Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Promotion”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 109 records · Page 6Linked to original sources
PubMed1985

Site-directed mutagenesis of the Klebsiella pneumoniae nifL and nifH promoters and in vivo analysis of promoter activity.

The role of conserved nucleotides in nitrogen-fixation promoter function has been examined using both oligonucleotide and chemical mutagenesis to introduce base changes in the Klebsiella pneumoniae nifL and nifH promoters. Among ten mutations analysed, including six spontaneous mutations, base changes at -12, -13, -14, and -26, located in previously identified conserved sequences, perturbed the activity of the promoters, demonstrating that these sequences are required for transcription. Not all base changes produced similar strong promoter down phenotypes when the nifL and nifH promoters were compared: activation of the nifH promoter by the nifA gene product was less sensitive to base changes in conserved nucleotides than was activation of the equivalently altered nifL promoter by the nifA or ntrC products. We have found that the nifH promoter can be weakly activated by the ntrC product; this activation shows the same down response to base changes seen with ntrC activation of the nifL promoter. We present evidence that the efficient activation of the nifH promoter by nifA (but not ntrC) can be attributed to specific upstream sequences present in the nifH promoter.

Anti-Bacterial Agents↗
PubMed1985

Promoter selectivity of E. coli RNA polymerase: analysis of the promoter system of convergently-transcribed dnaQ-rnh genes.

Promoter properties were analyzed for the convergently-overlapped E. coli genes coding for the DNA polymerase III epsilon subunit (dnaQ) and the ribonuclease H (rnh). The rates of open complex formation for a single promoter of the rnh gene and two tandem promoters of the dnaQ gene were constant whether they are located on a single DNA fragment or separated into individual fragments. The relative expression levels of these three promoters, as measured using an in vitro mixed transcription system, varied differentially depending on the concentration of RNA polymerase. At low enzyme concentrations, the downstream promoter (P2) of the dnaQ gene was utilized preferentially, but the upstream promoter (P1) was utilized as well when the enzyme concentration was increased. This indicates different physiological roles between the two dnaQ promoters. The level of rnh transcription was as low as that of dnaQ-1 RNA synthesis but the rnh promoter was utilized as well as the dnaQ P2 promoter when it was separated from the dnaQ promoters. This implies a promoter interference between the convergently transcribed genes.

Base Sequence↗
PubMed1993

Contributions of promoter context and structure to regulated expression of the F plasmid traY promoter in Escherichia coli K-12.

Expression of the F plasmid traY promoter in vivo requires both host (E. coli) and plasmid encoded proteins. As judged by transcript size and primer extension analyses, the F plasmid traY promoter was utilized in vitro by purified E. coli sigma 70 RNA polymerase in the absence of other proteins. However, in vitro transcription required supercoiled templates. Endonuclease protection experiments showed that RNA polymerase is unable to form a stable complex at the traY promoter in linear or relaxed circular templates. In vitro transcription with linear templates could be elicited by altering the traY -10 and -35 hexamers to the consensus sequences. Alterations that reduced the effect of template supercoiling on apparent promoter strength in vitro also reduced the effect of the F plasmid TraJ protein on traY expression in vivo. Apparent traY promoter strength in vitro, estimated in template competition experiments, was unaltered by deletion of tra DNA normally upstream of the promoter, a change in promoter context that elicited high levels of promoter activity in TraJ- cells. These data suggest a model for regulated traY promoter activity in which a nucleoprotein complex involving tra DNA immediately upstream locally relaxes traY promoter DNA. TraJ and perhaps other activators could disrupt the complex, allowing promoter DNA to equilibrate at the prevailing negative superhelical density and thereby eliciting transcription initiation.

Bacterial Outer Membrane Proteins↗
PubMed1993

Genetic evidence that promoter P2 is the physiologically significant promoter for the pyrBI operon of Escherichia coli K-12.

The pyrBI operon of Escherichia coli K-12 encodes the two nonidentical subunits of the pyrimidine biosynthetic enzyme aspartate transcarbamylase (ATCase). Expression of this operon is negatively regulated by pyrimidine availability primarily through UTP-sensitive transcriptional attenuation and, to a lesser extent, at the level of transcriptional initiation. Previous studies indicated that the pyrBI operon was transcribed from tandem sigma 70 promoters designated P1 and P2, with the large majority of transcription initiated at the more downstream promoter P2. To more clearly define the roles of these promoters, mutations that severely impair or inactivate individual promoters were constructed in the chromosomal pyrBI operon, and their effects on ATCase synthesis were measured. In cells grown under conditions of either pyrimidine excess or pyrimidine limitation, more than 99% of all ATCase synthesis was directed by transcripts initiated at promoter P2, indicating that it is the only physiologically significant pyrBI promoter. However, mutations that effectively inactivate promoter P1 caused a 15% reduction in ATCase levels, apparently by inhibiting transcription from promoter P2 by an unknown mechanism. Support for this explanation was provided by the demonstration that little, if any, transcriptional initiation occurred at promoter P1 in a transcriptional fusion vector whereas a high level of transcription was initiated at promoter P2 in an equivalent construction. Our results also provide evidence for pyrimidine-mediated regulation of transcriptional initiation at promoter P2 over a severalfold range and show that cells can grow reasonably well with very low levels of ATCase, apparently because of changes in the concentration of allosteric effectors that increase the specific activity of the enzyme.

Aspartate Carbamoyltransferase↗
PubMed2004

Mutational analysis of the Myxococcus xanthus Omicron4499 promoter region reveals shared and unique properties in comparison with other C-signal-dependent promoters.

The bacterium Myxococcus xanthus undergoes multicellular development during times of nutritional stress and uses extracellular signals to coordinate cell behavior. C-signal affects gene expression late in development, including that of Omega4499, an operon identified by insertion of Tn5 lac into the M. xanthus chromosome. The Omega4499 promoter region has several sequences in common with those found previously to be important for expression of other C-signal-dependent promoters. To determine if these sequences are important for Omega4499 promoter activity, the effects of mutations on expression of a downstream reporter gene were tested in M. xanthus. Although the promoter resembles those recognized by Escherichia coli sigma(54), mutational analysis implied that a sigma(70)-type sigma factor likely recognizes the promoter. A 7-bp sequence known as a C box and a 5-bp element located 6 bp upstream of the C box have been shown to be important for expression of other C-signal-dependent promoters. The Omega4499 promoter region has C boxes centered at -33 and -55 bp, with 5-bp elements located 7 and 8 bp upstream, respectively. A multiple-base-pair mutation in any of these sequences reduced Omega4499 promoter activity more than twofold. Single base-pair mutations in the C box centered at -33 bp yielded a different pattern of effects on expression than similar mutations in other C boxes, indicating that each functions somewhat differently. An element from about -81 to -77 bp exerted a twofold positive effect on expression but did not appear to be responsible for the C-signal dependence of the Omega4499 promoter. Mutations in sigD and sigE, which are genes that encode sigma factors, reduced expression from the Omega4499 promoter. The results provide further insight into the regulation of C-signal-dependent genes, demonstrating both shared and unique properties among the promoter regions so far examined.

Base Sequence↗
PubMed1998

In vitro transcription of pe38/polyhedrin hybrid promoters reveals sequences essential for recognition by the baculovirus-induced RNA polymerase and for the strength of very late viral promoters.

In vitro transcription was used to analyze the promoter specificity of the alpha-amanitin-resistant RNA polymerase that is induced late during infection of Autographa californica multicapsid nuclear polyhedrosis virus. By modifying the preparation of crude nuclear extracts, we have established an assay that permits differentiation between weak late and strong very late viral promoters. The virus-induced RNA polymerase initiates at a TAAG sequence motif in both late and very late promoters. Based on the sensitivity of our in vitro transcription system, we have investigated the sequences responsible for a functional TAAG motif and their putative role with respect to the strength of very late promoters. By constructing hybrid promoters between the early pe38 and the very late polyhedrin promoters, we demonstrated that the replacement of 7 nucleotides upstream of the nonfunctional TAAG sequences in the pe38 promoter with the corresponding sequences of the polyhedrin promoter was sufficient for recognition by the virus-induced RNA polymerase. The strength of the very late polyhedrin promoter was established after replacing the 5' untranslated sequences of the pe38 promoter by those of the polyhedrin promoter in addition to the 7 nucleotides upstream of the TAAG motif.

Animals↗
PubMed2004

A negative regulatory element (base pairs -204 to -177) of the EICP0 promoter of equine herpesvirus 1 abolishes the EICP0 protein's trans-activation of its own promoter.

The early EICP0 protein is a powerful trans-activator that activates all classes of equine herpesvirus 1 (EHV-1) promoters but, unexpectedly, trans-activates its own promoter very weakly. Transient transfection assays that employed constructs harboring deletions within the EICP0 promoter indicated that EICP0 cis-acting sequences within bp -224 to -158 relative to the first ATG abolished the EICP0 protein's trans-activation of its own promoter. When inserted into the promoters of other EHV-1 genes, this sequence also downregulated activation of the immediate-early IE(-169/+73), early thymidine kinase TK(-215/+97), and late glycoprotein K gK(-83/+14) promoters, indicating that the cis-acting sequence (-224 to -158) downregulated expression of representative promoters of all classes of EHV-1 genes and contains a negative regulatory element (NRE). To define the cis-acting element(s), three synthetic oligonucleotides (Na [bp -224 to -195], Nb [bp -204 to -177], and Nc [bp -185 to -156]) were synthesized and cloned upstream of the EICP0(-157/-21) promoter. Of the three synthetic sequences, only the Nb oligonucleotide caused the downregulation of the EICP0 promoter. The NRE was identified as a 28-bp element to lie at -204 to -177 that encompassed the sequence of ([-204]AGATACAGATGTTCGATAAATTGGAACC[-177]). Gel shift assays performed with mouse L-M, rabbit RK-13, and human HeLa cell nuclear extracts and gamma-(32)P-labeled wild-type and mutant NREs demonstrated that a ubiquitous nuclear protein(s) (NRE-binding protein, NREBP) binds specifically to a sequence (bp -193 to -183) in the NRE. The NREBP is also present in the nucleus of EHV-1-infected cells; however, the amount of NREBP in EHV-1-infected L-M cells that bound to the Nb oligonucleotide was reduced compared to that in uninfected L-M cells. Transient transfection assays showed that deletions or mutations within the NREBP-binding site abolished the NRE activity of the EICP0 promoter. These results suggested that the NREBP may mediate the NRE activity of the EICP0 promoter and may function in the coordinate expression of EHV-1 genes.

Animals↗
PubMed2006

Analyses of subgenomic promoters of Hibiscus chlorotic ringspot virus and demonstration of 5' untranslated region and 3'-terminal sequences functioning as subgenomic promoters.

Hibiscus chlorotic ringspot virus (HCRSV), which belongs to the genus Carmovirus, generates two 3'-coterminal subgenomic RNAs (sgRNAs) of 1.4 kb and 1.7 kb. Transcription start sites of the two sgRNAs were identified at nucleotides (nt) 2178 and 2438, respectively. The full promoter of sgRNA1, a 118-base sequence, is localized between positions +6 and -112 relative to its transcription start site (+1). Similarly, a 132-base sequence, from +6 to -126, defines the sgRNA2 promoter. Computer analysis revealed that both sgRNA promoters share a similar two-stem-loop (SL1 + SL2) structure, immediately upstream of the transcription start site. Mutational analysis of the primary sequence and secondary structures showed further similarities between the two subgenomic promoters. The basal portion of SL2, encompassing the transcription start site, was essential for transcription activity in each promoter, while SL1 and the upper portion of SL2 played a role in transcription enhancement. Both the 5' untranslated region (UTR) and the last 87 nt at the 3' UTR of HCRSV genomic RNA are likely to be the putative genomic plus-strand and minus-strand promoters, respectively. They function well as individual sgRNA promoters to produce ectopic subgenomic RNAs in vivo but not to the same levels of the actual sgRNA promoters. This suggests that HCRSV sgRNA promoters share common features with the promoters for genomic plus-strand and minus-strand RNA synthesis. To our knowledge, this is the first demonstration that both the 5' UTR and part of the 3' UTR can be duplicated and function as sgRNA promoters within a single viral genome.

3' Untranslated Regions↗
PubMed1992

The promoter for the procyclic acidic repetitive protein (PARP) genes of Trypanosoma brucei shares features with RNA polymerase I promoters.

All eukaryotic protein-coding genes are believed to be transcribed by RNA polymerase (Pol) II. An exception may exist in the protozoan parasite Trypanosoma brucei, in which the genes encoding the variant surface glycoprotein (VSG) and procyclic acidic repetitive protein (PARP) are transcribed by an RNA polymerase that is resistant to the Pol II inhibitor alpha-amanitin. The PARP and VSG genes were proposed to be transcribed by Pol I (C. Shea, M. G.-S. Lee, and L. H. T. Van der Ploeg, Cell 50:603-612, 1987; G. Rudenko, M. G.-S. Lee, and L. H. T. Van der Ploeg, Nucleic Acids Res. 20:303-306, 1992), a suggestion that has been substantiated by the finding that trypanosomes can transcribe protein-coding genes by Pol I (G. Rudenko, H.-M. Chung, V. P. Pham, and L. H. T. Van der Ploeg, EMBO J. 10:3387-3397, 1991). We analyzed the sequence elements of the PARP promoter by linker scanning mutagenesis and compared the PARP promoter with Pol I, Pol II, and Pol III promoters. The PARP promoter appeared to be of limited complexity and contained at least two critical regions. The first was located adjacent to the transcription initiation site (nucleotides [nt] -69 to +12) and contained three discrete domains in which linker scanning mutants affected the transcriptional efficiency: at nt -69 to -56, -37 to -11, and -11 to +12. The second region was located between nt -140 and -131, and a third region may be located between nt -228 and -205. The nucleotide sequences of these elements, and their relative positioning with respect to the transcription initiation site did not resemble those of either Pol II or Pol III promoter elements, but rather reflected the organization of Pol I promoters in (i) similarity in the positioning of essential domains in the PARP promoter and Pol I promoter, (ii) strong sequence homology between the PARP core promoter element (nt -37 to -11) and identically positioned nucleotide sequences in the trypanosome rRNA and VSG gene promoters, and (iii) moderate effects on promoter activity of mutations around the transcription initiation site.

Base Sequence↗
PubMed2000

Promoter-proximal pausing on the hsp70 promoter in Drosophila melanogaster depends on the upstream regulator.

RNA polymerase II pauses in the promoter-proximal region of many genes during transcription. In the case of the hsp70 promoter from Drosophila melanogaster, this pause is long-lived and occurs even when the gene is not induced. Paused polymerase escapes during heat shock when the transcriptional activator heat shock factor associates with the promoter. However, pausing is still evident, especially when induction is at an intermediate level. Yeast Gal4 protein (Gal4p) will induce transcription of the hsp70 promoter in Drosophila when binding sites for Gal4p are positioned upstream from the hsp70 TATA element. To further our understanding of promoter-proximal pausing, we have analyzed the effect of Gal4p on promoter-proximal pausing in salivary glands of Drosophila larvae. Using permanganate genomic footprinting, we observed that various levels of Gal4p induction resulted in an even distribution of RNA polymerase throughout the first 76 nucleotides of the transcribed region. In contrast, promoter-proximal pausing still occurs on endogenous and transgenic hsp70 promoters in salivary glands when these promoters are induced by heat shock. We also determined that mutations introduced into the region where the polymerase pauses do not inhibit pausing in a cell-free system. Taken together, these results indicate that promoter-proximal pausing is dictated by the regulatory proteins interacting upstream from the core promoter region.

Animals↗
PubMed2006

Regulation of the human biotin transporter hSMVT promoter by KLF-4 and AP-2: confirmation of promoter activity in vivo.

The mechanism of biotin uptake in human intestine has been well characterized and involves the human sodium-dependent multivitamin transporter (hSMVT), yet little is known about the molecular/transcriptional regulation of the system. Previous investigations cloned the 5' regulatory region of the hSMVT gene and identified the minimal promoter. To expand these investigations, we compared activity of the hSMVT promoter in three human intestinal epithelial cell lines (NCM460, Caco-2, and HuTu-80) and contrasted a renal epithelial cell line (HEK-293). We analyzed the role of putative cis-elements in regulating promoter activity and confirmed activity of the cloned hSMVT promoter in vivo. In vitro studies demonstrated that all cell lines utilized the same minimal promoter region, and mutation of specific cis-regulatory elements [Kruppel-like factor 4 (KLF-4) and activator protein-2 (AP-2)] led to a decrease in promoter activity in all intestinal cell types but not in renal cells. Using electrophoretic mobility shift assays, we identified two specific DNA/protein complexes. Using oligonucleotide competition and antibody supershift analysis, we determined that KLF-4 and AP-2 were involved in forming the complexes. In HEK-293 cells, overexpressing KLF-4 increased the endogenous hSMVT message levels threefold and activated a cotransfected hSMVT promoter-reporter construct. In vivo studies using hSMVT promoter-luciferase transgenic mice established physiological relevance and showed the pattern of hSMVT promoter expression to be similar to endogenous mouse SMVT mRNA expression. The results demonstrate, for the first time, the importance of KLF-4 and AP-2 in regulating the activity of the hSMVT promoter in the intestine and provide direct in vivo confirmation of hSMVT promoter activity.

Animals↗
PubMed2005

Osteo-Promoter Database (OPD) -- promoter analysis in skeletal cells.

BACKGROUND: Increasing our knowledge about the complex expression of genes in skeletal tissue will provide a better understanding of the physiology of skeletal cells. The study summarizes transcriptional regulation factors interacting and cooperating at promoter regions that regulate gene expression. Specifically, we analyzed A/T rich elements along the promoter sequences. DESCRIPTION: The Osteo-Promoter Database (OPD) is a collection of genes and promoters expressed in skeletal cells. We have compiled a new viewer, OPD, as unique database developed and created as an accessible tool for skeletal promoter sequences. OPD can navigate to identify genes specific to skeletal cDNA databases and promoter analysis sites. OPD offers exclusive access to facilitate a dynamic extraction of promoters' gene-specific analyses in skeletal tissue. The data on promoters included in OPD contains cloned promoters or predicted promoters that were analyzed by bioinformatics tools. OPD offers MAR-analysis, which allocates A/T rich elements along these promoter sequences. CONCLUSION: The analysis leads to a better insight of proteins that bind to DNA, regulate DNA, and function in chromatin remodeling. The OPD is a distinctive tool for understanding the complex function of chromatin remodeling and transcriptional regulation of specific gene expression in skeletal tissue.

Bone and Bones↗
PubMed2004

Human CD1D gene has TATA boxless dual promoters: an SP1-binding element determines the function of the proximal promoter.

CD1d presents lipid Ags to a specific population of NK T cells, which are involved in the host immune defense, suppression of autoimmunity, and the rejection of tumor cells. The transcriptional control mechanism that determines the regulation and the tissue distribution of CD1d remains largely unknown. After investigating 3.7 kb 5' upstream of the coding region, we found that human gene encoding CD1d molecule (CD1D) has TATA boxless dual promoters with multiple transcription initiation sites. The proximal promoter is located within the region of -106 to +24, and the distal promoter is located within the region of -665 to -202 with the A of the translational start codon defined as +1. The longest 5'-untranslated region derived from 5'-RACE and apparently generated by the distal promoter has 272 bp in length covering the genomic sequence of the proximal promoter. The region covering the proximal promoter gave a much higher luciferase activity in Jurkat cells than in K562 cells, whereas it was in reverse for the region covering the distal promoter, indicating a cell type sp. act. of the two promoters. Transcription factor SP1 plays a crucial role in the function of the proximal promoter. The analysis of the CD1D promoter region indicates that IFN-gamma, NF-IL-6, and T cell factor 1/lymphoid enhancer-binding factor 1 are most likely involved in the regulation of CD1d expression. The illustration of the dual CD1D gene promoters will help to reveal the regulatory factors that control CD1d expression and its tissue distribution for a better understanding of the cross-regulation between CD1d and NK T cells.

5' Flanking Region↗
PubMed1995

Retroviral-mediated gene expression in human myelomonocytic cells: a comparison of hematopoietic cell promoters to viral promoters.

Gene transfer into human hematopoietic stem cells with expression targeted to the maturing myelomonocytic progeny has applications for gene therapy of genetic diseases affecting granulocytes and macrophages. We hypothesized that promoters of myeloid-specific genes that are upregulated with myelomonocytic differentiation would also upregulate expression of an exogenous gene in a retroviral vector. Moloney murine leukemia virus (MoMuLV)-based retroviral vectors using promoters from hematopoietic genes (CD11b, CD18, and CD34) were compared with vectors with viral promoters (MoMuLV long terminal repeat [LTR], cytomegalovirus [CMV], and simian virus 40 [SV40]). Human glucocerebrosidase (GC) cDNA was the reporter gene. HL60 cells were transduced with these vectors and vector-derived GC activity was compared in undifferentiated HL-60 cells and the same cells differentiated into granulocytes using dimethyl sulfoxide or monocyte/macrophages using phorbol myristate acetate. In undifferentiated HL-60 cells, vector-derived GC activity was the highest when it was controlled by the MoMuLV LTR. In HL-60 cells differentiated into granulocytes, vector-derived GC activity transcribed from the CD11b, MoMuLV LTR, and CMV promoters was equivalent to 1.7, 1.5, and 1.5 times the normal endogenous GC activity, respectively, and 0.8, 2.0, and 3.6 times the normal GC activity, respectively, in those differentiated into macrophages. With granulocytic differentiation, the CD11b promoter showed maximal induction in GC activity (8-fold); with macrophage differentiation, the CD11b promoter showed a fourfold induction in GC expression. The CD11b promoter also generated significant levels of GC activity in the myelomonocytic progeny of transduced CD34+ cells. Expression from the CD11b promoter, unlike that from the CMV or the MoMuLV LTR promoters, was relatively myelomonocyte-specific, with minimal expression observed in Jurkat T cells or HeLa carcinoma cells. The induction of expression from the CD11b promoter with differentiation in HL-60 cells correlates with the developmental regulation of the CD11b gene. Retroviral vectors using the CD11b promoter have potential utility for gene therapy of disorders affecting the myelomonocytic lineage.

Antigens, CD34↗
PubMed2001

Promoter strength in adenovirus transducing vectors: down-regulation of the adenovirus E1A promoter in 293 cells facilitates vector construction.

Most adenovirus transducing vectors have the cytomegalovirus major immediate-early (CMV) or the Rous sarcoma virus long terminal repeat (RSV) promoter driving expression of the transgene. Both of these promoters are highly active in transfection and transduction assays in 293 cells, in which transducing vectors are constructed and grown, and in HeLa cells. The CMV promoter exhibits rapid activation while the RSV promoter exhibits a lag prior to the onset of viral DNA replication in transduction assays. While the use of very strong promoters facilitates expression of the transgene, high-level expression of certain gene products hinders virus construction and growth. For such genes, the use of the adenovirus type 5 E1A promoter offers advantages. The E1A promoter exhibits modest activity in HeLa cells after transfection or transduction, but very little activity in 293 cells, suggesting that the E1A promoter would permit construction and growth of vectors encoding deleterious gene products that could not be constructed with the CMV and RSV promoters. This idea was tested through attempts to construct viruses encoding the immunoglobulin loop 6 and transmembrane regions of the prostaglandin F2alpha receptor regulatory protein (FPRP), a product that inhibits adenovirus vector construction for reasons that are not clear. Only the E1A promoter permitted construction and growth of the transducing vector encoding the fragment of FPRP.

Adenovirus E1A Proteins↗
PubMed2001

Polymorphsims of CTLA-4 exon 1 +49, CTLA-4 promoter -318 and Fas promoter -670 in spondyloarthropathies.

The aim of the study was to investigate a possible association between the CTLA-4 exon 1 +49, CTLA-4 promoter -318 and Fas promoter -670 and spondyloarthropathies (SpA). Polymerase chain reaction of genomic DNA-restriction fragment length polymorphism was used to determine genotypes of the CTLA-4 exon 1 +49, CTLA-4 promoter -318 and Fas promoter -670 in 54 SpA patients, 84 healthy control subjects and 87 bronchial asthma patients as disease controls. There were no significant differences in the genotype and allele frequencies of the CTLA-4 exon 1, promoter and Fas promoter genes among SpA, asthma patients and controls. No significant differences were found in age at onset, sex, disease duration, history of enthesopathy, peripheral arthritis and uveitis, Schober test, chest expansion, white blood cell count, C-reactive protein and erythrocyte sedimentation rate among patients with SpA according to the CTLA-4 exon 1, CTLA-4 promoter and Fas promoter polymorphisms. We found no association between the polymorphisms of the CTLA-4 exon 1 +49, CTLA-4 promoter -318 and Fas promoter -670 genes and SpA. However, further studies are required to discover the possible contribution of the polymorphisms of the CTLA-4 and Fas to the pathogenesis of SpA.

Abatacept↗
PubMed2005

Characterization of promoter activities of four different Japanese flounder promoters in transgenic zebrafish.

An important consideration in transgenic research is the choice of promoter for regulating the expression of a foreign gene. In this study several tissue-specific and inducible promoters derived from Japanese flounder Paralichthys olivaceus were identified, and their promoter activity was examined in transgenic zebrafish. The 5' flanking regions of the Japanese flounder complement component C3, gelatinase B, keratin, and tumor necrosis factor (TNF) genes were linked to green fluorescence protein (GFP) as a reporter gene. The promoter regulatory constructs were introduced into fertilized zebrafish eggs. As a result we obtained several stable transgenic zebrafish that displayed green fluorescence in different tissues. Complement component C3 promoter regulated GFP expression in liver, and gelatinase B promoter regulated it in the pectoral fin and gills. Keratin promoter regulated GFP expression in skin and liver. TNF gene promoter regulated GFP expression in the pharynx and heart. TNF promoter had lipoplysaccharide-inducible activity, such that when transgenic embryos were immersed lipopolysaccharide, GFP expression increased in the epithelial tissues. These 4 promoters regulated the expression of GFP in different patterns in transgenic zebrafish.

Animals↗
PubMed1987

A set of positively regulated flagellar gene promoters in Caulobacter crescentus with sequence homology to the nif gene promoters of Klebsiella pneumoniae.

The study reported here describes nuclease S1 mapping of the in-vivo transcription start sites of transcription units I and III of the hook gene cluster of Caulobacter crescentus. We show that transcription units I and II of this flagellar (fla) gene cluster, which have divergent promoters with transcription start sites separated by 218 nucleotides, are under positive transcriptional control by genes in transcription unit III. The promoters of transcription units I, II, and III were compared with flagellin gene promoters P25, P27 and P29 recently identified in C. crescentus. Promoters PII, P25, and P27, which are under positive regulation by transcription units III to V have strongly conserved sequence elements at -13 and -24 with the consensus sequence (C/T)TGGC(C/G)C-N5-TTGC. The -13, -24 sequence elements are not well conserved in promoter PI, but the promoter does contain a copy of the -13 and -24 consensus sequence 23 base-pairs upstream (PI). The C. crescentus fla gene promoters are not homologous to the canonical Escherichia coli -10, -35 promoter sequence, but they are very similar to the -12, -24 nif gene promoter sequence reported for Klebsiella pneumoniae and Rhizobium sp. The four positively regulated fla gene promoters examined here also share a third conserved element designated II-1, with the consensus sequence C-C-CGGC--AAA--GC-G, located at approximately -100. We speculate that the conserved sequence elements mapping at -13, -24 and -100 are cis-acting regulatory elements required for the transcription and periodic regulation of these fla genes in the C. crescentus cell cycle.

Base Sequence↗