of DNA relatedness between strains isolated from root nodules of Phaseolus vulgaris and reference strains of different Rhizobium species were determined by performing DNA-DNA hybridization experiments (S1 nuclease method). The nine strains examined were members of three genomic groups previously delineated by a restriction fragment length polymorphism analysis among strains isolated from P. vulgaris at different sites in France. In agreement with the results of the restriction fragment length polymorphism analysis, three genomic species were found. We confirmed that one of these species corresponded to Rhizobium leguminosarum since the strain examined was 100% related to the type strain of this species. The other two species were new genomic species which were less than 21% related to reference strains belonging to other Rhizobium species, including Rhizobium etli and Rhizobium tropici, and were 18% related to each other. As determined by an analysis of partial 16S ribosomal DNA sequences, each of the genomic species was found to belong to a lineage independent from the lineages of previously described Rhizobium species. Nevertheless, they were included in the group formed by the fast-growing Rhizobium species. Both genomic species 1 and genomic species 2 contained a majority of strains which were capable of nodulating both P. vulgaris and Leucaena leucocephala, like R. tropici. However, they also contained strains with a nodulation phenotype restricted to P. vulgaris, like R. leguminosarum bv. phaseoli and R. etli bv. phaseoli. Our data are the first evidence that in Europe species other than R. leguminosarum nodulate P. vulgaris.

Base Sequence↗

PubMed2005

Evaluation of regulatory potential and conservation scores for detecting cis-regulatory modules in aligned mammalian genome sequences.

Techniques of comparative genomics are being used to identify candidate functional DNA sequences, and objective evaluations are needed to assess their effectiveness. Different analytical methods score distinctive features of whole-genome alignments among human, mouse, and rat to predict functional regions. We evaluated three of these methods for their ability to identify the positions of known regulatory regions in the well-studied HBB gene complex. Two methods, multispecies conserved sequences and phastCons, quantify levels of conservation to estimate a likelihood that aligned DNA sequences are under purifying selection. A third function, regulatory potential (RP), measures the similarity of patterns in the alignments to those in known regulatory regions. The methods can correctly identify 50%-60% of noncoding positions in the HBB gene complex as regulatory or nonregulatory, with RP performing better than do other methods. When evaluated by the ability to discriminate genomic intervals, RP reaches a sensitivity of 0.78 and a true discovery rate of approximately 0.6. The performance is better on other reference sets; both phastCons and RP scores can capture almost all regulatory elements in those sets along with approximately 7% of the human genome.

Algorithms↗

PubMed2005

Spectrum and prevalence of cardiac ryanodine receptor (RyR2) mutations in a cohort of unrelated patients referred explicitly for long QT syndrome genetic testing.

BACKGROUND: Mutations in the RyR2-encoded cardiac ryanodine receptor/calcium release channel cause type 1 catecholaminergic polymorphic ventricular tachycardia (CPVT1). OBJECTIVES: Because CPVT and concealed long QT syndrome (LQTS) phenotypically mimic one other, we sought to determine the spectrum and prevalence of RyR2 mutations in a cohort of unrelated patients who were referred specifically for LQTS genetic testing. METHODS: Using denaturing high-performance liquid chromatography and direct DNA sequencing, targeted mutational analysis of 23 RyR2 exons previously implicated in CPVT1 was performed on genomic DNA from 269 unrelated patients (180 females, average age at diagnosis 24 +/- 17 years) who were referred to Mayo Clinic's Sudden Death Genomics Laboratory for LQTS genetic testing. Previously, comprehensive mutational analysis of the five LQTS-associated cardiac channel genes proved negative for this entire subset of patients now designated as "genotype-negative" LQTS referrals. RESULTS: Fifteen distinct RyR2 mutations (14 missense, 1 duplication/insertion, 12 novel) were found in 17 (6.3%) of 269 patients. None of these mutations were present in 400 reference alleles. Two mutations localized to the calstabin-2 (FKBP12.6) binding domain. Upon review of the clinical records, the referral diagnosis for all 17 patients was "atypical" or "borderline" LQTS. CONCLUSION: Putative pathogenic CPVT1-causing mutations in RyR2 were detected in 6% of unrelated, genotype-negative LQTS referrals. These findings suggest that CPVT may be underrecognized among physicians referring patients because of a suspected channelopathy. A diagnosis of "atypical LQTS" may warrant consideration of CPVT and analysis of RyR2 if the standard cardiac channel gene screen for LQTS is negative.

Adolescent↗

PubMed2026

Variant harmonization critically determines polygenic score transferability for lipid traits in Samoan populations.

Dyslipidemia is a significant risk factor for cardiovascular disease (CVD), the leading cause of death in Samoa. Polygenic scores (PGSs) for lipid traits offer promise for improved CVD risk prediction; however, their performance in Pacific Islander populations-comprising only 0.002% of genome-wide association study (GWAS) participants as of 2024-remains unknown. We evaluated the transferability of multi-ancestry PGS for LDL cholesterol (LDL-C), HDL cholesterol (HDL-C), triglycerides (TGs), and total cholesterol (TC) in 4,342 Samoan adults across five cohorts spanning 1990-2010. PGSs from Graham et al. and Kanoni et al. multi-ancestry meta-analyses were harmonized with genome-wide imputed genotypes using a Samoan-specific reference panel, and performance was assessed via incremental R2 from linear mixed models with bootstrapped confidence intervals. HDL-C showed the highest performance (incremental R2 5.0%-15.0%), followed by TC (5.0%-10.7%), LDL-C (5.7%-8.6%), and TG (3.5%-7.0%). Critically, meaningful LDL-C performance was achieved only with the genome-wide PRS-CS score (99.6%-99.7% variant matching), while a curated pruning-and-thresholding score achieved ∼9% matching and near-zero performance. These findings establish systematic lipid PGS benchmarks in Samoans, demonstrating meaningful transferability when genome-wide variant coverage is ensured, and highlight variant harmonization as a critical precondition for PGS deployment in underrepresented populations.

Pacific Islanders↗