Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “CATALOGING”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,081 records · Page 60Linked to original sources
PubMed1994

The status of online Mendelian inheritance in man (OMIM) medio 1994.

During the last year many changes have been introduced into the system of maintaining OMIM. There are three major components of the reorganization. First, a distributed editorial system was introduced which provides a three-tiered editorial board with senior editors, science writers and subject editors. Second, MIM entries have been restructured to provide separate gene and phenotype information and to organize them into separate catalogs. The restructuring also establishes clearly defined sections for entering new information, converts old entries to the new structure, and establishes a file maintenance and editorial system in SGML format. Third, the entry numbering and naming system has been modified. In addition, the information has been made available through a variety of output media, including books, CD-ROM and online access based on the IRx, WAIS, Gopher and WWW formats.

Books↗
PubMed1994

Construction of a normalized cDNA library by introduction of a semi-solid mRNA-cDNA hybridization system.

We report a novel procedure to construct a normalized (equalized) cDNA library. By introduction of the highly efficient self-hybridization system between a whole mRNA population and their corresponding cDNA immobilized on latex beads, which involves relatively simple manipulations, we were able to generate an mRNA population in which the copy number of abundant species was reduced while that of rare species was enriched. In a typical experiment, after several cycles of self-hybridization on the beads, the ratio of the most to the least abundant marker mRNA species dropped by a factor of 300 (from 10,000 to 30) while the complexity and length of mRNAs in the population remained unchanged. The procedure should provide a potent tool for the expression cloning of cDNA and also facilitate the construction of whole cDNA catalogs from specific tissues (or cell types) from higher organisms.

Animals↗
PubMed2000

The prostate expression database (PEDB): status and enhancements in 2000.

The Prostate Expression Database (PEDB) is an online resource designed to access and analyze gene expression information derived from the human prostate. PEDB archives >55 000 expressed sequence tags (ESTs) from 43 cDNA libraries in a curated relational database that provides detailed library information including tissue source, library construction methods, sequence diversity and sequence abundance. The differential expression of each EST species can be viewed across all libraries using a Virtual Expression Analysis Tool (VEAT), a graphical user interface written in Java for intra- and inter-library species comparisons. Recent enhancements to PEDB include: (i) the functional categorization of annotated EST assemblies using a classification scheme developed at The Institute for Genome Research; (ii) catalogs of expressed genes in specific prostate tissue sources designated as transcriptomes; and (iii) the addition of prostate proteome information derived from two-dimensional electrophoreses and mass spectrometry of prostate cancer cell lines. PEDB may be accessed via the WWW at http://www.mbt.washington.edu/PEDB/

Databases, Factual↗
PubMed2000

KEGG: kyoto encyclopedia of genes and genomes.

KEGG (Kyoto Encyclopedia of Genes and Genomes) is a knowledge base for systematic analysis of gene functions, linking genomic information with higher order functional information. The genomic information is stored in the GENES database, which is a collection of gene catalogs for all the completely sequenced genomes and some partial genomes with up-to-date annotation of gene functions. The higher order functional information is stored in the PATHWAY database, which contains graphical representations of cellular processes, such as metabolism, membrane transport, signal transduction and cell cycle. The PATHWAY database is supplemented by a set of ortholog group tables for the information about conserved subpathways (pathway motifs), which are often encoded by positionally coupled genes on the chromosome and which are especially useful in predicting gene functions. A third database in KEGG is LIGAND for the information about chemical compounds, enzyme molecules and enzymatic reactions. KEGG provides Java graphics tools for browsing genome maps, comparing two genome maps and manipulating expression maps, as well as computational tools for sequence comparison, graph comparison and path computation. The KEGG databases are daily updated and made freely available (http://www. genome.ad.jp/kegg/).

Animals↗
PubMed2000

DIP: the database of interacting proteins.

The Database of Interacting Proteins (DIP; http://dip.doe-mbi.ucla.edu) is a database that documents experimentally determined protein-protein interactions. This database is intended to provide the scientific community with a comprehensive and integrated tool for browsing and efficiently extracting information about protein interactions and interaction networks in biological processes. Beyond cataloging details of protein-protein interactions, the DIP is useful for understanding protein function and protein-protein relationships, studying the properties of networks of interacting proteins, benchmarking predictions of protein-protein interactions, and studying the evolution of protein-protein interactions.

Databases, Factual↗
PubMed2000

Human immunodeficiency virus reverse transcriptase and protease sequence database.

The HIV RT and Protease Sequence Database is an online relational database that catalogs evolutionary and drug-related human immunodeficiency virus (HIV) reverse transcriptase (RT) and protease sequence variation (http://hivdb.stanford.edu). The database contains a compilation of nearly all published HIV RT and protease sequences including International Collaboration database submissions (e.g., GenBank) and sequences published in journal articles. Sequences are linked to data about the source of the sequence sample and the antiretroviral drug treatment history of the individual from whom the isolate was obtained. The database is curated and sequences are annotated with data from >230 literature references. Users can retrieve additional data and view alignments of sequence sets meeting specific criteria (e.g., treatment history, subtype, presence of a particular mutation). A gene-specific sequence analysis program, new user-defined queries and nearly 2000 additional sequences were added in 1999.

Databases, Factual↗
PubMed2000

dbSNP: a database of single nucleotide polymorphisms.

In response to a need for a general catalog of genome variation to address the large-scale sampling designs required by association studies, gene mapping and evolutionary biology, the National Cancer for Biotechnology Information (NCBI) has established the dbSNP database. Submissions to dbSNP will be integrated with other sources of information at NCBI such as GenBank, PubMed, LocusLink and the Human Genome Project data. The complete contents of dbSNP are available to the public at website: http://www.ncbi.nlm.nih.gov/SNP. Submitted SNPs can also be downloaded via anonymous FTP at ftp://ncbi.nlm.nih.gov/snp/

Base Sequence↗
PubMed2000

TRIPLES: a database of gene function in Saccharomyces cerevisiae.

Using a novel multipurpose mini-transposon, we have generated a collection of defined mutant alleles for the analysis of disruption phenotypes, protein localization, and gene expression in Saccharomyces cerevisiae. To catalog this unique data set, we have developed TRIPLES, a Web-accessible database of TRansposon-Insertion Phenotypes, Localization and Expression in Saccharomyces. Encompassing over 250 000 data points, TRIPLES provides convenient access to information from nearly 7800 transposon-mutagenized yeast strains; within TRIPLES, complete data reports of each strain may be viewed in table format, or if desired, downloaded as tab-delimited text files. Each report contains external links to corresponding entries within the Saccharomyces Genome Database and International Nucleic Acid Sequence Data Library (GenBank). Unlike other yeast databases, TRIPLES also provides on-line order forms linked to each clone report; users may immediately request any desired strain free-of-charge by submitting a completed form. In addition to presenting a wealth of information for over 2300 open reading frames, TRIPLES constitutes an important medium for the distribution of useful reagents throughout the yeast scientific community. Maintained by the Yale Genome Analysis Center, TRIPLES may be accessed at http://ycmi.med.yale.edu/ygac/triples.htm

DNA Transposable Elements↗
PubMed2000

Discovering regulatory elements in non-coding sequences by analysis of spaced dyads.

The application of microarray and related technologies is currently generating a systematic catalog of the transcriptional response of any single gene to a multiplicity of experimental conditions. Clustering genes according to the similarity of their transcriptional response provides a direct hint to the regulons of the different transcription factors, many of which have still not been characterized. We have developed a new method for deciphering the mechanism underlying the common transcriptional response of a set of genes, i.e. discovering cis -acting regulatory elements from a set of unaligned upstream sequences. This method, called dyad analysis, is based on the observation that many regulatory sites consist of a pair of highly conserved trinucleotides, spaced by a non-conserved region of fixed width. The approach is to count the number of occurrences of each possible spaced pair of trinucleotides, and to assess its statistical significance. The method is highly efficient in the detection of sites bound by C(6)Zn(2)binuclear cluster proteins, as well as other transcription factors. In addition, we show that the dyad and single-word analyses are efficient for the detection of regulatory patterns in gene clusters from DNA chip experiments. In combination, these programs should provide a fast and efficient way to discover new regulatory sites for as yet unknown transcription factors.

Base Sequence↗
PubMed2001

Human Immunodeficiency Virus Reverse Transcriptase and Protease Sequence Database: an expanded data model integrating natural language text and sequence analysis programs.

The HIV Reverse Transcriptase and Protease Sequence Database is an on-line relational database that catalogs evolutionary and drug-related sequence variation in the human immunodeficiency virus (HIV) reverse transcriptase (RT) and protease enzymes, the molecular targets of anti-HIV therapy (http://hivdb.stanford.edu). The database contains a compilation of nearly all published HIV RT and protease sequences, including submissions from International Collaboration databases and sequences published in journal articles. Sequences are linked to data about the source of the sequence sample and the antiretroviral drug treatment history of the individual from whom the isolate was obtained. During the past year 3500 sequences have been added and the data model has been expanded to include drug susceptibility data on sequenced isolates. Database content has also been integrated with didactic text and the output of two sequence analysis programs.

Amino Acid Sequence↗
PubMed2001

OrCGDB: a database of genes involved in oral cancer.

The Oral Cancer Gene Database (OrCGDB; http://www.tumor-gene. org/Oral/oral.html) was developed to provide the biomedical community with easy access to the latest information on the genes involved in oral cancer. The information is stored in a relational database and accessed through a WWW interface. The OrCGDB is organized by gene name, which is linked to information describing properties of the gene. This information is stored as a collection of findings ('facts') that are entered by the database curator in a semi-structured format from information in primary publications using a WWW interface. These facts include causes of oncogenic activation, chromosomal localization of the gene, mutations associated with the gene, the biochemical identity and activity of the gene product, synonyms for the gene name and a variety of clinical information. Each fact is associated with a MEDLINE citation. The user can search the OrCGDB by gene name or by entering a textword. The OrCGDB is part of a larger WWW-based tumor gene database and represents a new approach to catalog and display the research literature.

Databases, Factual↗
PubMed2001

dbSNP: the NCBI database of genetic variation.

In response to a need for a general catalog of genome variation to address the large-scale sampling designs required by association studies, gene mapping and evolutionary biology, the National Center for Biotechnology Information (NCBI) has established the dbSNP database [S.T.Sherry, M.Ward and K. Sirotkin (1999) Genome Res., 9, 677-679]. Submissions to dbSNP will be integrated with other sources of information at NCBI such as GenBank, PubMed, LocusLink and the Human Genome Project data. The complete contents of dbSNP are available to the public at website: http://www.ncbi.nlm.nih.gov/SNP. The complete contents of dbSNP can also be downloaded in multiple formats via anonymous FTP at ftp://ncbi.nlm.nih.gov/snp/.

Animals↗
PubMed2001

Identification and prevention of a GC content bias in SAGE libraries.

Serial Analysis of Gene Expression (SAGE) is becoming a widely used gene expression profiling method for the study of development, cancer and other human diseases. Investigators using SAGE rely heavily on the quantitative aspect of this method for cataloging gene expression and comparing multiple SAGE libraries. We have developed additional computational and statistical tools to assess the quality and reproducibility of a SAGE library. Using these methods, a critical variable in the SAGE protocol was identified that has the potential to bias the Tag distribution relative to the GC content of the 10 bp SAGE Tag DNA sequence. We also detected this bias in a number of publicly available SAGE libraries. It is important to note that the GC content bias went undetected by quality control procedures in the current SAGE protocol and was only identified with the use of these statistical analyses on as few as 750 SAGE Tags. In addition to keeping any solution of free DiTags on ice, an analysis of the GC content should be performed before sequencing large numbers of SAGE Tags to be confident that SAGE libraries are free from experimental bias.

Animals↗
PubMed2002

DIP, the Database of Interacting Proteins: a research tool for studying cellular networks of protein interactions.

The Database of Interacting Proteins (DIP: http://dip.doe-mbi.ucla.edu) is a database that documents experimentally determined protein-protein interactions. It provides the scientific community with an integrated set of tools for browsing and extracting information about protein interaction networks. As of September 2001, the DIP catalogs approximately 11 000 unique interactions among 5900 proteins from >80 organisms; the vast majority from yeast, Helicobacter pylori and human. Tools have been developed that allow users to analyze, visualize and integrate their own experimental data with the information about protein-protein interactions available in the DIP database.

Animals↗
PubMed2002

The TRIPLES database: a community resource for yeast molecular biology.

TRIPLES is a web-accessible database of TRansposon-Insertion Phenotypes, Localization and Expression in Saccharomyces cerevisiae-a relational database housing nearly half a million data points generated from an ongoing study using large-scale transposon mutagenesis to characterize gene function in yeast. At present, TRIPLES contains three principal data sets (i.e. phenotypic data, protein localization data and expression data) for over 3500 annotated yeast genes as well as several hundred non-annotated open reading frames. In addition, the TRIPLES web site provides online order forms linked to each data set so that users may request any strain or reagent generated from this project free of charge. In response to user requests, the TRIPLES web site has undergone several recent modifications. Our localization data have been supplemented with approximately 500 fluorescent micrographs depicting actual staining patterns observed upon indirect immunofluorescence analysis of indicated epitope-tagged proteins. These localization data, as well as all other data sets within TRIPLES, are now available in full as tab-delimited text. To accommodate increased reagent requests, all orders are now cataloged in a separate database, and users are notified immediately of order receipt and shipment. Also, TRIPLES is one of five sites incorporated into the new functional analysis tool Function Junction provided by the Saccharomyces Genome Database. TRIPLES may be accessed from the Yale Genome Analysis Center (YGAC) homepage at http://ygac.med.yale.edu.

Computer Graphics↗
PubMed1980

Secondary structure model for bacterial 16S ribosomal RNA: phylogenetic, enzymatic and chemical evidence.

We have derived a secondary structure model for 16S ribosomal RNA on the basis of comparative sequence analysis, chemical modification studies and nuclease susceptibility data. Nucleotide sequences of the E. coli and B. brevis 16S rRNA chains, and of RNAse T1 oligomer catalogs from 16S rRNAs of over 100 species of eubacteria were used for phylogenetic comparison. Chemical modification of G by glyoxal, A by m-chloroperbenzoic acid and C by bisulfite in naked 16S rRNA, and G by kethoxal in active and inactive 30S ribosomal subunits was taken as an indication of single stranded structure. Further support for the structure was obtained from susceptibility to RNases A and T1. These three approaches are in excellent agreement. The structure contains fifty helical elements organized into four major domains, in which 46 percent of the nucleotides of 16S rRNA are involved in base pairing. Phylogenetic comparison shows that highly conserved sequences are found principally in unpaired regions of the molecule. No knots are created by the structure.

Bacillus↗
PubMed1980

Nucleotide sequence of Crithidia fasciculata cytosol 5S ribosomal ribonucleic acid.

The complete nucleotide sequence of the cytosol 5S ribosomal ribonucleic acid of the trypanosomatid protozoan Crithidia fasciculata has been determined by a combination of T1-oligonucleotide catalog and gel sequencing techniques. The sequence is: GAGUACGACCAUACUUGAGUGAAAACACCAUAUCCCGUCCGAUUUGUGAAGUUAAGCACC CACAGGCUUAGUUAGUACUGAGGUCAGUGAUGACUCGGGAACCCUGAGUGCCGUACUCCCOH. This 5S ribosomal RNA is unique in having GAUU in place of the GAAC or GAUC found in all other prokaryotic and eukaryotic 5S RNAs, and thought to be involved in interactions with tRNAs. Comparisons to other eukaryotic cytosol 5S ribosomal RNA sequences indicate that the four major eukaryotic kingdoms (animals, plants, fungi, and protists) are about equally remote from each other, and that the latter kingdom may be the most internally diverse.

Animals↗
PubMed2002

Discovery of novel transcription factor binding sites by statistical overrepresentation.

Understanding the complex and varied mechanisms that regulate gene expression is an important and challenging problem. A fundamental sub-problem is to identify DNA binding sites for unknown regulatory factors, given a collection of genes believed to be co-regulated. We discuss a computational method that identifies good candidates for such binding sites. Unlike local search techniques such as expectation maximization and Gibbs samplers that may not reach a global optimum, the method discussed enumerates all motifs in the search space, and is guaranteed to produce the motifs with greatest z-scores. We discuss the results of validation experiments in which this algorithm was used to identify candidate binding sites in several well studied regulons of Saccharomyces cerevisiae, where the most prominent transcription factor binding sites are largely known. We then discuss the results on gene families in the functional and mutant phenotype catalogs of S.cerevisiae, where the algorithm suggests many promising novel transcription factor binding sites. The program is available at http://bio.cs.washington.edu/software.html.

Algorithms↗