SEARCH · Search PubMed

Results for “Repression domains”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

SourceResearch connectionFrom yearThrough year

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 109 records · Page 6Linked to original sources

PubMed1989

Functional domains of a negative regulatory protein, GAL80, of Saccharomyces cerevisiae.

To study the functional domains of a transcriptional repressor encoded by the GAL80 gene of Saccharomyces cerevisiae, we constructed various deletion and insertion mutations in the GAL80 coding region and determined the ability of these mutations to repress synthesis of galactose-metabolizing enzymes as well as the capacity of the mutant proteins to respond to the inducer. Two regions, from amino acids 1 to 321 and from amino acids 341 to 423, in the total sequence of 435 amino acids were required for repression. The internal region from amino acids 321 to 340 played a role in the response to the inducer. The 12 amino acids at the carboxy terminus were dispensable for normal functioning of the GAL80 protein. Using indirect immunofluorescence and subcellular fractionation techniques, we also found that two distinct regions (amino acids 1 to 109 and 342 to 405) within the putative repression domain were capable of directing cytoplasmically synthesized Escherichia coli beta-galactosidase to the yeast nucleus. In addition, three gal80 mutations were mapped at amino acid residues 183, 298, and 310 in the domain required for repression. On the basis of these results, we suggest that the GAL80 protein consists of a repression domain located in two separate regions (amino acid residues 1 to 321 and 341 to 423) that are interrupted by an inducer interaction domain (residues 322 to 340) and two nuclear localization domains (1 to 109 and 342 to 405) that overlap the repression domains.

Biological Transport↗

PubMed2001

Groucho augments the repression of multiple Even skipped target genes in establishing parasegment boundaries.

Groucho acts as a co-repressor for several Drosophila DNA binding transcriptional repressors. Several of these proteins have been found to contain both Groucho-dependent and -independent repression domains, but the extent to which this distinction has functional consequences for the regulation of different target genes is not known. The product of the pair-rule gene even skipped has previously been shown to contain a Groucho-independent repression activity. In the Even skipped protein, outside the Groucho-independent repression domain, we have identified a conserved C-terminal motif (LFKPY), similar to motifs that mediate Groucho interaction in Hairy, Runt and Hückebein. Even skipped interacts with Groucho in yeast and in vitro, and groucho and even skipped genetically interact in vivo. Even skipped with a mutated Groucho interaction motif, which abolished binding to Groucho, showed a significantly reduced ability to rescue the even skipped null phenotype when driven by the complete even skipped regulatory region. Replacing this motif with a heterologous Groucho interaction motif restored the rescuing function of Even skipped in segmentation. Further functional assays demonstrated that the Even skipped C terminus acts as a Groucho-dependent repression domain in early Drosophila embryos. This novel repression domain was active on two target genes that are normally repressed by Even skipped at different concentrations, paired and sloppy paired. When the Groucho interaction motif is mutated, repression of each target gene is reduced to a similar extent, with some activity remaining. Thus, the ability of Even skipped to repress different target genes at different concentrations does not appear to involve differential recruitment or function of Groucho. The accumulation of multiple domains of similar function within a single protein may be a common evolutionary mechanism that fine-tunes the level of activity for different regulatory functions.

Amino Acid Motifs↗

PubMed1996

The mixed lineage leukemia (MLL) protein involved in 11q23 translocations contains a domain that binds cruciform DNA and scaffold attachment region (SAR) DNA.

Translocations involving chromosome band 11q23, found in acute lymphoid and myeloid leukemias, disrupt the MLL gene. This gene encodes a putative transcription factor with regions of homology to several other proteins including the zinc fingers and other domains of the Drosophila trithorax gene product, and the "AT-hook" DNA-binding motif of high mobility group proteins. We have previously demonstrated that MLL contains transcriptional activation and repression domains using a GAL4 fusion protein system (21). The repression domain, which is capable of repressing transcription 3-5-fold, is located centromeric to the breakpoint region of MLL. The activation domain, located telomeric to the breakpoint region, activated transcription from a variety of promoters including ones containing only basal promoter elements. The level of activation was very high, ranging from 10-fold to more than 300-fold, depending on the promoter and cell line used for transient transfection. In translocations involving MLL, the protein produced from the der(11) chromosome which contains the critical junction for leukemogenesis includes the AT-hook domain and the repression domain. We assessed the DNA binding capability of the MLL AT-hook domain using bacterially expressed and purified AT-hook protein. In a gel mobility shift assay, the MLL AT-hook domain could bind cruciform DNA, recognizing structure rather than sequence of the target DNA. This binding could be specifically competed with Hoechst 33258 dye and with distamycin. In a nitrocellulose protein-DNA binding assay, the MLL AT-hook domain could bind to AT-rich SARs, but not to non-SAR DNA fragments. The role that the AT-hook binding to DNA may play in vivo is unclear, but it is likely that DNA binding could affect downstream gene regulation. The AT-hook domain retained on the der(11) would potentially recognize a different DNA target than the one normally recognized by the intact MLL protein. Furthermore, loss of an activation domain while retaining a repression domain on the der(11) chromosome could alter the expression of various downstream target genes, suggesting potential mechanisms of action for MLL in leukemia.

Amino Acid Sequence↗

PubMed2000

The FBP interacting repressor targets TFIIH to inhibit activated transcription.

FUSE-binding protein (FBP) binds the single-stranded far upstream element of active c-myc genes, possesses potent transcription activation and repression domains, and is necessary for c-myc expression. A novel 60 kDa protein, the FBP interacting repressor (FIR), blocked activator-dependent, but not basal, transcription through TFIIH. Recruited through FBP's nucleic acid-binding domain, FIR formed a ternary complex with FBP and FUSE. FIR repressed a c-myc reporter via the FUSE. The amino terminus of FIR contained an activator-selective repression domain capable of acting in cis or even in trans in vivo and in vitro. The repression domain of FIR targeted only TFIIH's p89/XPB helicase, required at several stages in transcription, but not factors required for promoter selection. Thus, FIR locks TFIIH in an activation-resistant configuration that still supports basal transcription.

Amino Acid Sequence↗

PubMed2002

Comparative study and identification of potent eukaryotic transcriptional repressors in gene switch systems.

In mammalian cells, proper gene regulation is achieved by the complex interplay of transcription factors that activate or repress gene expression by binding to the regulatory regions of target promoters. While transcriptional activators have been extensively characterised and classified into functional groups, relatively little is known about the comparative strength and cell type-specificity of transcriptional repressors. Here, we have compared the ability of a series of eukaryotic repression domains to silence basal and activated transcription. A series of the most potent repression domains was further tested in the context of a gene therapy gene-switch system in various cell types. The results indicate that the analysed repression domains exert varying silencing activities in different promoter contexts. Furthermore, their potential for gene silencing varies also depending on the cellular context. When multimerised within one chimeric repressor protein, particular combinations of repressor domains were found to display synergistic repressing effects and efficient repression in a panel of cell lines. This approach thus allowed the identification of transcriptional repressors that are both potent and versatile in terms of cellular specificity as a basis for gene switch systems.

Cell Line↗

PubMed2004

Promoter-targeted phage display selections with preassembled synthetic zinc finger libraries for endogenous gene regulation.

Regulation of endogenous gene expression has been achieved using synthetic zinc finger proteins fused to activation or repression domains, zinc finger transcription factors (TFZFs). Two key aspects of selective gene regulation using TFZFs are the accessibility of a zinc finger protein to its target DNA sequence and the interaction of the fused activation or repression domain with endogenous proteins. Previous work has shown that predicting a biologically active binding site at which a TF(ZF) can control gene expression is not always straightforward. Here, we used a library of preassembled three-finger zinc finger proteins (ZFPs) displayed on filamentous phage, and selected for ZFPs that bound along a 1.4 kb promoter fragment of the human ErbB-2 gene. Following affinity selection by phage display, 13 ZFPs were isolated and sequenced. Transcription factors were prepared by fusion of the zinc finger proteins with a VP64 activation domain or a KRAB repression domain and the transcriptional control imposed by these TFZFs was evaluated using luciferase reporter assays. Endogenous gene regulation activity was studied following retroviral delivery into A431 cells. Additional ZFP characterization included DNaseI footprinting to evaluate the integrity of each predicted protein:DNA interaction. The most promising TFZFs able to both up-regulate and down-regulate ErbB-2 expression were extended to six-finger proteins. The increased affinity and refined specificity demonstrated by the six-finger proteins provided reliable transcriptional control. As a result of studies with the six-finger proteins, the specific region of the promoter most accessible to transcriptional control by VP64-ZFP and KRAB-ZFP fusion proteins was elucidated and confirmed by DNaseI footprinting, flow cytometric analysis and immunofluorescence. The ZFP phage display library strategy disclosed here, coupled with the growing availability of genome sequencing information, provides a route to identifying gene-regulating TFZFs without the prerequisite of well-defined promoter elements.

Base Sequence↗

PubMed2004

Repression of Dpp targets in the Drosophila wing by Brinker.

Patterning along developing body axes is regulated by gradients of transcription factors, which activate or repress different genes above distinct thresholds. Understanding differential threshold responses requires knowledge of how these factors regulate transcription. In the Drosophila wing, expression of genes such as omb and sal along the anteroposterior axis is restricted by lateral-to-medial gradients of the transcriptional repressor Brinker (Brk). omb is less sensitive to repression by Brk than sal and is consequently expressed more laterally. Contrary to previous suggestions, we show that Brk cannot repress simply by competing with activators, but requires specific repression domains along with its DNA-binding domain. Brk possesses at least three repression domains, but these are not equivalent; one, 3R, is sufficient to repress omb but not sal. Thus, although sal and omb show quantitative differences in their response to Brk, there are qualitative differences in the mechanisms that Brk uses to repress them.

Amino Acid Sequence↗

PubMed2006

IMP1 interacts with poly(A)-binding protein (PABP) and the autoregulatory translational control element of PABP-mRNA through the KH III-IV domain.

Repression of poly(A)-binding protein (PABP) mRNA translation involves the formation of a heterotrimeric ribonucleoprotein complex by the binding of PABP, insulin-like growth factor II mRNA binding protein-1 (IMP1) and the unr gene encoded polypeptide (UNR) to the adenine-rich autoregulatory sequence (ARS) located at the 5' untranslated region of the PABP-mRNA. In this report, we have further characterized the interaction between PABP and IMP1 with the ARS at the molecular level. The dissociation constants of PABP and IMP1 for binding to the ARS RNA were determined to be 2.3 nM and 5.9 nM, respectively. Both PABP and IMP1 interact with each other, regardless of the presence of the ARS, through the conserved C-terminal PABP-C and K-homology (KH) III-IV domains, respectively. Interaction of PABP with the ARS requires at least three out of its four RNA-binding domains, whereas KH III-IV domain of IMP1 is necessary and sufficient for binding to the ARS. In addition, the strongest binding site for both PABP and IMP1 on the ARS was determined to be within the 22 nucleotide-long CCCAAAAAAAUUUACAAAAAA sequence located at the 3' end of the ARS. Results of our analysis suggest that both protein x protein and protein x RNA interactions are involved in forming a stable ribonucleoprotein complex at the ARS of PABP mRNA.

5' Untranslated Regions↗

PubMed2004

Ubc9 interacts with chicken ovalbumin upstream promoter-transcription factor I and represses receptor-dependent transcription.

Chicken ovalbumin upstream promoter-transcription factors (COUP-TFs) are orphan receptors involved in regulation of neurogenesis and organogenesis. COUP-TF family members are generally considered to be transcriptional repressors and several mechanisms have been proposed to underlie this activity. To explore novel transcriptional coregulators for COUP-TFs, we used the COUP-TFI as bait in a yeast two-hybrid screen of an adrenocortical adenoma cDNA library. We have identified Ubc9, a class E2 conjugating enzyme of small ubiquitin-related modifier (SUMO)-1 as a COUP-TFI corepressor. Ubc9 interacts with COUP-TFI in yeast and in glutathione S-transferase pulldown and coimmunoprecipitation assays. Fluorescence imaging studies show that both Ubc9 and COUP-TFI are colocalized in the nuclei of transfected COS-1 cells. The C-terminal region of Ubc9 encoding amino acids 59-158 interacts with the C-terminus of COUP-TFI encoding amino acids 383-403, in which transcriptional repression domains are located. Mammalian one-hybrid assays utilizing a variety of Ubc9 fragments fused to Gal4 DNA-binding domain show that a Ubc9 fragment encoding amino acids 1-89 contains autonomous transferrable repression domain. Transfection of Ubc9 into COS-1 cells markedly enhances transcriptional repression by Gal4 DNA-binding domain-fused to COUP-TFI(155-423), but not by Gal4-COUP-TFI(155-388) which lacks a repressor domain. Coexpression of a C-terminal deletion mutant of Ubc9(1-58), which fails to interact with COUP-TFI, but retains a transcriptional repression domain, has no effect on Gal4-COUP-TFI-mediated repression activity. These findings indicate that interaction of Ubc9 with COUP-TFI is crucial for the corepressor function of Ubc9. Overexpression of Ubc9 similarly enhances COUP-TFI-dependent repression of the promoter activity of the bovine CYP17 gene encoding steroid 17alpha-hydroxylase. In addition, the C93S mutant of Ubc9, which abrogates SUMO-1 conjugation activity, continues to function as a COUP-TFI corepressor. Our studies indicate that Ubc9 functions as a novel COUP-TFI corepressor, the function of which is distinct from its SUMO-1 conjugating enzyme activity.

Animals↗

PubMed2004

The transactivating function of peroxisome proliferator-activated receptor gamma is negatively regulated by SUMO conjugation in the amino-terminal domain.

Peroxisome proliferator-activated receptor (PPAR)-gamma2, a member of the nuclear hormone receptor superfamily, plays a key role in adipocyte differentiation. Its amino-terminal region carries a ligand-independent gene-activating function, AF-1, and is composed of activation as well as repression domains. We have found PPARgamma2 and its isoform, PPARgamma1, to be modified by small ubiquitin-related modifier (SUMO)-1 in vivo, at a lysine residue in the repression domain. In reporter assays, a sumoylation-defective K107R mutant of PPARgamma2 exhibited much stronger transactivation than the wild-type, comparable with that of a mutant deleted for the repression domain. A close inverse correlation was observed between the levels of sumoylation and transactivation by PPARgamma2, in analyses employing PPARgamma2 forms with mutations in the sumoylation motif and a dominant-negative mutant of the SUMO conjugating enzyme, Ubc9. Studies with phosphorylation-defective mutants suggested that phosphorylation at S112 of PPARgamma2 promotes K107 sumoylation, and this latter exerts the more potent repressive effects. The K107R mutant PPARgamma2, when infected into NIH3T3 cells with a viral vector, promoted differentiation into adipocytes more efficiently than the wild-type. These observations provide evidence that sumoylation is involved in negative regulation of the transactivating function of PPARgamma2.

HeLa Cells↗

PubMed1994

Human hepatitis virus X gene encodes a regulatory domain that represses transactivation of X protein.

The human hepatitis B virus (HBV) X gene seems to be essential for establishment of viral infection, and the X gene product, HBx, transactivates virus and host genes through a wide variety of cis-elements, whereas regulation of HBx has not been fully understood. We found that transactivation-negative HBx mutants truncated at the C-terminal portion specifically repressed the HBx transactivation in trans. The ability to trans-repress the HBx transactivation is confined to the N-terminal third of HBx. Transactivation-positive constructs of HBx were divided into two groups by their sensitivity to trans-repression due to the presence of the N-terminal third. Thus the regulatory domain, the N-terminal third, is separated from the transacting domain and responsible for the negative regulations, the trans-repression and sensitivity to X trans-repression. A possible direct association between the HBx regulatory domains was tested by far-Western blotting using purified fused forms of HBx proteins. The regulatory domain was found to associate preferentially with the full HBx or the regulatory domain, but not with the transacting domain. Taken together, it is possible that HBx has a self-regulatory mechanism that avoids excessive HBx transactivation and is important for regulation of X gene expression.

Binding Sites↗

PubMed2001

TEL contacts multiple co-repressors and specifically associates with histone deacetylase-3.

TEL (Translocation-ETS-Leukemia or ETV 6) is disrupted by multiple chromosomal translocations in acute leukemia. The loss of heterozygosity at the TEL locus in leukemias and the hemizygous deletion of TEL that is observed in various tumors, suggests that TEL is a tumor suppressor. Overexpression of TEL alters cellular morphology and represses the expression of the matrix metalloproteinase stromelysin-1. Based on these studies, deletion analysis was used to define the minimal repression domains of TEL. TEL-mediated repression required both the N-terminal pointed domain and a central region composed of amino acids 268-303. The mSin3A and N-CoR corepressors bind to the pointed domain and the central repression domain of TEL, respectively. Unexpectedly, histone deacetylase-3, but not other histone deacetylases, also associates with the central region of TEL. Histone deacetylase-3 interacts with a TEL mutant that cannot bind N-CoR, suggesting that this is a direct interaction with TEL. In addition, histone H3 was under-acetylated near the TEL-binding sites in the endogenous stromelysin-1 promoter when TEL was expressed. Furthermore, trichostatin A, a potent histone deacetylase inhibitor, impaired TEL-dependent repression of the stromelysin-1 promoter. Finally, while TEL-expression induced cellular aggregation of Ras-transformed cells, Trichostatin A reversed the TEL-induced cellular aggregation phenotype. Thus, the cumulative data suggests that histone deacetylase-3 activity is required for the transcriptional functions of TEL.

3T3 Cells↗

PubMed2001

The basic helix-loop-helix protein, sharp-1, represses transcription by a histone deacetylase-dependent and histone deacetylase-independent mechanism.

Many aspects of neurogenesis and neuronal differentiation are controlled by basic helix-loop-helix (bHLH) proteins. One such factor is SHARP-1, initially identified on the basis of its sequence similarity to hairy. Unlike hairy, and atypically for bHLHs, SHARP-1 is expressed late in development, suggestive of a role in terminal aspects of differentiation. Nevertheless, the role of SHARP-1 and the identity of its target genes remain unknown. During the course of a one-hybrid screen for transcription factors that bind to regulatory domains of the M1 muscarinic acetylcholine receptor gene, we isolated the bHLH transcription factor SHARP-1. In this study, we investigated the functional role of SHARP-1 in regulating transcription. Fusion proteins of SHARP-1 tethered to the gal4 DNA binding domain repress both basal and activated transcription when recruited to either a TATA-containing or a TATAless promoter. Furthermore, we identified two independent repression domains that operate via distinct mechanisms. Repression by a domain in the C terminus is sensitive to the histone deacetylase inhibitor trichostatin A, whereas repression by the bHLH domain is insensitive to TSA. Furthermore, overexpression of SHARP-1 represses transcription from the M(1) promoter. This study represents the first report to assign a function to, and to identify a target gene for, the bHLH transcription factor SHARP-1.

Amino Acid Sequence↗

PubMed1999

PRDI-BF1/Blimp-1 repression is mediated by corepressors of the Groucho family of proteins.

The PRDI-BF1/Blimp-1 protein is a transcriptional repressor required for normal B-cell differentiation, and it has been implicated in the repression of beta-interferon (IFN-beta) and c-myc gene expression. Here, we show that PRDI-BF1 represses transcription of the IFN-beta promoter and of an artificial promoter through an active repression mechanism. We also identified a minimal repression domain in PRDI-BF1 that is sufficient for transcriptional repression when tethered to DNA as a Gal4 fusion protein. Remarkably, this repression domain interacts specifically with hGrg, TLE1, and TLE2 proteins, all of which are members of the Groucho family of transcriptional corepressors. In addition, the hGrg protein itself can function as a potent repressor when tethered to DNA through the Gal4 DNA-binding domain. We also find that the amino-terminal glutamine-rich domains of hGrg and TLE1 are sufficient to mediate dimerization of the two Groucho family proteins. Proteins containing only this domain can function as a dominant-negative inhibitor of PRDI-BF1 repression, and can significantly increase the IFN-beta promoter activity after virus induction. We conclude that PRDI-BF1/Blimp-1 represses transcription by recruiting a complex of Groucho family proteins to DNA, and suggest that such corepressor complexes are required for the postinduction repression of the IFN-beta promoter.

Amino Acid Sequence↗

PubMed2005

p21WAF1/CIP1 regulates the p300 sumoylation motif CRD1 through a C-terminal domain independently of cyclin/CDK binding.

Although best known for its ability to inhibit Cyclin/Cdk complexes and the replication protein PCNA, p21(WAF1/CIP1) is a multifunctional protein that interacts with many cellular binding partners, including a number of transcriptional regulators. Previously, we characterized p21 derepression of the p300 sumoylation-dependent transcriptional repression domain, CRD1. Such repression domains are at least partially dependent upon recruitment of histone deacetylase (HDAC) complexes but the mechanism through which p21 selectively disrupts CRD1 activity remains unknown. Here, we demonstrate that distinct motifs in the C-terminus of p21 are required for regulation of p300 CRD1 function and that this effect does not correlate with Cyclin or PCNA binding. Through the creation of N-terminal glutathione-s-transferase fusion proteins, which also overcome the problems of instability that result from many p21 mutations, we investigated p21 binding to HDACs. Although p21 binds both Class I and Class II HDACs in vitro, only weak association with HDAC1 and 2 is seen in cells. Mutation of the p21 PCNA binding domain significantly increases this interaction suggesting that binding is mutually exclusive and only naturally occurs under certain conditions. Binding of HDACs also failed to correlate with CRD1 inducibility, suggesting that p21 targets other transcriptional repression complexes to mediate this effect.

Amino Acid Motifs↗

PubMed2004

Orphan nuclear receptor small heterodimer partner, a novel corepressor for a basic helix-loop-helix transcription factor BETA2/neuroD.

Small heterodimer partner (SHP; NR0B2) is an atypical orphan nuclear receptor that lacks a conventional DNA binding domain (DBD) and represses the transcriptional activity of various nuclear receptors. In this study, we examined the novel cross talk between SHP and BETA2/NeuroD, a basic helix-loop-helix transcription factor. In vitro and in vivo protein interaction studies showed that SHP physically interacts with BETA2/NeuroD, but not its heterodimer partner E47. Moreover, confocal microscopic study and immunostaining results demonstrated that SHP colocalized with BETA2 in islets of mouse pancreas. SHP inhibited BETA2/NeuroD-dependent transactivation of an E-box reporter, whereas SHP was unable to repress the E47-mediated transactivation and the E-box mutant reporter activity. In addition, SHP repressed the BETA2-dependent activity of glucokinase and cyclin-dependent kinase inhibitor p21 gene promoters. Gel shift and in vitro protein competition assays indicated that SHP inhibits neither dimerization nor DNA binding of BETA2 and E47. Rather, SHP directly repressed BETA2 transcriptional activity and p300-enhanced BETA2/NeuroD transcriptional activity by inhibiting interaction between BETA2 and coactivator p300. We also showed that C-terminal repression domain within SHP is also required for BETA2 repression. However, inhibition of BETA2 activity was not observed by naturally occurring human SHP mutants that cannot interact with BETA2/NeuroD. Taken together, these results suggest that SHP acts as a novel corepressor for basic helix-loop-helix transcription factor BETA2/NeuroD by competing with coactivator p300 for binding to BETA2/NeuroD and by its direct transcriptional repression function.

Animals↗

PubMed2003

Expression of the GLI2 oncogene and its isoforms in human basal cell carcinoma.

BACKGROUND: Mutations of the patched (Ptc) gene, a developmental regulator implicated in the signalling pathway via sonic hedgehog (Shh) and smoothened (Smo), play an essential pathogenic role in the development of basal cell carcinomas (BCCs). We previously reported the upregulation of Shh signal transducers, including Ptc, Smo and hedgehog-interacting protein, in BCCs. In vertebrates, specific downstream effectors in the Shh signalling pathway include three zinc-finger transcription factors, Gli1, Gli2 and Gli3. Gli1 possesses only an activation domain, while Gli2 and Gli3 contain both activation and repression domains. It remains unclear which of these transcription factors are responsible for the development of BCCs. OBJECTIVES: To examine the expression pattern of Gli2 mRNA by human BCCs in comparison with those by normal human skin and various skin tumours. METHODS: We performed quantitative reverse transcriptase-polymerase chain reaction analyses with a series of samples from BCCs, other skin tumours and normal skin. RESULTS: We found that Gli2 mRNA expression was enhanced in the BCCs we examined, whereas there was no significant increase in other skin tumours or normal skin. Of four spliced Gli2 isoforms designated Gli2alpha, beta, gamma and delta, the expression of Gli2beta mRNA was increased the most in BCCs. CONCLUSIONS: As Gli2beta is an isoform spliced at the first splicing site containing a repression domain and consists of an intact activation domain, its overexpression may lead to the upregulation of the Shh signalling pathway, thereby inducing BCCs.

Aged↗

PubMed1999

Repression by Ikaros and Aiolos is mediated through histone deacetylase complexes.

Here we show that the lymphoid lineage-determining factors Ikaros and Aiolos can function as strong transcriptional repressors. This function is mediated through two repression domains and is dependent upon the promoter context and cell type. Repression by Ikaros proteins correlates with hypo-acetylation of core histones at promoter sites and is relieved by histone deacetylase inhibitors. Consistent with these findings, Ikaros and its repression domains can interact in vivo and in vitro with the mSin3 family of co-repressors which bind to histone deacetylases. Based on these and our recent findings of associations between Ikaros and Mi-2-HDAC, we propose that Ikaros family members modulate gene expression during lymphocyte development by recruiting distinct histone deacetylase complexes to specific promoters.

Acetylation↗