Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “inverted terminal repeat”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,081 records · Page 60Linked to original sources
PubMed1996

The Drosophila P-element KP repressor protein dimerizes and interacts with multiple sites on P-element DNA.

Drosophila P elements are mobile DNA elements that encode an 87-kDa transposase enzyme and transpositional repressor proteins. One of these repressor proteins is the 207-amino-acid KP protein which is encoded by a naturally occurring P element with an internal deletion. To study the molecular mechanisms by which KP represses transposition, the protein was expressed, purified, and characterized. We show that the KP protein binds to multiple sites on the ends of P-element DNA, unlike the full-length transposase protein. These sites include the high-affinity transposase binding site, an 11-bp transpositional enhancer, and, at the highest concentrations tested, the terminal 31-hp inverted repeats. The DNA binding domain was localized to the N-terminal 98 amino acids and contains a CCHC sequence, a potential metal binding motif. We also demonstrate that the KP repressor protein can dimerize and contains two protein-protein interaction regions and that this dimerization is essential for high-affinity DNA binding.

Amino Acid Sequence↗
PubMed1989

Alterations in the pre-mRNA topology of the bovine growth hormone polyadenylation region decrease poly(A) site efficiency.

RNase mapping experiments show that the bovine growth hormone (bGH) poly(A) region forms an extensive hairpin loop. Mutants were prepared to change poly(A) region pre-mRNA structure and cleavage site efficiency without altering necessary sequences. An inverted repeat which includes the poly(A) cleavage site was created by insertion of a linker upstream of the poly(A) region to compete with any wild-type secondary structure. RNA mapping analyses show alterations in the nuclease accessibility of this mutant at the natural site of cleavage. This mutant shows a 75% drop in relative reporter gene expression at the steady-state protein and RNA levels. When the linker is inserted as a direct repeat, expression is equivalent to wildtype levels. To show that transcription was not terminated by the inverted repeat, the SV40 late poly(A) region was inserted downstream. These mutants show restored expression and processing at the downstream site. Our experiments reveal that the conformation of the poly(A) site pre-mRNA is important in mediating efficient cleavage-polyadenylation.

Animals↗
PubMed1991

Sequence analysis of the clpG gene, which codes for surface antigen CS31A subunit: evidence of an evolutionary relationship between CS31A, K88, and F41 subunit genes.

The clpG gene coding for the CS31A subunit was localized on a 0.9-kb SphI fragment from the recombinant plasmid pAG315. This was established by testing the ability of subclones to hybridize with a 17-meric oligonucleotide probe obtained from N-terminal analysis of the CS31A subunit. The nucleotide sequence of the region coding for CS31A was determined. From primer extension analysis, two initiation translation start sites were detected. Two possible promoterlike sequences were identified; the ribosome binding site and the translation terminator are proposed. Inverted repeat sequences leading to the formation of possible hairpin structures of the transcripts were found on the 5' untranslated region of clpG. The deduced amino acid composition was in close agreement with the chemical amino acid composition and sequence match with the first 25 N-terminal amino acids from the published N-terminal sequence of the purified CS31A subunit. The clpG gene codes for a mature protein of 257 amino acids with a molecular size of 26,777 Da. An obvious homology was observed when the amino acid sequence of CS31A was compared with those of K88 and F41. This homology includes five different conserved sequences of up to 19 identical amino acids, which is associated with conserved proline. An extensive change in the CS31A region homologous to that identified to contain the K88 receptor binding site might be responsible for the functional divergence between CS31A and K88.

Amino Acid Sequence↗
PubMed1985

The nucleotide sequence of the tnpA gene completes the sequence of the Pseudomonas transposon Tn501.

The nucleotide sequence of the gene (tnpA) which codes for the transposase of transposon Tn501 has been determined. It contains an open reading frame for a polypeptide of Mr = 111,500, which terminates within the inverted repeat sequence of the transposon. The reading frame would be transcribed in the same direction as the mercury-resistance genes and the tnpR gene. The amino acid sequence predicted from this reading frame shows 32% identity with that of the transposase of the related transposon Tn3. The C-terminal regions of these two polypeptides show slightly greater homology than the N-terminal regions when conservative amino acid substitutions are considered. With this sequence determination, the nucleotide sequence of Tn501 is fully defined. The main features of the sequence are briefly presented.

Amino Acid Sequence↗
PubMed1989

Drosophila P element transposase recognizes internal P element DNA sequences.

Drosophila P transposable elements encode an 87 kd trans-acting protein, transposase, that is required to catalyze P element transposition and excision. We show here that purified transposase is a site-specific DNA binding protein. P element transposase does not interact with the terminal 31 bp inverted repeats but instead interacts specifically with an internal 10 bp consensus sequence present at both the 5' and 3' ends of P element DNA. These binding sites lie within sequences known to be important for transposition in vivo. Transposase also displays an unusually high nonspecific affinity for DNA. The transposase binding site at the 5' and overlaps sequences we show to be essential for transcription from the P element promoter in vitro, which raises the possibility that either transposase or the related 66 kd P element protein may affect P element transcription. From these and other observations, we suggest that the P element transposition reaction probably requires the binding of additional Drosophila protein factors to the terminal DNA sequences.

Animals↗
PubMed1983

The mitochondrial genomes of spontaneous orir petite mutants of yeast have rearranged repeat units organized as inverted tandem dimers.

We have investigated the structure and organization of the mitochondrial genomes of two related orir (ori-rearranged) spontaneous petite mutants of Saccharomyces cerevisiae. In these mutant genomes every repeat unit contains an inverted terminal duplication harboring a second (inverted) ori sequence, and tandem pairs of repeat units alternate with tandem pairs in inverted orientation. We have shown that orir genomes are organized as the genomes with inverted repeat units of ethidium bromide (EtBr)-induced petites, and we have clarified the mechanism by which such mutant mitochondrial genomes arise.

Base Sequence↗
PubMed1997

Cloning and sequence analysis of a novel insertion element from plasmids harbored by the carbofuran-degrading bacterium, Sphingomonas sp. CFO6.

Sphingomonas sp. CFO6 (a member of the alpha group of Proteobacteria) was isolated from a Washington soil by enrichment on the insecticide carbofuran as a sole source of carbon and energy. This strain has been shown to harbor five plasmids, at least some of which are required for catabolism of carbofuran. Rearrangements, deletions, and loss of individual plasmids resulting in the loss of the carbofuran-degrading phenotype were observed following treatment with heat or introduction of Tn5. Several putative insertion sequence elements of different sizes were cloned from these plasmids by trapping in pUCD800, a positive selection vector for isolation of transposable elements. Three of the most common putative IS elements (designated IS1412, IS1487, and IS1488) in the clone library were of different sizes and cross-hybridize with each other. An element hybridizing with IS1412, IS1487, and IS1488 was mobilized during growth of CFO6 at 42 degrees C and inserted into one of CFO6's plasmids (pCFO4), corresponding to a deletion in the plasmid and a loss of catabolic function. IS1412 was completely sequenced and its sequence analyzed. IS1412 is 1656 bp in length and possesses terminal partially matched inverted repeats of unequal length (17 and 18 bp). In addition, IS1412 contains an open reading frame which encodes a putative transposase with significant homology to the putative transposases of IS1380 from Acetobacter pasteurianus, HRS1 from Bradyrhizobium japonicum, and IS1247 from Xanthobacter autotrophicus. These related IS elements form part of a family of common IS elements distributed among members of the alpha group of the Proteobacteria.

Amino Acid Sequence↗
PubMed1979

Fine structure of the 21S ribosomal RNA region on yeast mitochondrial DNA. II. The organization of sequences in petite mitochondrial DNAs carrying genetic markers from the 21S region.

We have investigated the organization of sequences in ten rho- petite mtDNAs by restriction enzyme analysis and electron microscopy. From the comparison of the physical maps of the petite mtDNAs with the physical map of the mtDNA of the parental rho+ strain we conclude that there are at least three different classes of petite mtDNAs: I. Head-to-tail repeats of an (almost) continuous segment of the rho+ mtDNA. II. Head-to-tail repeats of an (almost) continuous segment of the rho+ mtDNA with a terminal inverted duplication. III. Mixed repeats of an (almost) continuous rho+ mtDNA segment. In out petite mtDNAs of the second type, the inverted duplications do not cover the entire conserved rho+ mtDNA segment. We have found that the petite mtDNAs of the third type contain a local inverted duplication at the site where repeating units can insert in two orientations. At least in one case this local inverted duplication must have arisen by mutation. The rearrangements that we have found in the petite mtDNAs do not cluster at specific sites on the rho+ mtDNA map. Large rearrangements or deletions within the conserved rho+ mtDNA segment seem to contribute to the suppressiveness of a petite strain. There is also a positive correlation between the retention of certain segments of the rho+ mtDNA and the suppressiveness of a petite strain. We found no correlation between the suppressiveness of a petite strain and its genetic complexity. The relevance of these findings for the mechanism of petite induction and the usefulness of petite strains for the physical mapping of mitochondrial genetic markers and for DNA sequence analysis are discussed.

Base Sequence↗
PubMed1995

Transcriptional analyses of the unique short segment of EHV-1 strain Kentucky A.

The unique short (Us) segment of the genome of equine herpesvirus type 1 (EHV-1) strain KyA is comprised of six open reading frames (ORFs) that encode: a) a homolog of the Us2 protein of herpes simplex virus type 1 (HSV-1); b) a serine threonine protein kinase that is a homolog of the HSV-1 Us3 protein; c) a homolog of pseudorabies virus glycoprotein gX and HSV-2 gG; d) a novel glycoprotein, EUS4, not encoded by other herpesviruses sequenced to date; e) a homolog of HSV-1 gD; and f) a homolog of HSV-1 Us9. The KyA strain is a deletion mutant that lacks Us sequences encoding gI, gE, and a potential 10 kD polypeptide, and thus may be useful as a parent virus for the generation of live virus vaccines. To complete the elucidation of the transcriptional program of the Us segment, Northern blot hybridization and S1 nuclease analyses were performed on poly(A)(+)-selected RNA isolated from infected cells maintained under early (phosphonoacetic acid-block) and late conditions. The findings revealed that the gene (EUS2 ORF) encoding the protein kinase is expressed as an early 2.9 kb transcript that overlaps and is 3' coterminal with a 1.6 kb early transcript that encodes the gG/gX homolog (EUS3 ORF). Two transcripts of 1.6 kb and 5.8 kb are 5' coterminal and may both encode the novel glycoprotein gene EUS4. The 1.6 kb transcript terminates at a poly(A) signal site downstream of the EUS4 ORF, and the 5.8 kb transcript terminates within the inverted repeat (IR) segment. Overall, the transcriptional program of the EHV-1 KyA Us segment is complex and exhibits similarities to that of HSV-1 Us segment: a) transcripts arise from both DNA strands; b) some transcripts, including those mapping at the termini of the Us segment, extend into the IR segments and are 3' coterminal with the 1.2 kb IR6 transcript; c) at least one transcript reads through a functional polyadenylation signal; d) some transcripts encoding genes that lie in different reading frames exist as a family of overlapping mRNAs, some in an anti-sense manner. Lastly, of the six Us genes of the EHV-1 KyA strain, only those encoding the EHV-1 protein kinase and the HSV-2 gG/gX homolog are members of the early kinetic class.

Base Sequence↗
PubMed1993

SIRE-1, a long interspersed repetitive DNA element from soybean with weak sequence similarity to retrotransposons: initial characterization and partial sequence.

Gm776 is a 776-bp subregion of a member of an interspersed family of relatively homogeneous repetitive DNA elements from soybean (Glycine max). The fragment was originally amplified from soybean DNA by the polymerase chain reaction using a single 22-nucleotide primer, and consequently terminates in an inverted repeat. The elements defined by Gm776 are at least 10.6 kb in length and constitute a family of 500-800 members per haploid genome. The family has been designated SIRE-1 (soybean interspersed repetitive element 1). Overlapping regions of Gm776 exhibit suggestive DNA sequence similarity to Ta1 and Ty1, copia-like retrotransposons from Arabidopsis thaliana and Saccharomyces cerevisiae, respectively. However, there are no similarities at the amino acid level, and the regions of similarity are not functionally related.

Base Sequence↗
PubMed2003

Regulatory C protein of the EcoRV modification-restriction system.

The C gene product of the modification-restriction system PvuII binds to its own promoter (C box) and stimulates transcription of both the C gene and the endonuclease gene. According to our data the same regulatory mechanism is realized in the EcoRV system. It was found that upstream of the EcoRV endonuclease gene two ATG codons give rise to two open reading frames (ORF1 and ORF2) ending at the same point inside the endonuclease gene. Two DNA fragments corresponding to ORF1 and ORF2 were cloned, and the homogenous products of proteins encoded by them were found to be DNA-binding proteins. A specific DNA sequence (C box) recognized by the proteins was determined with DNAse I footprinting. The C box CCCATTTTGGGTTATCCCATTTTGGG is located inside ORF1 and, similar to the PvuII C box consisting of tandem repeats of 11 nucleotides, is divided by four nucleotides. In its turn each of the repeats contains inverted repeats of four terminal nucleotides. The EcoRV C box sequence differs both from the PvuII C box sequence and from the proposed consensus sequence of C boxes in other modification-restriction systems.

Base Sequence↗
PubMed2003

Isolation and analysis of a new hopper hAT transposon from the Bactrocera dorsalis white eye strain.

A new hopper element belonging to the hAT transposon family was isolated from the white eye mutant strain of the Oriental fruit fly, Bactrocera dorsalis. Using the original hopper element sequence from the wild type Kahuku strain as a template, the new hopper was isolated by inverse and direct PCR. Nucleotide sequence analysis reveals a 3131 bp element with terminal and subterminal inverted repeat sequences, an 8 bp duplicated insertion site, and a conceptual translation yielding a single uninterrupted 650 amino acid open reading frame. The white eye hopper has structure more consistent with function than the Kahuku element, indicating that hopper is not an ancient relic. The hopper element remains distantly related to other known hAT elements including those from insects, and presently it is most similar to Activator-related elements discovered in the human genome. DNA hybridization studies indicate, however, that elements closely related to hopper exist in another bactrocerid species, the melonfly, B. cucurbitae.

Amino Acid Sequence↗
PubMed1984

Complete nucleotide sequence of the E. coli glutathione synthetase gsh-II.

The nucleotide sequence of the cloned DNA, 1,478 bp in length coding for glutathione synthetase (GSH-II) of E. coli B has been determined. Amino acid and nucleotide sequence analyses have assigned the open reading frame for GSH-II, starting with the ATG near its 5' terminus. The molecular weight calculated from the predicted amino acid sequence is 35,559 daltons, being in good agreement with that of a GSH-II subunit estimated by the SDS-PAGE method. Several signal sequences conserved in the promoter regions of E. coli were found in the non-coding regions of the gsh-II gene. They include the Shine-Dalgarno sequence, the Pribnow box and the sequence conserved in the "-35 region" with a preferable spacing from each other for an efficient transcription. Downstream from the termination codon, the inverted repeat sequences were present, followed by 6 successive T's. These structural features found in the non-coding regions have suggested to be involved in regulatory functions for the gsh-II gene expression.

Amino Acid Sequence↗
PubMed1985

Complete nucleotide sequence of the E. coli N-acetylneuraminate lyase.

The nucleotide sequence of the cloned DNA, 1,243 bp in length coding for N-acetylneuraminate lyase (N-acetylneuraminate pyruvate lyase; NPL) of Escherichia coli has been determined. Nucleotide sequence and amino acid analysis have assigned the open reading frame for NPL, starting with the ATG near its 5'terminus. The molecular weight calculated from the predicted amino acid sequence was 32,640 daltons, being in good agreement with that of a NPL subunit estimated by the SDS-PAGE method and amino acid composition. Several signal sequences conserved in the promoter regions of E. coli were found in the npl gene. They were the Shine-Dalgarno sequence, the Pribnow box and the sequence coserved in the "-35 region" and they were separated to each other with preferable spacing for an efficient transcription. Downstream from the termination codon, the inverted repeat sequence was present, followed by 4 successive T's.

Amino Acid Sequence↗
PubMed1986

Nucleotide sequence of the gene responsible for D-xylose uptake in Escherichia coli.

The nucleotide sequence of the cloned DNA, 363 bp in length, has been determined. It can complement the mutation of Escherichia coli having a decreased activity of D-xylose uptake at low temperature. Nucleotide sequence analysis found one possible reading frame coding for a polypeptide consisting of 61 amino acids. Several signal sequences conserved in the promoter regions of E. coli were found in the upstream regions of the open frame. This included the Shine-Dalgarno sequence, the Pribnow box, and the sequence conserved in the "-35 region" with a preferable spacing from each other for an efficient transcription. Downstream from the termination codon, the inverted repeat sequence was present, followed by 3 successive T's.

Bacterial Proteins↗
PubMed1989

Sequence and characteristics of IS900, an insertion element identified in a human Crohn's disease isolate of Mycobacterium paratuberculosis.

The complete sequence of an insertion element IS900 in Mycobacterium paratuberculosis is reported. This is the first characterised example of a mycobacterial insertion element. IS900 consists of 1451bp of which 66% is G + C. It lacks terminal inverted and direct repeats, characteristic of Escherichia coli insertion elements but shows a degree of target sequence specificity. A single open reading frame (ORF 1197) coding for 399 amino acids is predicted. This amino acid sequence, and to a lesser extent the nucleotide sequence, show significant homologies to IS110, an insertion element of Streptomyces coelicolor A3(2). It is proposed that IS900, IS110, and similar insertion elements recently identified in disease isolates of Mycobacterium avium are members of a phylogenetically related family. IS900 will provide highly specific markers for the precise identification of Mycobacterium paratuberculosis, useful in defining its relationship to animal and human diseases.

Amino Acid Sequence↗
PubMed1980

Nucleotide sequences at the ends of the mercury resistance transposon, Tn501.

The nucleotide sequences at the ends of the mercury-resistance transposon, Tn501, have been determined. The terminal sequences are inverted repeated sequences 38 nucleotide pairs in length, which differ in 3 nucleotide pairs. The transposon is flanked by directly repeated sequences of 5 nucleotide pairs, originating from a single pentanucleotide sequence in the recipient replicon. There is no obvious homology between recipient replicons at the site of insertion of the transposon. The structures of the ends of Tn501 are compared with those of other transposons and insertion sequences. The use of Tn501 to locate an EcoRI site within a genetically defined sequence of interest is discussed.

Base Sequence↗
PubMed2000

Genetic linkage of the vanB2 gene cluster to Tn5382 in vancomycin-resistant enterococci and characterization of two novel insertion sequences.

VanB-type vancomycin resistance is encoded by the vanB gene cluster, which disseminates by horizontal gene transfer and clonal spread of vancomycin-resistant enterococci (VRE). Genetic linkage of the vanB gene cluster to transposon Tn5382 and the insertion sequences IS16 and IS256-like has previously been shown. In this study linkage of defined vanB gene cluster subtypes to these elements was examined. All the vanB2 subtype strains studied (n=14) revealed co-hybridization of vanB and Tn5382, whereas the strains of vanB1 (n=8) and vanB3 (n=1) subtypes were Tn5382 negative. Conjugative cotransfer of the vanB2 gene cluster and Tn5382 was demonstrated for two strains. DNA sequencing of the vanX(B)-ORFC region in vanB2 strains confirmed that the vanB2 gene cluster is an integral part of Tn5382. No general pattern of linkage was observed with regard to IS16 and IS256-like. Two novel insertion sequences were identified in specific vanB2 subtype strains. (i) A 1611 bp element (ISEnfa110) was detected in the left flank of Tn5382. Its insertion site, lack of terminal inverted and direct repeats, and two conserved motifs in its putative transposase all conform to the conventions of the IS110 family. (ii) A 787 bp element (ISEnfa200) was detected in the vanS(B)-vanY(B) intergenic region. Its ORF encoded a putative protein with 60-70% identity to transposases of the IS200 family. No further copies of ISEnfa110 were found by colony hybridization of 181 enterococcal isolates, whereas ISEnfa200 was found in four additional vanB2 strains from the USA. The five strains had identical ISEnfa200 element insertion sites, and Tn5382 was located downstream from a pbp5 gene conferring high-level ampicillin resistance. These isolates showed related PFGE patterns, suggesting possible clonal spread of a VRE strain harbouring a Tn5382-vanB2-ISEnfa200 element linked to a pbp5 gene conferring ampicillin resistance.

Animals↗