Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “quadruplex”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 109 records · Page 6Linked to original sources
PubMed2004

Stability and structure of telomeric DNA sequences forming quadruplexes containing four G-tetrads with different topological arrangements.

Telomeres are DNA-protein structures at the ends of eukaryotic chromosomes, the DNA of which comprise noncoding repeats of guanine-rich sequences. Telomeric DNA plays a fundamental role in protecting the cell from recombination and degradation. Telomeric sequences can form quadruplex structures stabilized by guanine quartets. These structures can be constructed from one, two, or four oligonucleotidic strands. Here, we report the thermodynamic characterization of the stability, analyzed by differential scanning calorimetry, of three DNA quadruplexes of different molecularity, all containing four G-tetrads. The conformational properties of these quadruple helices were studied by circular dichroism. The investigated oligomers form well-defined G-quadruplex structures in the presence of sodium ions. Two have the truncated telomeric sequence from Oxytricha, d(TGGGGT) and d(GGGGTTTTGGGG), which form a tetramolecular and bimolecular quadruplex, respectively. The third sequence, d(GGGGTTGGGGTGTGGGGTTGGGG) was designed to form a unimolecular quadruplex. The thermodynamic parameters of these quadruplexes have been determined. The tetramolecular structure is thermodynamically more stable than the bimolecular one, which, in turn, is more stable than the unimolecular one. The experimental data were discussed in light of the molecular-modeling study.

Base Sequence↗
PubMed2005

Duplex and quadruplex DNA binding and photocleavage by trioxatriangulenium ion.

The stable trioxatriangulenium ion (TOTA) has previously been shown to bind to and photooxidize duplex DNA, leading to cleavage at G residues, particularly 5'-GG-3' repeats. Telomeric DNA consists of G-rich sequences that may exist in either duplex or G-quadruplex forms. We have employed electrospray ionization mass spectrometry (ESI-MS) to investigate the interactions between TOTA and duplex DNA or G-quadruplex DNA. A variety of duplex decamer oligodeoxynucleotides form complexes with TOTA that can be detected by ESI-MS, and the stoichiometry and fragmentation patterns observed are commensurate with an intercalative binding mode. TOTA also forms complexes with four-stranded and hairpin-dimer G-quadruplex oligodeoxynucleotides that can be detected by ESI-MS. Both the stoichiometry and the fragmentation patterns observed by ESI-MS are different than those observed for G-tetrad end-stacking binding ligands. We have carried out (1)H NMR titrations of a four-stranded G-quadruplex in the presence of TOTA. Addition of up to 1 equiv of TOTA is accompanied by pronounced upfield shifts of the G-tetrad imino proton resonances in the NMR, which is similar to the effect observed for G-tetrad end-stacking ligands. At higher ratios of added TOTA, there is evidence for additional binding modes. Duplex DNA containing either human telomeric repeats (T(2)AG(3))(4) or the Tetrahymena telomeric repeats (T(2)G(4))(4) are readily photooxidized by TOTA, the major sites of oxidation being the central guanine residues in each telomeric repeat. These telomeric repeats were incorporated into duplex/quadruplex chimeras in which the repeats adopt a G-quadruplex structure. Analysis by denaturing polyacrylamide gel electrophoresis reveals significantly less TOTA photocleavage of these quadruplex telomeric repeats when compared to the duplex repeats.

Base Sequence↗
PubMed2005

Role of loop residues and cations on the formation and stability of dimeric DNA G-quadruplexes.

Formation of guanine-quadruplexes by four DNA oligonucleotides with common sequence dG4-loop-dG4 has been studied by a combination of NMR and UV spectroscopy. The loops consisted of 1',2'-dideoxyribose, propanediol, hexaethylene glycol, and thymine residues. The comparison of data on modified and parent oligonucleotides gave insight into the role of loop residues on formation and stability of dimeric G-quadruplexes. All modified oligonucleotides fold into dimeric fold-back G-quadruplexes in the presence of sodium ions. Multiple structures form in the presence of potassium and ammonium ions, which is in contrast to the parent oligonucleotide with dT4 loop. 15N-filtered 1H NMR spectra demonstrate that all studied G-quadruplexes exhibit three 15NH4(+) ion binding sites. Topology of intermolecular G-quadruplexes was evaluated by NMR measurements and diffusion experiments. The spherical, prolate-ellipsoid and symmetric cylinder models were used to interpret experimental translational diffusion constants in terms of diameters and lengths of unfolded oligonucleotides and their respective G-quadruplexes. UV melting and annealing curves show that oligonucleotides with non-nucleosidic loop residues fold faster, exhibit no hysteresis, and are less stable than dimeric d(G4T4G4)2 which can be attributed to the absence of H-bonds, stacking between loop residues and the outer G-quartets as well as cation-pi interactions. Oligonucleotide consisting of hexaethylene glycol linkage with only two phosphate groups in the loop exhibits higher melting temperature and more negative deltaH(o) and deltaG(o) values than oligonucleotides with four 1',2'-dideoxyribose or propanediol residues.

DNA↗
PubMed2005

Thermodynamics and kinetics of PNA-DNA quadruplex-forming chimeras.

PNA-DNA chimeras present the interesting properties of PNA, such as the high binding affinity to complementary single-strand (DNA or RNA), and the resistance to nuclease and protease degradation. At the same time, the limitations of an oligomer containing all PNA residues, such as low water solubility, self-aggregation, and low cellular uptake, are effectively overcome. Further, PNA-DNA chimeras possess interesting biological properties as antisense agents. We have explored the ability of PNA-DNA chimeric strands to assemble in quadruplex structures. The rate constant for association of the quadruplexes and their thermodynamic properties have been determined by CD spectroscopy and differential scanning calorimetry (DSC). Thermal denaturation experiments indicated higher thermal and thermodynamic stabilities for chimeric quadruplexes in comparison with the corresponding unmodified DNA quadruplex. Singular value decomposition analysis (SVD) suggests the presence of kinetically stable intermediate species in the quadruplex formation process. The experimental results have been discussed on the basis of molecular dynamic simulations. The ability of PNA-DNA chimeras to form stable quadruplex structures expands their potential utility as therapeutic agents.

Calorimetry↗
PubMed2006

Unfolding of G-quadruplexes: energetic, and ion and water contributions of G-quartet stacking.

It has been shown that DNA oligonucleotides composed, in part, of G repeat sequences can adopt G-quadruplex structures in the presence of specific metal ions. In this work, we use a combination of spectroscopic and calorimetric techniques to determine the spectral and thermodynamic characteristics of two DNA aptamers, d(G2T2G2TGTG2T2G2), G2, and d(G3T2G3TGTG3T2G3), G3; a sequence in the promoter region of the c-MYC oncogene, d(TG4AG3TG4AG3TG4A2G2), NHE-III; and the human telomere sequence d(AG3T2AG3T2AG3T2AG3), 22GG. The circular dichroism spectra of these oligonucleotides in the presence of K+ indicate that all form G-quadruplexes with G-quartets in an antiparallel arrangement (G2), in a parallel arrangement (NHE-III and 22GG), or in a mixed parallel and antiparallel G-quartet arrangement (G3). Melting profiles show transition temperatures, TM, above 45 degrees C that are independent of strand concentration, consistent with the formation of very stable intramolecular G-quadruplexes. We used differential scanning calorimetry to obtain complete thermodynamic profiles for the unfolding of each quadruplex. Subtracting the thermodynamic folding profiles of G2 from those of G3 yielded the following thermodynamic profile for the formation of a G-quartet stack: DeltaG degrees 20 = -2.2 kcal/mol, DeltaHcal = -14.6 kcal/mol, TDeltaScal = -12.4 kcal/mol, DeltanK+ = -0.3 mol of K+/mol, and DeltanW = 13 mol of H2O/mol. Furthermore, we used this profile to estimate the thermodynamic contributions of the loops and/or extra base sequences of each oligonucleotide in the G-quadruplex state. The average free energy contributions of the latter indicate that the incorporation of loops and base overhangs stabilizes quadruplex structures. This stabilization is enthalpy-driven and is due to base-stacking contributions.

Calorimetry, Differential Scanning↗
PubMedDate not supplied

A comparison of the properties and the solution structure for RNA and DNA quadruplexes which contain two GGAGG sequences joined with a tetranucleotide linker.

We have determined solution structure of r(GGAGGUUUUGGAGG) (R14) by NMR; the RNA 14-mer forms an intra-strand parallel quadruplex with a G-tetrad and a hexad, in which a G-tetrad core is augmented by association of two A residues. The quadruplex further forms a dimer through stacking interaction between the hexads. In order to obtain insight into the difference between RNA and DNA quadruplexes, we synthesized the corresponding DNA 14-mer, d(GGAGGTTTTGGAGG) (D14), and examined its properties and structure by CD, gel electrophoresis, and NMR. K+ ions increased the thermal stability of both R14 and D14 structures. The binding affinity of K+ ions to R14 was much higher than that to D14. The CD and gel electrophoretic studies suggest that D14 forms a quadruplex entirely different from that of R14 in the presence of K+ ions; two molecules of D14 form a quadruplex with both antiparallel and parallel strand alignments and with diagonal loops at both ends of the stacked G-tetrads. The NMR study also gave results that are consistent with such structure: alternate glycosidic conformation, 5'G(syn)-G(anti)3', and characteristic chemical shift data observed for many quadruplexes containing diagonal TTTT loops.

Circular Dichroism↗
PubMed2004

Intramolecular quadruplex conformation of human telomeric DNA assessed with 125I-radioprobing.

A repeated non-coding DNA sequence d(TTAGGG)n is present in the telomeric ends of all human chromosomes. These repeats can adopt multiple inter and intramolecular non-B-DNA conformations that may play an important role in biological processes. Two intramolecular structures of the telomeric oligonucleotide dAGGG(TTAGGG)3, antiparallel and parallel, have been solved by NMR and X-ray crystallography. In both structures, the telomeric sequence adopts an intramolecular quadruplex structure that is stabilized by G-4 quartets, but the ways in which the sequence folds into the quadruplex are different. The folds of the human telomeric DNA were described as an anti-parallel basket-type and a parallel propeller-type. We applied 125I-radioprobing to determine the conformation of the telomeric quadruplex in solution, in the presence of either Na+ or K+ ions. The probability of DNA breaks caused by decay of 125I is inversely related to the distance between the radionuclide and the sugar unit of the DNA backbone; hence, the conformation of the DNA backbone can be deduced from the distribution of breaks. The probability of breaks measured in the presence of Na+ and K+ were compared with the distances in basket-type and propeller-type quadruplexes obtained from the NMR and crystal structures. Our radioprobing data demonstrate that the antiparallel conformation was present in solution in the presence of both K+ and Na+. The preferable conformation in the Na+-containing solution was the basket-type antiparallel quadruplex whereas the presence of K+ favored the chair-type antiparallel quadruplex. Thus, we believe that the two antiparallel and the parallel conformations may coexist in solution, and that their relative proportion is determined by the type and concentration of ions.

Base Sequence↗
PubMed2006

Formation of the G-quadruplex and i-motif structures in retinoblastoma susceptibility genes (Rb).

The formation of G-quadruplex and i-motif structures in the 5' end of the retinoblastoma (Rb) gene was examined using chemical modifications, circular dichroism (CD) and fluorescence spectroscopy. It was found that substitutions of 8-methylguanine at positions that show syn conformations in antiparallel G-quadruplexes stabilize the structure in the G-rich strand. The complementary C-rich 18mer forms an i-motif structure, as suggested by CD spectroscopy. Based on the C to T mutation experiments, C bases participated in the C-C+ base pair of the i-motif structure were determined. Experiments of 2-aminopurine (2-AP) substitution reveal that an increase of fluorescence in the G-quadruplex relative to duplex is attributed to unstacked 2-AP within the loop of G-quadruplex. The fluorescence experiments suggest that formation of the G-quadruplex and i-motif can compete with duplex formation. Furthermore, a polymerase arrest assay indicated that formation the G-quadruplex structure in the Rb gene acts as a barrier in DNA synthesis.

5' Flanking Region↗
PubMed2000

G-Quadruplex DNA as a target for drug design.

Telomeres are structures on the ends of chromosomes that are required for chromosomal stability. Telomeric DNA contains a single-stranded G-rich DNA overhang, which may adopt a G-quadruplex structure. Telomere shortening has been implicated in cellular senescence. Telomerase is an enzyme which synthesizes the G-rich strand of telomere DNA. Telomerase activity is highly correlated with cancer and may allow cancer cells to escape senescence. Based on these observations, telomerase has been proposed as a potential target for anticancer drug design. The targeting of telomerase is associated with potential problems, including the existence in some cancer cells of telomerase-independent mechanisms for telomere maintenance, and the long delay time between telomerase inhibition and effects on proliferation. One promising approach for inhibiting telomerase involves targeting the G-quadruplex DNA structures thought to be involved in telomere and telomerase function. Compounds that specifically bind G-quadruplex DNA may interact directly with telomeres, in addition to inhibiting telomerase, and produce more immediate antiproliferative effects. The diamidoanthraquinones, porphyrins, and perylene diimides have all been shown to bind G-quadruplex DNA and inhibit telomerase. Most of these compounds also bind double-stranded DNA and are cytotoxic at the concentrations required to inhibit telomerase; however, certain perylene diimides appear to be non-cytotoxic, G-quadruplex selective telomerase inhibitors. Biological characterization of such compounds may provide validation for the concept of the G-quadruplex as a target in drug design.

Animals↗
PubMed2006

Characterization of an unusual folding pattern in a catalytically active guanine quadruplex structure.

In the presence of certain metal ions, DNA and RNA can form guanine quadruplex structures, which have been proposed to play a functional role in a variety of biological processes. An 18-nucleotide DNA oligomer, PS2.M, d(GTG3TAG3CG3T2G2), was previously reported to bind hemin and the resulting complex exhibited peroxidase activity. It was proposed that PS2.M folds unimolecularly into an antiparallel quadruplex with unusual, single-base loops and terminal guanines positioned in adjacent quartets. Here we describe structural and stability properties of PS2.M alone in different buffers and metal ions, using gel electrophoresis, circular dichroism (CD), ultraviolet (UV)-visible spectroscopies, and one-dimensional 1H nuclear magnetic resonance (NMR). Native gel behavior of PS2.M in the presence of either Na+ or Pb2+ suggests the formation of unimolecular structures but, in the presence of K+, both unimolecular and multistranded structures are observed. In the presence of Pb2+ ions, PS2.M forms a unimolecular quadruplex containing three guanine quartets. CD titrations reveal that binding of Pb2+ ions to PS2.M is stoichiometric, and a single lead cation suffices to fully fold PS2.M. The PS2.M-Na+ system also forms a similar unimolecular quadruplex. In the presence of K+, the PS2.M-K+ system forms mixed species. With increasing time and PS2.M concentration, the contribution of unimolecular species decreases while that of multimolecular species increases, and this behavior is independent of buffer media. These results suggest that the catalytically active form, studied in the presence of K+, may be a parallel, multistranded quadruplex rather than an antiparallel, unimolecular quadruplex.

Base Sequence↗
PubMed2002

Triplex and quadruplex DNA structures studied by electrospray mass spectrometry.

DNA triplex and quadruplex structures have been successfully detected by electrospray ionization mass spectrometry (ESI-MS). Circular dichroism and UV-melting experiments show that these structures are stable in 150 mM ammonium acetate at pH 7 for the quadruplexes and pH 5.5 for the triplexes. The studied quadruplexes were the tetramer [d(TGGGGT)](4), the dimer [d(GGGGTTTTGGGG)](2), and the intramolecular folded strand dGGG(TTAGGG)(3), which is an analog of the human telomeric sequence. The absence of sodium contamination allowed demonstration of the specific inclusion of n - 1 ammonium cations in the quadruplex structures, where n is the number of consecutive G-tetrads. We also detected the complexes between the quadruplexes and the quadruplex-specific drug mesoporphyrin IX. MS/MS spectra of [d(TGGGGT)](4) and the complex with the drug are also reported. As the drug does not displace the ammonium cations, one can conclude that the drug binds at the exterior of the tetrads, and not between them. For the triplex structure the ESI-MS spectra show the detection of the specific triplex, at m/z values typically higher than those typically observed for duplex species. Upon MS/MS the antigene strand, which is bound into the major groove of the duplex, separates from the triplex. This is the same dissociation pathway as in solution. To our knowledge this is the first report of a triplex DNA structure by electrospray mass spectrometry.

Acetates↗
PubMed2006

Physico-chemical analysis of G-quadruplex containing bunch-oligonucleotides.

A growing number of evidences suggest that DNA G-quadruplex structures play an important role in many relevant biological processes. The introduction of chemical modifications in quadruplex structures could enhance the in vivo biological activity. The correlation between the physico-chemical properties and chemical modifications represents an essential step toward the de novo design of quadruplex forming oligonucleotides for biomedical applications. We report the physico-chemical characterisation of a quadruplex formed by a bunch of four d(TG4T) oligonucleotides whose 3'-ends are linked together by a tetra-branched linker. The study was performed by circular dichroism, gel electrophoresis and molecular modelling techniques. The data indicate an high stability for this kind of quadruplex and add some information on the role of the tetra-branched linker on the quadruplex stability.

Models, Molecular↗
PubMed2005

Structural characterization of G-quadruplexes in deoxyguanosine clusters using ion mobility mass spectrometry.

The aggregation and conformation of deoxyguanosine (dG) in an ammonium acetate buffer solution were examined using mass spectrometry, ion mobility, and molecular mechanics/dynamics calculations. The nano-ESI mass spectrum indicated that 4 and 6 dGs cluster with 1 NH4+; 11 dGs with 2 NH4+; 14, 16, and 17 dGs with 3 NH4+; and 23 dGs with 4 NH4+. The collision cross sections with helium were measured and compared with calculated cross sections of theoretical structures generated by molecular mechanics/dynamics calculations. Three distinct arrival time distribution (ATD) peaks were observed for (4dG + NH4)+. One peak was assigned to the quadruplex structure of (4dG + NH4)+, while the other two peaks corresponded to the quadruplex structures of (8dG + 2NH4)2+ and (12dG + 3NH4)3+, all with the same m/z. Four ATD peaks were observed for (6dG + NH4)+ and assigned to the globular structure of (6dG + NH4)+, and the quadruplex structures of (12dG + 2NH4)2+, (18dG + 3NH4)3+, and (24dG + 4NH4)4+. Two ATD peaks were observed for (11dG + 2NH4)2+ and assigned to the quadruplex structures of (11dG + 2NH4)2+ and (22dG + 4NH4)4+. All of the other clusters in the mass spectrum (14, 16, and 17 dGs with 3 NH4+ and 23 dGs with 4 NH4+) only had one peak in their ATDs and in all cases the theoretical structures in a quadruplex arrangement agreed with the experimental cross sections. These results provide compelling evidence that quadruplexes are present in solution and retain their structure during the spray process, dehydration, and detection.

Deoxyguanosine↗
PubMed2002

Crystal structure of the potassium form of an Oxytricha nova G-quadruplex.

The crystal structures of the potassium-containing quadruplex formed from the Oxytricha nova sequence d(GGGGTTTTGGGG) are reported, in two space groups, the orthorhombic P2(1)2(1)2(1) and the trigonal P3(2)21, which diffract to 2.0 A and 1.49 A, respectively. The orthorhombic form contains two independent quadruplexes in the asymmetric unit, and the trigonal form contains one. All three of these quadruplexes adopt an identical fold, with two strands forming an antiparallel diagonal arrangement. This is identical with that observed previously in NMR studies of the native sodium and potassium forms, and a crystallographic analysis of it complexed with an O. nova protein. The present analysis demonstrates that the native structure is the same in solution and in the crystalline state and, moreover, that the nature of the counter-ion does not affect the overall fold of this quadruplex. The analysis corrects an earlier crystallographic study of this quadruplex. The conformation of the tetra-thymine loop is described in detail, which involves the third thymine base folding back to interact with the first thymine base. The water networks in the grooves and loops are described and, in particular, the ability of water molecules to form a continuous spine of hydration in the narrow groove is detailed. Each quadruplex has five potassium ions organised in a linear channel, with square antiprismatic coordination to each ion from oxygen atoms.

Animals↗
PubMed2004

Detection of quadruplex DNA structures in human telomeres by a fluorescent carbazole derivative.

Single-stranded telomeric DNA tends to form a four-base-paired planar structure termed G-quadruplex. This structure was easily formed in vitro in the presence of monovalent cations. However, the existence of this structure in native human telomeres is unclear. Here we address this important question through the distinctive properties of 3,6-bis(1-methyl-4-vinylpyridinium)carbazole diiodide (BMVC) upon binding to various DNA structures. Although the fluorescence of BMVC increases significantly in the presence of DNA, BMVC has high sensitivity and binding preference to quadruplex d(T(2)AG(3))(4) over duplex DNA. In addition, the fluorescent emissions were characterized around 575 nm for quadruplex d(T(2)AG(3))(4) and 545 nm for most of duplex DNA. The 575-nm fluorescence emissions were detected in the mixtures of 2 nM BMVC with the chromosomal DNA that were extracted from human cells, suggesting the presence of quadruplex structure in human nucleus. Further analyzing the BMVC fluorescence at the ends of metaphase chromosomes and other regions of chromosomes, we detected the quadruplex-binding BMVC fluorescence at telomere-proximal regions. Together these results provide the first evidence for the presence of quadruplex structures in human telomeres.

Binding Sites↗
PubMed1995

Structure and dynamics of interstrand guanine association in quadruplex telomeric DNA.

Exchanges of the amino and imino protons in guanine quartets of telomeric DNA have been time-resolved by laser Raman spectroscopy. The Raman dynamic probe has been applied to parallel and antiparallel quadruplexes formed by the telomeric repeat of Oxytricha nova, d(T4G4)4, and to the highly thermostable parallel quadruplex formed by d(G12). Time-dependent Raman spectra of the d(G12) quadruplex reveal two characteristic exchange reactions for guanine N2 amino groups. At 10 degrees C, the pseudo-first-order exchange rates are kN2H(10 degrees C) = 5.7 x 10(-3) and k'N2H'(10 degrees C) = 1.2 x 10(-2) min-1, assignable to Hoogsteen-hydrogen-bonded and non-hydrogen-bonded N2 protons, respectively. These measurements provide the first quantitative determination of two kinetically distinct N2 amino proton exchange reactions in the guanine quartet and demonstrate that amino group rotation about the C2-N2 bond is highly restricted in the quadruplex. No exchange of guanine N1 imino sites occurs in d(G12) at 10 degrees C, and N1 exchange remains slow even at 95 degrees C [kN1H(95 degrees C) = 2.7 x 10(-2) min-1], indicating severe suppression of imino exchange in guanine quartets. For both parallel and antiparallel quadruplexes of d(T4G4)4, proton exchange rates decrease in the order thymine N3 imino > guanine N2 amino > guanine N1 imino. The rapid exchange of thymine N3 imino sites indicates that thymine quartets are not stabilized in Oxytricha quadruplexes. The protium-->deuterium exchange experiments also establish new guanine Raman band assignments. Importantly, the 1603 cm-1 band is due to in-plane bending of N1-H, while the 1644 cm-1 band involves scissoring of the N2 amino group. Accordingly, the 1603 and 1644 cm-1 bands are potentially valuable markers of hydrogen-bonding interactions specific to guanine imino and amino sites, respectively. The present findings also show that guanine hydrogen bonding and exchange dynamics are not interrelated in a simple manner. Despite extraordinary retardation of N1 imino proton exchange, Raman markers suggest that Hoogsteen-type guanine-guanine hydrogen bonding (N1-H...O=C6) is comparable in strength to hydrogen bonding of N1-H with water and, surprisingly, much weaker than hydrogen bonding between N1-H and the cytosine N3 acceptor of Watson-Crick B DNA.

Animals↗
PubMed2001

Inhibition of the Bloom's and Werner's syndrome helicases by G-quadruplex interacting ligands.

G-Quadruplex DNAs are folded, non-Watson-Crick structures that can form within guanine-rich DNA sequences such as telomeric repeats. Previous studies have identified a series of trisubstituted acridine derivatives that are potent and selective ligands for G-quadruplex DNA. These ligands have been shown previously to inhibit the activity of telomerase, the specialized reverse transcriptase that regulates telomere length. The RecQ family of DNA helicases, which includes the Bloom's (BLM) and Werner's (WRN) syndrome gene products, are apparently unique among cellular helicases in their ability to efficiently disrupt G-quadruplex DNA. This property may be relevant to telomere maintenance, since it is known that the sole budding yeast RecQ helicase, Sgs1p, is required for a telomerase-independent telomere lengthening pathway reminiscent of the "ALT" pathway in human cells. Here, we show that trisubstituted acridine ligands are potent inhibitors of the helicase activity of the BLM and WRN proteins on both G-quadruplex and B-form DNA substrates. Inhibition of helicase activity is associated with both a reduction in the level of binding of the helicase to G-quadruplex DNA and a reduction in the degree to which the G-quadruplex DNA can support DNA-dependent ATPase activity. We discuss these results in the context of the possible utility of trisubstituted acridines as antitumor agents for the disruption of both telomerase-dependent and telomerase-independent telomere maintenance.

Acridines↗
PubMed2002

The Ff gene 5 single-stranded DNA-binding protein binds to the transiently folded form of an intramolecular G-quadruplex.

The Ff gene 5 protein (g5p) is classified as a single-stranded DNA-binding protein. However, we previously showed that g5p binds with high affinity to a SELEX-selected G-rich 58-mer DNA oligomer, I-3, that forms an intramolecular G-quadruplex [Wen, J.-D., Gray, C. W., and Gray, D. M. (2001) Biochemistry 40, 9300-9310]. In 200 mM NaCl at 37 degrees C, g5p binds to I-3 in two stages, the first stage being the formation of a discrete intermediate complex that appears to be a precursor to a saturated g5p x I-3 complex. For the present paper, CD spectroscopy and DMS methylation techniques were used to investigate the binding of g5p to the I-3 oligomer and to the truncated 26-nucleotide core of the I-3 oligomer. The core sequence, called I-3c26, was d(GGGGTCAGGCTGGGGTTGTGCAGGTC). Results were the following: (1) The g5p binds in one stage to I-3c26 in 200 mM NaCl at 37 degrees C. (2) The intermediate complex of g5p.I-3 is formed by the binding of g5p to the core sequence. (3) G-quadruplex structures are maintained in both the g5p x I-3 and g5p x I-3c26 complexes, but the bound G-quadruplex structures are altered from their respective steady-state folded forms in 200 mM NaCl. (4) CD kinetics measurements showed that the I-3c26 quadruplex folds in two stages and that a transiently folded form is apparently the same as the altered structure to which g5p binds. (5) DMS methylation protection and interference experiments identified two guanines that are differentially involved in the steady-state folded and g5p-bound G-quadruplex structures. A model for a possible I-3c26 G-quadruplex structure is described.

Base Sequence↗