Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Photobacterium”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 109 records · Page 6Linked to original sources
PubMed1991

Investigations of phagocytosis concerning the immunological defence mechanism of Mytilus edulis using a sublethal luminescent bacterial assay (Photobacterium phosphoreum).

1. A simple method for the determination of phagocytosis activity using mussel hemocytes by measuring the bioluminescence is presented. 2. The immunological defence activity based on phagocytosis is measured and quantified by a luminescent bacterial assay with Photobacterium phosphoreum. 3. The measuring system allows us to establish the stress of the immunological defence mechanism of organisms exposed to chemicals and polluted rivers or sewage. Results with reference substances and the phagocytosis indices of exposed mussels from Norwegian aquaculture plants compared to those of mussels from the German Wadden Sea are given as examples.

Animals↗
PubMed2005

Characteristic analysis of the ampC gene encoding beta-lactamase from Photobacterium phosphoreum.

The ampC gene of Photobacterium phosphoreum ATCC 11040 was cloned and identified. Nucleotide sequence of the regulatory region R&R and the ampC gene (GenBank Accession No. AY787792) from P. phosphoreum has been determined, and the encoded beta-lactamase is deduced. The beta-lactamase encoded by the ampC gene has a calculated M(r) 31,198 and comprises 285 amino acid residues (pI 7.35). There is a signal peptide of 20 amino acid residues MKLRFIASTLLLSFSQLASA to lead the beta-lactamase secretion, and the cleavage site is between ASA-Q; thus, the matured protein only has M(r) 29,019 and comprises 265 amino acid residues (pI 6.21). The specific amino acid residues STFK (65th to 68th), SDN (125th to 127th), and D (158th) located 33 residues downstream from the SDN loop of the class A beta-lactamases are highly conserved, but the KTG is not found. The gene order of the ampC is <--ufo-R&R-ampC-->, the genes running in the opposite directions. Functional analysis elicits that R&R([ampC]) does function to lead to the gene expression. Primer extension assay elicits that the ampC gene's transcriptional initiation +1 is -26 C upstream of the start codon; the P([I])-promoter should be the promoter response for the gene expression. Analysis of the R&R([ampC]) elicits that the upstream activator binding sequence Sigma UAS TGTTTAAATACGCTTTGAACA is like the two-component regulator binding sequence TGT-N(8-12)-ACA. It implies that P. phosphoreum ampC gene could be under-regulated by the specific two-component regulator.

Amino Acid Sequence↗
PubMed2004

Collaborative effects of Photobacterium CuZn superoxide dismutase (SODs) and human AP endonuclease in DNA repair and SOD-deficient Escherichia coli under oxidative stress.

The defenses against free radical damage include specialized repair enzymes that correct oxidative damage in DNA and detoxification systems such as superoxide dismutases (SODs). These defenses may be coordinated genetically as global responses. We hypothesized that the expression of SOD and DNA repair genes would inhibit DNA damage under oxidative stress. Therefore, protection of Escherichia coli mutants deficient in SOD and DNA repair genes (sod-, xth-, and nfo-) was demonstrated by transforming the mutant strain with a plasmid pYK9 that encoded Photobacterium leiognathi CuZnSOD and human AP endonuclease. The results show that survival rates were increased in sod+ xth- nfo+ cells compared with sod- xth- ape-, sod- xth- ape-, and sod+ xth- ape- cells under oxidative stress generated with 0.1 mM paraquat or 3 mM H2O2. The data suggest that, at the least, SOD and DNA repair enzymes may collaborate on protection and repair of damaged DNA. Additionally, both enzymes are required for protection against free radicals.

DNA Repair↗
PubMed2004

Activation of the nitric oxide response in gilthead seabream after experimental infection with Photobacterium damselae subsp. piscicida.

Inoculation of small gilthead seabream (Sparus aurata) (30-75 g body weight) with a sublethal dose of different Photobacterium damselae subsp. piscicida (Pdp) strains (DI-21 and 94/99) induced an increase in serum concentrations of stable nitric oxide (NO) metabolites lasting from 6 h to six days post-infection, with a peak at 24 h. In contrast, no such response was detected in larger fish (150-600 g). Since the virulence of Pdp correlates with the presence of a polysaccharide capsular layer which can be induced by growing the bacteria in medium supplemented with 1% glucose (C+ forms), the effect of the presence of an enhanced capsular layer on the NO response in small fish was also evaluated. Although, all bacteria induced a similar rapid (6 h) and sustained (up to six days) NO response, serum concentrations of nitrites and citrulline were significantly increased in fish infected with the Pdp strains grown in glucose-supplemented medium. When the NO response of fish infected with the C+ form of Pdp was blocked by prior injection of the inhibitor L-NAME, the LD(50) was reduced by over 10-fold and the mean time to death was also markedly reduced. Considering that (i) pasteurellosis only affects gilthead seabream with body weights below 100 g; (ii) capsulated Pdp are more resistant to the bactericidal action of NO and peroxynitrites than non-capsulated strains; and (iii) blocking the NO response of the fish results in greater susceptibility to Pdp, it seems reasonable to propose that the sustained NO response reported in this study represents a relevant protective mechanism of juvenile gilthead seabream against pasteurellosis.

Analysis of Variance↗
PubMed2005

Influence of vaccination on the nitric oxide response of gilthead seabream following infection with Photobacterium damselae subsp. piscicida.

The nitric oxide (NO) response of vaccinated and non-vaccinated juvenile gilthead seabream was studied in vivo and the NO response of isolated kidney macrophages of fish was studied in vitro. Fish were vaccinated with formalin-killed Photobacterium damselae subsp. piscicida (Pdp) with or without Freund's incomplete adjuvant (FIA) and control fish received phosphate buffered saline (PBS). Thirty days later, fish were injected with a sublethal dose of Pdp and 3 fish/group were bled at time periods thereafter and serum nitrite and citrulline levels were determined as a measure of the NO response. All infected groups showed an increase in NO metabolites from 6h to 27 days, with peak levels at 24 h. However, the response in bacterin-vaccinated fish was significantly higher than in the non-vaccinated group and the bacterin plus FIA resulted in a further significant enhancement. Similarly enhanced NO responses were produced in vitro by isolated macrophages obtained from vaccinated compared with non-vaccinated fish 30 days after vaccination following infection, with the response in macrophages from fish vaccinated with the bacterin plus FIA being significantly higher than those from fish vaccinated with the bacterin alone. Thus, vaccination resulted in an enhanced NO response to infection with Pdp in vivo and in vitro. Furthermore, the level of protection of fish to experimental challenge with virulent Pdp correlated with the level of the NO responses in the different groups.

Analysis of Variance↗
PubMed2005

The effect of sea bream (Sparus aurata) broodstock and larval vaccination on the susceptibility by Photobacterium damsela subsp. piscicida and on the humoral immune parameters.

Sea bream broodstock were immunised 1 or 2 months before spawning with a novel photobacteriosis vaccine. Sixty-seven-day-old larvae (mean weight 22.3 mg) originating from immunised and non-immunised parents were experimentally infected with the Photobacterium damsela subsp. piscicida (Phdp). Larvae from immunised fish showed delayed onset and lower mortality (66.67%) compared with larvae from control fish (80%). Eighty-nine-day-old larvae (mean weight 162.2 mg) from both groups were bath vaccinated with Phdp and Escherichia coli lipopolysaccharides (LPS) and larval samples were collected for measurement of humoral parameters. Larvae vaccinated with Phdp and LPS showed significantly higher anti-protease activity, lysozyme activity and total immunoglobulin compared to the controls. One-hundred-and-twenty-day-old larvae (mean weight 297.85 mg) from both parental groups were challenged with (LD70) virulent Phdp bacterial cells. Vaccinated larvae from both groups showed significantly less mortality compared to the respective controls. The RPS values of larvae from immunised parents vaccinated with Phdp and LPS was 95.83% and 72.22%, respectively. The RPS values of larvae from non-immunised parents vaccinated with Phdp and LPS was 62.5% and 70.83%, respectively. Results are discussed with respect to the beneficial effect of broodstock immunisation prior to spawning and the immunisation of larvae on their survival against photobacteriosis.

Analysis of Variance↗
PubMed2005

Effect of salinity on the immune response of tiger shrimp Penaeus monodon and its susceptibility to Photobacterium damselae subsp. damselae.

Addition of NaCl at 2.5% to tryptic soy broth (TSB) significantly increased the growth of Photobacterium damselae subsp. damselae. Tiger shrimp Penaeus monodon held in 25 per thousand seawater were injected with P. damsela subsp. damselae grown in TSB containing NaCl at 0.5%, 1.5%, 2.5% and 3.5% at a dose of 8.48 x 10(4)colony-forming units (cfu)shrimp(-1). Over 24-96 h, the cumulative mortality was significantly higher for the shrimp challenged with P. damselae subsp. damselae grown in 2.5% NaCl than those grown in 0.5%, 1.5% and 3.5% NaCl. In another experiment, P. monodon held in 25 per thousand were injected with TSB-grown P. damselae subsp. damselae (8.48 x 10(4)cfushrimp(-1)), and then transferred to 5 per thousand, 15 per thousand, 25 per thousand (control) and 35 per thousand. After 96 h, the mortality was highest for the P. damselae subsp. damselae-injected shrimp held in 5 per thousand, and the lowest for the P. damselae subsp. damselae-injected shrimp held in 25 per thousand. In a separate experiment, P. monodon held in 25 per thousand and then transferred to 5 per thousand, 15 per thousand, 25 per thousand (control) and 35 per thousand were examined for immune parameters, and phagocytic activity and clearance efficiency of P. damselae subsp. damselae after 12-96 h. The THC, hyaline cell, phenoloxidase activity, respiratory burst, superoxide dismutase (SOD) activity, phagocytic activity and clearance efficiency decreased significantly for the shrimp held in 5 per thousand, 15 per thousand and 35 per thousand after 12h. It is concluded that tiger shrimp P. monodon transferred from 25 per thousand to low salinity levels (5 per thousand and 15 per thousand) and high salinity (35 per thousand) had reduced immune ability and decreased resistance against P. damselae subsp. damselae infection.

Animals↗
PubMed2005

Complement consumption by Photobacterium damselae subsp. piscicida in seabream, red porgy and seabass normal and immune serum. Effect of the capsule on the bactericidal effect.

A virulent strain of Photobacterium damselae subsp. piscicida (Pdp) was grown without (C form) or with (C+ form) glucose supplementation, the latter to enhance capsule formation. Both forms were resistant to killing by normal serum of seabream, red porgy and seabass. However, the C form was killed by immune serum of all three fish species while the C+ form was killed only by seabream and red porgy sera and to a lesser extent than the C form. Both C and C+ forms consumed complement in normal serum and this consumption was enhanced by precoating the bacteria in specific fish antibody. Complement consumption was greatest in seabass serum, especially with antibody-coated C+ form yet in this case the bacteria were not killed. The killing of the C form in immune serum of all three fish species was completely inhibited by EGTA/Mg(2+), indicating that the mechanism of complement activation leading to killing of the bacteria was by the classical pathway. The results suggest that immune serum killing by the classical complement pathway may provide some degree of protection against pasteurellosis, but enhanced expression of the capsule by Pdp in vivo may restrict complement-mediated killing, especially in immunised seabass.

Animals↗
PubMed2004

Photobacterium phosphoreum caused a histamine fish poisoning incident.

An incident of histamine fish poisoning (HFP) occurred due to the consumption of iwashi maruboshi (dried sardine) in Osaka, Japan in March 2002. A histamine-producing bacterial strain, YS4-7, was isolated from iwashi maruboshi that contained 1700 mg of histamine per kilogram. This strain was identified as Photobacterium phosphoreum by biochemical examinations and partial sequencing of 16S rDNA. P. phosphoreum YS4-7 showed greater capability as a histamine producer at 4 and 12 degrees C than Morganella morganii JCM 1672. Strain YS4-7 produced 546 mg of histamine per kilogram in a sardine homogenate stored for 12 h at 20 degrees C. M. morganii, Raoultella planticola and Hafnia alvei have been isolated from fish implicated in HFP incidents, whereas this is the first report of P. phosphoreum being the causative bacterium in a sporadic case of histamine food poisoning.

Animals↗
PubMed2006

Screening and estimating of toxicity formation with photobacterium bioassay during chlorine disinfection of wastewater.

Reclamation and reuse of wastewater is one of the most effective ways to alleviate water shortage. Disinfection plays a key role in killing the harmful pathogens in reclaimed water, while an unwanted side effect is the formation of disinfection by-products (DBPs). Recently, a number of researches have been conducted on the formation regularities of certain DBPs. However, with current physiochemical techniques, it is impossible to detect all the DBPs. In this study, photobacterium bioassay was used to measure the formation of DBPs and their toxic effect as a whole. The effects of water quality characteristics and operational conditions on the toxicity formation during wastewater chlorination disinfection process were evaluated. A statistical model, depending on chlorine disinfectant dosage, concentration of ammonia nitrogen, and concentration of dissolved organic carbon, was developed to quantitatively estimate the toxicity formation during the disinfection process. It was found that the toxicity of the wastewater samples was positively correlated with chlorine disinfectant dosage, concentration of dissolved organic carbon and UV absorbance at 254nm, while negatively correlated with concentration of ammonia nitrogen.

Biological Assay↗
PubMed1977

A calorimetric investigation of the growth of the luminescent bacteria Beneckea harveyi and Photobacterium leiognathi.

Direct calorimetric determinations of the rate of heat production along with simultaneous determinations of the rate of photon emission and the number of viable cells have provided insight into the growth of Beneckea harveyi and Photobacterium leiognathi. These experiments were performed with a Tronac isothermal microcalorimeter modified with a fiber optic light guide to allow in situ detection of light. Escherichia coli and a dark variant of P. leiognathi were also examined to provide points of reference. It is demonstrated that B. harveyi seems to pause in the rate of metabolic heat production at the same point in time that the enzyme luciferase begins to be synthesized. This effect is not removed if B. harveyi is grown in conditioned medium. The thermograms for all species are correlated with cell generation time. The heat production per cell indicates that uncrowded cultures produce more heat than older, more crowded cultures, supporting the original observation of Bayne-Jones and Rhees (1929). These observations reopen for examination the suggestion that living systems tend toward a state of minimum metabolism per unit mass.

Calorimetry↗
PubMed1997

Cloning, sequencing and overexpression of the gene encoding malate dehydrogenase from the deep-sea bacterium Photobacterium species strain SS9.

The gene encoding malate dehydrogenase (mdhA) was obtained from the psychrophilic, barophilic, deep-sea isolate Photobacterium species strain SS9. The SS9 mdhA gene directed high levels of malate dehydrogenase (MDH) production in Escherichia coli. A comparison of SS9 MDH to three mesophile MDHs, a MDH sequence obtained from another deep-sea bacterium, and to other psychrophile proteins is presented.

Amino Acid Sequence↗
PubMed2000

Molecular fingerprinting of strains of Yersinia ruckeri serovar O1 and Photobacterium damsela subsp. piscicida isolated in Italy.

We studied the ribotypes, patterns of pulsed-field gel electrophoresis (PFGE) and interspersed repeated sequences (IRS)-PCR of 30 strains of Yersinia ruckeri O1 and 20 strains of Photobacterium damsela subsp. piscicida isolated from apparently unrelated epizootic outbreaks occurring on Italian fish farms between 1993 and 1999. All of the Y. ruckeri O1 strains had similar profiles, as demonstrated by all three typing methods, thus confirming the clonal structure of this species. The strains of P. damsela subsp. piscicida showed similar profiles when tested with ribotyping and PFGE; however, two slightly different profiles were distinguished by IRS-PCR using the primer ERIC2. The two profiles appeared to be related to the geographic origin of the strains, since each of them was specific to isolates from a certain area (i.e. northern or southern Italy). This result suggests that PCR fingerprinting may be a valuable tool in typing fish bacterial pathogens, which often present a great degree of genetic homogeneity.

Animals↗
PubMed2003

Apoptosis of sea bass (Dicentrarchus labrax L.) neutrophils and macrophages induced by experimental infection with Photobacterium damselae subsp. piscicida.

The infection of sea bass (Dicentrarchus labrax L.) by intraperitoneal (i.p.) injection of the agent of fish pasteurellosis Photobacterium damselae subsp. piscicida resulted in the apoptosis of peritoneal neutrophils and macrophages. All the eight virulent and none of the two non-virulent strains tested exhibited apoptogenic activity. A secreted bacterial protein(s) is a likely candidate as the factor(s) responsible for this activity, since no apoptosis was induced by i.p. injected UV-killed virulent strains and the virulent culture supernatants exhibited a thermo-labile apoptogenic activity identical to that of live bacteria. The apoptotic process was characterized by the occurrence of DNA fragmentation detected by terminal deoxynucleotidyltransferase-mediated dUTP nick end labeling (TUNEL) staining and DNA electrophoresis, and of typical ultrastructural alterations namely cell shrinkage, chromatin condensation, nuclear fragmentation and production of blebs with shedding of apoptotic bodies. In the apoptotic process induced by lethal doses of virulent bacteria or culture supernatants both peritoneal macrophages and neutrophils were extensively affected, the majority of these cells being apoptotic and reaching values around 10(7)per peritoneal cavity for each cell type at 24h post-injection. Moreover, the number of non-apoptotic macrophages was always below the initial number in the resting peritoneal cavity. Since macrophages are key cells in the elimination of both bacteria and apoptotic moribund cells and apoptotic bodies, the induction by Ph. damselae subsp. piscicida of simultaneous macrophage and neutrophil apoptosis results, on the one hand, in the destruction of the two phagocytic cell types involved in the restriction of multiplication of the bacteria and, on the other hand, in the uncontrolled progression of the apoptotic process towards secondary necrosis and eventual lysis of high numbers of moribund neutrophils and of neutrophilic apoptotic bodies, with the consequent extensive release of their highly cytotoxic components. Abundant apoptotic cells were also seen in sections of head-kidney from fish dying from experimental pasteurellosis. In contrast, no apoptosis was seen in vitro after the treatment with virulent culture supernatants of sea bass head-kidney macrophage cultures or after the treatment ex vivo of peritoneal exudate leukocytes with virulent bacteria or culture supernatants. The apoptotic process described here appears as a novel and very powerful microbial pathogenic strategy.

Animals↗
PubMed2003

Toxicity of nitric oxide and peroxynitrite to Photobacterium damselae subsp. piscicida.

Virulent strains of Photobacterium damselae subsp. piscicida (Pdp) were grown in media with or without glucose supplementation (to enhance polysaccharide capsule formation) and the bactericidal action of nitric oxide (NO) and peroxynitrites was evaluated in a cell-free assay. Treatment with the NO-donor S-nitroso-acetyl-penicillamine (SNAP) induced a dose-and time-dependent decrease in Pdp survival. This effect was greater for strains grown without glucose supplementation (C forms) than for their counterparts grown with glucose supplementation (C(+) forms). Addition of superoxide anion (O2(-)) generating systems (Xanthine/Xanthine oxidase, glucose/glucose oxidase) to the culture media further enhanced the bactericidal effect of NO. A similar bactericidal effect, with the same pattern of sensitivity, was observed when C+ and C forms of the bacteria were treated with 3-morpholino-sydonimide hydrochloride (SIN-1), a compound which simultaneously generates NO and O2(-). Addition of superoxide dismutase (SOD) or SOD plus catalase (CAT) did not fully reverse the toxic action of SIN-1 and the bactericidal effect was similar for both C and C(+) forms suggesting that while NO alone is sufficient to cause damage in all strains of the pathogen tested, growth in glucose supplemented medium enhanced protection to reactive oxygen intermediates rather than NO.

Analysis of Variance↗
PubMed2004

The effect of growth medium salinity of Photobacterium damselae subsp. piscicida on the immune response of hybrid bass (Morone saxatilis x M. chrysops).

Photobacterium damselae subsp. piscicida (P. damselae) was grown on various media and the effect of media salinity on certain immune responses of hybrid bass was studied. In Israel, pasteurellosis outbreaks have not been reported at water salinities below 1.38 per thousand. During vaccination experiments the salinity of the medium on which P. damselae is grown, was shown to affect stimulation of the immune system. No correlation was found between antibody response and protection. Bacterial envelopes separated by electrophoresis and subjected to western blot analysis revealed an antibody response against some protein bands. Band sequencing was performed to identify the protein stimulating the immune response. Sequence identity of 80% was seen in 10-amino-acid overlap of the 36-kDa band with a specific gene of alkalophilic Bacillus firmus. A preparation of P. damselae grown in a 2.5% NaCl medium at 25 degrees C is the most effective vaccine against pasteurellosis, providing hybrid bass with quite good protection.

Amino Acid Sequence↗
PubMed2000

Existence of two geographically-linked clonal lineages in the bacterial fish pathogen Photobacterium damselae subsp. piscicida evidenced by random amplified polymorphic DNA analysis.

In this work, we applied the random amplified polymorphic DNA (RAPD) technique to evaluate the genetic diversity in Photobacterium damselae subsp. piscicida (formerly Pasteurella piscicida), an important pathogen for different marine fish. Regardless of the oligonucleotide primer employed, the 29 isolates of Ph. damselae subsp. piscicida tested were separated into two groups, the RAPD-PCR analysis differentiated the European strains from the Japanese strains. The similarity between both groups estimated on the basis of the Dice coefficient was 75-80%. These results show that European and Japanese isolates of Ph. damselae subsp. piscicida, regardless of their host fish species, belong to two different clonal lineages. Our findings also indicate that RAPD profiling constitutes a useful tool for epidemiological studies of this fish pathogen.

Animals↗
PubMed1995

Properties of recombinant fluorescent proteins from Photobacterium leiognathi and their interaction with luciferase intermediates.

Ligand binding and luciferase interaction properties of the recombinant protein corresponding to the lumazine protein gene (EMBL X56534) of Photobacterium leiognathi have been determined by fluorescence dynamics, circular dichroism, gel filtration, and SDS-PAGE. Scatchard analysis of a fluorescence titration shows that the apoprotein possess one binding site, and at 30 degrees C the KdS (microM) are as follows: 6,7-dimethyl-8-ribityllumazine, 0.26; riboflavin, 0.53; and much more weakly bound FMN, 30. All holoproteins are highly fluorescent and have absorption spectra distinct from each other and from the free ligands. The longest wavelength absorption maxima are, respectively (nm, 2 degrees C), 420, 463, and 458. Ligand binding produces no change in the far-UV circular dichroism; all have mean residual ellipticity at 210 nm of -6500 deg cm2 dmol-1, the same as the native protein. However, in the bioluminescence reaction only the lumazine holoprotein shows a bioluminescence effect. Fluorescence emission anisotropy decay was used to establish that none of these holoproteins complexed with native luciferase and that the lumazine protein alone formed a 1:1 complex with the luciferase hydroxyflavin fluorescent transient and the luciferase peroxyflavin intermediates, revealed by a dominant channel of anisotropy loss, with rotational correlation time of 2.5 ns, and attributed to excitation transfer from the luciferase flavin donor to the acceptor, the lumazine ligand. The complex stability was sufficient to allow its isolation by FPLC gel filtration and verification by SDS-PAGE. These methods also confirmed the absence of interaction of the holoflavoproteins.

Bacterial Proteins↗