Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “DNA structure”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,099 records · Page 61Linked to original sources
PubMed1989

DNA tertiary structures formed in vitro by misaligned hybridization of multiple tandem repeat sequences.

DNA tertiary structures are shown to be formed by denaturation and reannealing in vitro of molecularly-cloned DNA containing multiple tandem repeat sequences. Electron microscopy of homoduplex DNA molecules containing the human c-Harvey-ras gene revealed knot-like structures which mapped to the position of the 812 bp variable tandem repeat (VTR) sequence. We propose that the structures result from slipped-strand mispairing within the VTR and hybridisation of homologous repetitive sequences in the single-stranded loops so produced. Similar structures were also found in freshly-linearized supercoiled plasmids. More complex knot-like structures were found in homoduplexes of a 4 kb tandem array from the hypervariable region 3' to the human alpha-globin locus. Formation of such DNA tertiary structures in vitro also provides a practical method for identifying and mapping direct tandem repeat arrays that are at least 800 bp long.

Cloning, Molecular↗
PubMed1993

The effect of zinc on the secondary structure of d(GA.TC)n DNA sequences of different length: a model for the formation *H-DNA.

Alternating d(GA.TC)n DNA sequences are known to undergo transition to *H-DNA in the presence of zinc. Here, the effect of zinc on the secondary DNA structure of d(GA.TC)n sequences of different length (n = 5, 8, 10 and 19) was determined. Short d(GA.TC)n sequences form *H-DNA with a higher difficulty than longer ones. At bacterial negative superhelical density (- sigma = 0.05), zinc still induces transition to the *H-DNA conformation at a d(GA.TC)10 sequence but shorter sequences do not form *H-DNA. Transition to *H-DNA at a d(GA.TC)8 sequence is observed under conditions which destabilize the DNA double helix such as high negative supercoiling or low ionic strength. Our results indicate that a first step in the transition to *H-DNA is the formation of a denaturation bubble at the centre of the repeated DNA sequence, suggesting that the primary role of zinc is to induce a local denaturation of the DNA double helix. Subsequently, zinc might also participate in the stabilization of the altered DNA conformation through its direct interaction with the bases. Based on these results a model for the formation of *H-DNA is proposed.

Base Sequence↗
PubMed1986

Data structures for DNA sequence manipulation.

Two data structures designated Fragment and Construct are described. The Fragment data structure defines a continuous nucleic acid sequence from a unique genetic origin. The Construct defines a continuous sequence composed of sequences from multiple genetic origins. These data structures are manipulated by a set of software tools to simulate the construction of mosaic recombinant DNA molecules. They are also used as an interface between sequence data banks and analytical programs.

Base Sequence↗
PubMed2002

Identification of non-telomeric G4-DNA binding proteins in human, E. coli, yeast, and Arabidopsis.

G4-DNA binding proteins of E. coli, Saccharomyces cerevisiae, Arabidopsis, and human have been identified by a synthetic non-telomeric G4-DNA oligo 5'-d(ACTGTCGTACTTGATATGGGGGT)-3' using gel mobility shift assays. G4-DNA binding proteins are specific to G4-DNA, a four-stranded guanine-DNA structure. Bound complexes of G4-DNA and proteins were identified in nuclear extracts of all examined organisms in this study. In humans, three different G4-DNA and protein complexes were identified. However, human telomeric G-quadruplex oligo did not compete with G4-DNA oligo in the competition assays, suggesting that the identified G4-DNA binding proteins may be different from the known human telomeric G4-DNA binding proteins. We discovered two complexes of G4-DNA and protein in Arabidopsis identified in mobility shift assays. Interestingly, two complexes of G4-DNA and proteins were identified from E. coli, which have a circular genomic DNA structure. Results of this investigation suggest that non-telomeric G4-DNA structure and its binding proteins may be involved in important functional roles in both prokaryotes and eukaryotes.

Arabidopsis↗
PubMed1977

A nucleosome-like structure containing DNA and the arginine-rich histones H3 and H4.

The low-angle X-ray diffraction pattern from fibres of reconstituted H3/H4/DNA complexes is very similar to that of chromatin and has well defined maxima at 10.6, 5.4, 3.4 and 2.6 nm. Staphyloccal nuclease digestion of reconstituted H3/H4/DNA yields DNA fragments of length 49, 69, 100, 128, 193 and 255 b.p. as principal components. Comparison of the relative amounts of DNA fragments shows that the larger components (100 and 128 b.p.) increase with respect to the smaller (49 and 69 b.p.) as the histone to DNA ratio increases. A structural unit containing intergral of 65 b.p. of DNA and tetrameric (H3/H4)2 is proposed such that longer DNA fragments result from multiples of this unit. The principal nucleo-protein particle resulting from nuclease digestion contains 128/139 b.p. of DNA and has electrophoretic mobility very close to that of 'core' nucleosome. It probably represents a dimer of the basic structural unit.

Animals↗
PubMed1999

Structure of a triple helical DNA with a triplex-duplex junction.

Extended purine sequences on a DNA strand can lead to the formation of triplex DNA in which the third strand runs parallel to the purine strand. Triplex DNA structures have been proposed to play a role in gene expression and recombination and also have potential application as antisense inhibitors of gene expression. Triplex structures have been studied in solution by NMR, but have hitherto resisted attempts at crystallization. Here, we report a novel design of DNA sequences, which allows the first crystallographic study of DNA segment containing triplexes and its junction with a duplex. In the 1.8 A resolution structure, the sugar-phosphate backbone of the third strand is parallel to the purine-rich strand. The bases of the third strand associate with the Watson and Crick duplex via Hoogsteen-type interactions, resulting in three consecutive C(+).GC, BU.ABU (BU = 5-bromouracil), and C(+).GC triplets. The overall conformation of the DNA triplex has some similarity to the B-form, but is distinct from both A- and B-forms. There are large changes in the phosphate backbone torsion angles (particularly gamma) of the purine strand, probably due to the electrostatic interactions between the phosphate groups and the protonated cytosine. These changes narrow the minor groove width of the purine-Hoogsteen strands and may represent sequence-specific structural variations of the DNA triplex.

Base Pairing↗
PubMed1991

Site-specific DNA cleavage by vaccinia virus DNA topoisomerase I. Role of nucleotide sequence and DNA secondary structure.

Cleavage of linear duplex DNA by purified vaccinia virus DNA topoisomerase I occurs at a conserved sequence element (5'-C/T)CCTT decreases) in the incised DNA strand. Oligonucleotides spanning the high affinity cleavage site CCCTT at nucleotide 2457 in pUC19 DNA are cleaved efficiently in vitro, but only when hybridized to a complementary DNA molecule. As few as 6 nucleotides proximal to the cleavage site and 6 nucleotides downstream of the site are sufficient to support exclusive cleavage at the high affinity site (position +1). Single nucleotide substitutions within the consensus pentamer have deleterious effects on the equilibria of the topoisomerase binding and DNA cleavage reactions. The effects of base mismatch within the pentamer are more dramatic than are the effects of mutations that preserve base complementarity. Competition experiments indicate that topoisomerase binds preferentially to DNA sites containing the wild-type pentamer element. Single-stranded DNA containing the sequence CCCTT in the cleaved stand is a more effective competitor than is single-stranded DNA containing the complementary sequence in the noncleaved strand.

Base Sequence↗
PubMed1986

Crystal structure of a Z-DNA fragment containing thymine/2-aminoadenine base pairs.

The Z-DNA structure has been shown to form in two crystals made from self-complementary DNA hexamers d(CGTDCG) and d(CDCGTG) which contain thymine/2-aminoadenine (TD) base pairs. The latter structure has been solved and refined to 1.3 A resolution and it shows only small conformational changes due to the introduction of the TD base pairs in comparison with the structure of d(CG)3. Spectroscopic studies with these compounds demonstrate that DNA molecules containing 2-aminoadenine residues form Z-DNA slightly more easily than do those containing adenine nucleotides, but not as readily as the parent sequence containing only guanine-cytosine base pairs.

2-Aminopurine↗
PubMed1989

Quantitative analysis of DNA secondary structure from solvent-accessible surfaces: the B- to Z-DNA transition as a model.

Solvent structure and its interactions have been suggested to play a critical role in defining the conformation of polynucleotides and other macromolecules. In this work, we attempt to quantitate solvent effects on the well-studied conformational transition between right-handed B- and left-handed Z-DNA. The solvent-accessible surfaces of the hexamer sequences d(m5CG)3, d(CG)3, d(CA)3, and d(TA)3 were calculated in their B- and Z-DNA conformations. The difference in hydration free energies between the Z and the B conformations (delta delta GH(Z-B] was determined from these surfaces to be -0.494 kcal/mol for C-5 methylated d(CG), 0.228 kcal/mol for unmethylated d(CG), 0.756 kcal/mol for d(CA)-d(TG), and 0.896 kcal/mol for d(TA) dinucleotides. These delta delta GH(Z-B) values were compared to the experimental B- to Z-DNA transition energies of -0.56 kcal/mol that we measured for C-5 methylated d(CG), 0.69-1.30 kcal/mol reported for unmethylated d(CG), 1.32-1.48 kcal/mol reported for d(CA)-d(TG), and 2.3-2.4 kcal/mol for d(TA) dinucleotides. From this comparison, we found that the calculated delta delta GH(Z-B) of these dinucleotides could account for the previous observation that the dinucleotides were ordered as d(m5CG) greater than d(CG) greater than d(CA)-d(TG) greater than d(TA) in stability as Z-DNA. Furthermore, we predicted that one of the primary reasons for the inability of d(TA) sequences to form Z-DNA results from a decrease in exposed hydrophilic surfaces of adjacent base pairs due to the C-5 methyl group of thymine; thus, d(UA) dinucleotides should be more stable as Z-DNA than the analogous d(TA) dinucleotides.(ABSTRACT TRUNCATED AT 250 WORDS)

DNA↗
PubMed1992

Structure and applications of intermolecular DNA triplexes.

Current DNA binding drugs are not sequence specific. Triplex-forming oligonucleotides will bind targeted duplex DNA sites in a sequence-specific manner. A new class of DNA binding molecules based on triple-helical DNA formation promises a sequence-specific method of targeting discrete regions of DNA. DNA modifying molecules linked to third strands have been shown to modify only regions of DNA to which they were targeted. Current research will increase the understanding of triplex DNA structure and will lead to improved DNA binding drugs.

Base Composition↗
PubMed1998

Effect of DNA secondary structure on human telomerase activity.

Telomeres are specialized DNA-protein complexes located at the chromosome ends. The guanine-rich telomeric sequences have the ability to form G-quadruplex structures under physiological ionic conditions in vitro. Human telomeres are maintained through addition of TTAGGG repeats by the enzyme telomerase. To determine a correlation between DNA secondary structure and human telomerase, telomerase activity in the presence of various metal cations was monitored. Telomerase synthesized a larger proportion of products corresponding to four, five, eight, and nine full repeats of TTAGGG in 100 mM K+ and to a lesser extent in 100 mM Na+ when a d(TTAGGG)3 input primer was used. A more even product distribution was observed when the reaction mixture contained no added Na+ or K+. Increasing concentrations of Cs+ resulted in a loss of processivity but not in the distinct manner observed in K+. When the input primer contained 7-deaza-dG, the product distribution resembled that of reactions without K+ even in the presence of 100 mM K+. Native polyacrylamide gel electrophoresis indicated that d(TTAGGG)4, d(TTAGGG)5, d(TTAGGG)8, and d(TTAGGG)9 formed compact structures in the presence of K+. The oligonucleotide d(TTAGGG)4 had a UV spectrum characteristic of that of the G-quadruplex only in the presence of K+ and Na+. A reasonable explanation for these results is that four, five, eight, and nine repeats of TTAGGG form DNA secondary structures which promote dissociation of the primer from telomerase. This suggests that telomerase activity in cells can be modulated by the secondary structure of the DNA template. These findings are of probable relevance to the concept of telomerase as a therapeutic target for drug design.

Cesium↗
PubMed1991

Potassium permanganate as an in situ probe for B-Z and Z-Z junctions.

The availability of DNA structural probes that can be applied to living cells is essential for the analysis of biological functions of unusual DNA structures adopted in vivo. We have developed a chemical probe assay to detect and quantitate left-handed Z-DNA structures in recombinant plasmids in growing E. coli cells. Potassium permanganate selectively reacts with B-Z or Z-Z junction regions in supercoiled plasmids harbored in the cells. Restriction enzyme recognition sites located at these junctions are not cleaved by the corresponding endonuclease after modification with KMnO4. This inhibition of cleavage allows the determination of the relative amounts of B- and Z-forms of the cloned inserts inside the cell. We have successfully applied this method to monitor the extent of Z-DNA formation in E. coli as a function of the growth phase and mutated topoisomerase or gyrase activities. The assay can in principle be used for any unusual DNA structure that contains a restriction recognition site inside or near the structural alteration. It can be a useful tool to analyze in vivo correlations between DNA structure and gene regulatory events.

DNA Restriction Enzymes↗
PubMed1998

S-phase-specific activation of Cds1 kinase defines a subpathway of the checkpoint response in Schizosaccharomyces pombe.

Checkpoints that respond to DNA structure changes were originally defined by the inability of yeast mutants to prevent mitosis following DNA damage or S-phase arrest. Genetic analysis has subsequently identified subpathways of the DNA structure checkpoints, including the reversible arrest of DNA synthesis. Here, we show that the Cds1 kinase is required to slow S phase in the presence of DNA-damaging agents. Cds1 is phosphorylated and activated by S-phase arrest and activated by DNA damage during S phase, but not during G1 or G2. Activation of Cds1 during S phase is dependent on all six checkpoint Rad proteins, and Cds1 interacts both genetically and physically with Rad26. Unlike its Saccharomyces cerevisiae counterpart Rad53, Cds1 is not required for the mitotic arrest checkpoints and, thus, defines an S-phase specific subpathway of the checkpoint response. We propose a model for the DNA structure checkpoints that offers a new perspective on the function of the DNA structure checkpoint proteins. This model suggests that an intrinsic mechanism linking S phase and mitosis may function independently of the known checkpoint proteins.

Cell Cycle Proteins↗
PubMed2000

[Anti-DNA antibodies: structure and pathogenic role].

Anti DNA antibodies are generally classified into two major groups: Anti ds DNA (anti double .. stranded DNA) antibody and anti ss-DNA (anti single-stranded DNA) antibody. Anti-ds DNA antibodies are highly specific to systemic lupus erythematosus (SLE) and are probably involved in the pathogenesis of lupus nephritis. There are numerous serological tests for detecting anti-ds DNA. The detection of anti-ds DNA antibodies in the circulation of patients is one of the major criteria for the diagnosis of SLE; moreover, exacerbation of the disease are proceeded by increasing anti-DNA levels and the development of lupus nephritis, one of the most serious complications of the disease, strongly correlates with the presence of high avidity anti-DNA. It was reported that even normal individuals express anti-ds DNA. However, anti ds DNA found in healthy individuals is usually of the immunoglobulin M (IgM) isotype and shows a low affinity to ds-DNA. These natural antibodies are characterized by a wide cross-reactivity and are usually encoded by gene segments in the germ line configuration. In contrast, the ds-DNA antibodies involved influenced by various findings supporting the proposition that anti-ds DNA is involved in the pathogenesis of SLE, an enormous amount of scientific investigation has failed to reveal the exact mechanism through which this occurs.

Animals↗
PubMed1990

Molecular analysis of deep-subsurface bacteria.

Bacterial isolates from deep-sediment samples from three sites at the Savannah River site, near Aiken, S.C., were studied to determine their microbial community composition and DNA structure by using total DNA hybridization and moles percent G + C. Standard phenotypic identification underestimated the bacterial diversity at the three sites, since isolates with the same phenotype had different DNA structures in terms of moles percent G + C and DNA homology. The G + C content of deep-subsurface bacteria ranged from 20 to 77 mol%. More than 60% of the isolates tested had G + C values similar to those of Pseudomonas spp., and 12% had values similar to those of Acinetobacter spp. No isolates from deeper formations showed the same DNA composition as isolates from upper formations. Total-DNA hybridization and DNA base composition analysis provided a better resolution than phenotypic tests for the understanding of the diversity and structure of deep-subsurface bacterial communities. On the basis of the moles percent G + C values, deep-subsurface isolates tested seemed to belong to the families Pseudomonadaceae and Neisseriaceae, which might reflect a long period of adaptation to the environmental conditions of the deep subsurface.

Bacteria↗
PubMed1983

A dominant role for DNA secondary structure in forming hypersensitive structures in chromatin.

Previous work has suggested that potential information in DNA secondary structure might be used by cells to define DNAase 1- and S1-sensitive chromatin structures associated with promoter and terminator regions. To test this hypothesis, supercoiled pBR322 was cotransfected into L cells. For the majority of transfected clones supercoil-induced S1-sensitive sites in pure pBR322 DNA are also S1-sensitive in L-cell nuclei. These results suggest that the potential of certain DNA sequences to form specific secondary structures in chromatin can be a dominant characteristic. A recombinant chicken beta A-globin supercoiled plasmid was reconstituted in vitro with histones. The reconstituted chromatin also retained the ability to form S1-sensitive sites. Evidence suggests that DNA sequences capable of forming S1-sensitive sites in supercoiled plasmids may bind nucleosomes poorly after reconstitution with histones.

Animals↗
PubMed1992

NMR study of parallel-stranded tetraplex formation by the hexadeoxynucleotide d(TG4T).

Multistranded DNA structures based upon guanine association have been proposed to be important in the structure of chromosome telomeres and in immunoglobulin class switching. Nucleic acids containing runs of guanine bases form a number of structures in vitro, including fold-back structures (Fig. 1a) and parallel-stranded quadruplex structures in DNA and RNA. The features of fold-back structures have now been determined at high-resolution. The different structures are probably based on a tetrad of hydrogen-bonded guanine bases (Fig. 1b), with buffer conditions and sequence effects mediating isomerization between the different forms. Here we use NMR spectroscopy to investigate the solution structure of the complex formed by the hexadeoxynucleotide d(TG4T) in the presence of sodium ions. We have observed the formation of a parallel-stranded quadruplex containing hydrogen-bonded tetrads of guanine. The parallel-stranded form differs significantly from the fold-back form, with individual nucleotide conformations being closer to those of B-form DNA.

DNA↗
PubMed2001

Unwinding the molecular basis of the Werner syndrome.

Werner syndrome (WS) is an autosomal recessive disease manifested by the premature onset of age-related phenotypes, including diseases such as atherosclerosis and cancer. This mimicry of normal aging with the possible exception of central nervous system manifestations has made it a focus of recent molecular studies on the pathophysiology of aging. In culture, cells obtained from patients with WS are genetically unstable, characterized by an increased frequency of nonclonal translocations and extensive DNA deletions. The WS gene product (WRN) is a DNA helicase belonging to the RecQ family, but is unique within this family in that it also contains an exonuclease activity. In addition to unwinding double-stranded DNA, WRN helicase is able to resolve aberrant DNA structures such as G4 tetraplexes, triplexes and 4-way junctions. Concordant with this structure-specificity, WRN exonuclease preferentially hydrolyzes alternative DNA that contains bubbles, extra-helical loops, 3-way junctions or 4-way junctions. WRN has been shown to bind to and/or functionally interact with other proteins, including replication protein A (RPA), proliferating cell nuclear antigen (PCNA), DNA topoisomerase I, Ku 86/70, DNA polymerase delta and p53. Each of these interacting proteins is involved in DNA transactions including those that resolve alternative DNA structures or repair DNA damage. The biochemical activities of WRN and the functions of WRN associated proteins suggest that in vivo WRN resolves DNA topological or structural aberrations that either occur during DNA metabolic processes such as recombination, replication and repair, or are the outcome of DNA damage.

ATPases Associated with Diverse Cellular Activitie↗