Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “oligonucleotide composition”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,063 records · Page 59Linked to original sources
PubMed1996

The amino acid sequence of rat kidney 5-oxo-L-prolinase determined by cDNA cloning.

5-Oxoprolinase (EC 3.5.2) catalyzes a reaction in which the endergonic cleavage of 5-oxo-L-proline to form L-glutamate is coupled to the exergonic hydrolysis of ATP to ADP and inorganic phosphate. Highly purified preparations of the enzyme have been obtained from rat kidney and Pseudomonas putida. The rat kidney enzyme is composed of two strongly interacting, apparently identical subunits (Mr = 142,000), whereas that from P. putida is composed of two functionally different protein components that can readily be dissociated. Here we report the cloning of rat kidney 5-oxoprolinase with preliminary expression studies. cDNA clones encoding the enzyme were isolated by screening a lambdagt11 cDNA library beginning with a degenerate oligonucleotide probe based on peptide sequence data obtained from the purified enzyme. The whole cDNA clone was completed by amplifying its 5' end from a premade library of rat kidney Marathon-ReadyTM cDNAs using polymerase chain reaction methodology. The composite cDNA (4,016 bases) revealed an uninterrupted open reading frame encoding 1,288 amino acid residues (Mr = 137,759). The deduced amino acid sequence contains all four of the peptide sequences that were independently found in peptide fragments derived from the enzyme. Expression of the full-length clone in Escherichia coli yielded a product of the same size as the rat kidney enzyme and which reacted with antibodies directed against the rat kidney enzyme. The predicted amino acid sequence is almost 50% identical throughout its entire length to that of a hypothetical yeast protein YKL215C. It is also 26% identical in half its length to the bacterial hydantoinase HyuA and 26% identical in the other half to the bacterial hydantoinase HyuB. The results suggest unexpected evolutionary relationships among the hydantoinases and rat kidney 5-oxoprolinase which share the common property of hydrolyzing the imide bond of 5-membered rings but which do not all require ATP.

Amino Acid Sequence↗
PubMed1988

alpha-DNA. VII. Solid phase synthesis of alpha-anomeric oligodeoxyribonucleotides.

An efficient procedure for the synthesis of unnatural alpha-anomeric oligodeoxyribonucleotides is described. This solid-phase procedure is based on the use of alpha-nucleoside phosphoramidites and alpha-nucleoside derivatized solid supports corresponding to the four natural bases and allow rapid synthesis of oligonucleotides up to 20 alpha-deoxynucleotide units in length. After HPLC purification, a 15-mer: alpha-d(CCTCTCGTTCTTTAC) and a 20-mer: alpha-d(ATACTTGAGGAAGAGGTGTT) were obtained respectively in 27 and 29% overall yields. Their purity, nucleoside composition and primary structure were ascertained by HPLC and Maxam-Gilbert sequence analyses.

Base Sequence↗
PubMed1990

Epithelial-specific keratin gene expression: identification of a 300 base-pair controlling segment.

To elucidate the elements required for regulation of keratin expression in epidermis, we have linked a short, 300 base pair segment, corresponding to the promoter region of a human K#14 gene, to the chloramphenicol-acetyl-transferase gene. This construct was introduced into various mammalian cell lines and primary cultures via Ca3(PO4)2 precipitation. The 300 base pair segment from the keratin gene promoter region was active in all epithelial cells studied including transformed, simple epithelial cells such as HeLa and ME-180, cell lines derived from stratified epithelium, such as SCC-12, as well as primary cultures of epithelial cells. The construct was inactive in all non-epithelial cells tested including fibroblasts and melanocytes. The segment does not function as a silencer in nonepithelial cells but it can function as an enhancer in epithelial cells. Using the polymerase chain reaction we have constructed a series of deletions of the promoter and have localized an essential function within a 40 bp sequence. We conclude that we have identified the keratin gene promoter that is sufficient to confer epithelial-specific expression.

Animals↗
PubMed1991

Structural and kinetic aspects of chemical reactions in DNA duplexes. Information on DNA local structure obtained from chemical ligation data.

Chemical ligation of oligonucleotides in double-stranded helices has been considered in its structural-kinetic aspect. A study was made of (i) two series of DNA duplexes with various arrangements of reacting groups in the ligation junction induced by mispairing or by alteration of furanose structure (the replacement of dT unit with rU, aU, IU, xU, dxT ones) and of (ii) eight synthetic water-soluble carbodiimides with different substituents at N1 and N3 atoms. We assumed that some information on the local structure of modified sites in the duplex can be obtained from kinetic parameters of oligonucleotide coupling reaction. The ratio of kinetic constants k3/(k2 + k3) for productive and nonproductive decomposition of the activated phosphomonoester derivative apparently reflects the reaction site structure: for a given duplex this parameter is virtually independent of the condensing agent composition. Based on the analysis of the chemical ligation kinetics a suggestion has been made about the conformation of some modified units in the double helix.

Autoradiography↗
PubMed1994

Crystal structure of the highly distorted chimeric decamer r(C)d(CGGCGCCG)r(G).spermine complex--spermine binding to phosphate only and minor groove tertiary base-pairing.

The crystal structure of the self-complementary chimeric decamer duplex r(C)d(CGGCGCCG)r(G), with RNA base pairs at both termini, has been solved at 1.9 A resolution by the molecular replacement method and refined to an R value of 0.145 for 2,314 reflections. The C3'-endo sugar puckers of the terminal riboses apparently drive the entire chimeric duplex into an A-DNA conformation, in contrast to the B-DNA conformation adopted by the all-deoxy decamer of the same sequence. Five symmetry related duplexes encapsulate a spermine molecule which interacts with ten phosphate groups, both directly and through water molecules to form multiple ionic and hydrogen bonding interactions. The spermine interaction severely bends the duplexes by 31 degrees into the major groove at the fourth base pair G(4).C(17), jolts it and slides the 'base plate' into the minor groove. This base pair, together with the adjacent base pair in the top half and the corresponding pseudo two-fold related base pairs in the bottom half, form four minor groove base-paired multiples with the terminal base pairs of two neighboring duplexes.

Base Composition↗
PubMed2005

Adherent biofilms in bacterial vaginosis.

OBJECTIVE: Bacterial vaginosis is a common infectious disorder. Although known since ancient times, little progress has occurred in identifying causal factors. Our aims were to study the bacterial community structure and the spatial organization of microbiota on the epithelial surfaces of vaginal biopsy specimens. METHODS: We investigated the composition and spatial organization of bacteria associated with the vaginal epithelium in biopsy specimens from 20 patients with bacterial vaginosis and 40 normal premenopausal and postmenopausal controls using a broad range of fluorescent bacterial group-specific rRNA-targeted oligonucleotide probes. RESULTS: Bacterial vaginosis was associated with greater occurrence and higher concentrations of a variety of bacterial groups. However, only Gardnerella vaginalis developed a characteristic adherent biofilm that was specific for bacterial vaginosis. CONCLUSION: A biofilm comprised of confluent G vaginalis with other bacterial groups incorporated in the adherent layer is a prominent feature of bacterial vaginosis. LEVEL OF EVIDENCE: II-2.

Adolescent↗
PubMed1982

Avian nephroblastoma virus MAV-2(N) and avian osteopetrosis virus MAV-2(O) are genetically distinct.

Avian myeloblastosis virus consists of a mixture of a defective leukaemia virus and several non-defective associated avian leukosis viruses. The genomes of two of the associated avian leukosis viruses were examined in this study and were chosen because one of them, MAV-2(N), induces predominantly nephroblastoma, while the other, MAV-2(O), induces predominantly osteopetrosis. Competitive hybridization studies employing labelled virion RNA and DNA from normal and malignant tissue failed to demonstrate a difference the genomes. However, examination of ribonuclease T1-resistant oligonucleotide maps revealed that MAV-2(N) RNA had five oligonucleotide fragments which were not present in the MAV-2(O) genome. Poly(A) selection of the oligonucleotides at the 3' end of the genome showed that the fragments unique to MAV-2(N) were not present at this end of the genome. These results suggest that two viruses differing in oncogenic manifestation also differ in genome composition.

Avian Leukosis Virus↗
PubMed2002

Malaria research. Parasite genome sequenced, scrutinized.

This week, an almost complete DNA sequence of Plasmodium falciparum--one of the parasites that causes malaria--appears in Nature, and on page 129 of this issue of Science, other researchers report the DNA sequence of Anopheles gambiae, one of the mosquitoes that transmits P. falciparum to humans. Together with the human genome sequence, researchers now have in hand the genetic blueprints for the parasite, its vector, and its victim.

Animals↗
PubMed1989

Insertion elements and deletion formation in a halophilic archaebacterium.

Deletion events that occur spontaneously in 36-kilobase-pair (kbp) plasmid pHH4 from the archaebacterium Halobacterium halobium were investigated. Four different deletion derivatives with sizes ranging from 5.7 to 17 kbp were isolated. Three of these deletion variants derived from pHH4 (pHH6 [17 kbp], pHH7 [16 kbp], and pHH8 [6.3 kbp]), whereas the 5.7-kbp plasmid pHH9 derived from pHH6. Strains containing pHH6, pHH7, or pHH9 each lacked the parental plasmid pHH4, while pHH8 occurred at a 1:1 ratio together with pHH4. Common to all of these plasmids was the 5.7-kbp region of pHH9 DNA. The regions containing the fusion site in the deletion derivatives were investigated and compared with the corresponding area of the parental plasmid. Each deletion occurred exactly at the terminus of an insertion element. In pHH6 and pHH7, a halobacterial insertion element (ISH2) was located at the deletion site. The DNA fused to ISH2 displayed a 7-base-pair (bp) (pHH7) or 10-bp (pHH6) sequence homology to the inverted repeat of ISH2. In the two smaller plasmids, pHH8 and pHH9, an ISH27 element was located at the deletion site. Most likely, all of these smaller plasmids resulted from an intramolecular transposition event. The ISH27 insertion sequence contains a 16-bp terminal inverted repeat and duplicates 5 bp of target DNA during the transposition with the specificity 5'ANNNT3'. Four ISH27 copies were analyzed, and two ISH27 element types were identified that have approximately 85% sequence similarity. The ISH27 insertion elements constitute a family which is related to the ISH51 family characterized for H. volcanii, another halophilic archaebacterium.

Base Composition↗
PubMed2001

M13 cloning of mung bean nuclease digested PCR fragments as a means of gap closure within A/T-rich, genome sequencing projects.

Obtaining the complete DNA sequence of a genome is often not straightforward. After standard shotgun sequencing strategies have been employed there are often gaps remaining and these can be the most intractable regions, frequently containing repeat sequences, "uncloneable" sequences and/or regions of potential secondary structure or differential base composition. In genomes with a high A/T content, such as Plasmodium falciparum and Dictyostelium discoideum, solving these gaps is a particularly difficult problem as the sequences concerned are "fragile" and easily denatured, commonly uncloneable and have a paucity of good oligonucleotide priming sites. Reported here is a simple, yet reliable method for determining the sequence of A/T-rich gap-spanning PCR products. This method relies on the slippage of the specificity of mung bean nuclease so that it digests A/T-rich double-stranded DNA into a set of deletion fragments that can then be cloned into M13, sequenced and the original sequence assembled therefrom.

AT Rich Sequence↗
PubMed1990

A novel sequence-specific DNA binding protein which interacts with three regularly spaced direct repeats of the CCCTC-motif in the 5'-flanking sequence of the chicken c-myc gene.

The chicken c-myc 5'-flanking sequence has previously been shown to bind multiple proteins present in undifferentiated and differentiated red blood cells. In this report the protein binding to one specific region within a hypersensitive site approximately 200 base pairs upstream of the start of transcription has been analysed in detail. Using a combination of a modified agarose gel retardation assay with O-phenanthroline-copper footprinting in situ, missing contact point and methylation interference techniques, two proteins were found to bind to overlapping sequences within 180-230 bp upstream of the start of transcription. One protein resembles the transcription factor Sp1, the other is a protein which binds to three regularly spaced repeats of the core sequence CCCTC. This CCCTC-binding factor was termed CTCF. It requires additional sequences outside the three recognition motifs for tight binding. CTCF was purified to near homogeneity by sequence-specific DNA chromatography. The approximate molecular weight of the CTCF was estimated to be 130,000. Removal of 110 bp sequence binding both CTCF and Sp1-like proteins leads to a 4 to 8-fold increase in transcription of stably transfected c-myc fusion constructs in chicken embryonic fibroblasts, suggesting that the CTCF is likely to be one of multiple nuclear factors involved in the transcriptional regulation of the chicken c-myc gene.

Animals↗
PubMed1994

Comparison of antiparallel A.AT and T.AT triplets within an alternate strand DNA triple helix.

We have examined the formation of alternate strand triple-helices at the target sequence A11(TC)6.(GA)6T11 using the oligonucleotides T11(AG)6 and T11(TG)6, by DNase I footprinting. These third strands were designed so as to form parallel T.AT triplets together with antiparallel G.GC and A.AT or T.AT triplets. We find that, although both oligonucleotides yield clear footprints at similar concentrations (0.3 microM) in the presence of manganese, only T11(TG)6 forms a stable complex in magnesium-containing buffers, albeit at a higher concentration (10-30 microM). Examination of the interaction of (AG)6 and (TG)6 with half the target site confirmed that the complex containing A.AT triplets was only stable in the presence of manganese. In contrast no binding of (TG)6 was detected in the presence of either metal ion, suggesting that the reverse-Hoogsteen T.AT triplet is less stable that G.GC. We suggest that, within the context of G.GC triplets, the rank order of antiparallel triplet stability is A.AT (Mn2+) > T.AT (Mn2+) > T.AT (Mg2+) > A.AT (Mg2+). Third strands containing a single base substitution in the centre of either the parallel or antiparallel portion showed a (10-fold) weaker interaction in manganese-containing buffers, and no interaction in the presence of magnesium.

Base Composition↗
PubMed2003

Archaeal diversity associated with in situ samplers deployed on hydrothermal vents on the East Pacific Rise (13 degrees N).

To evaluate possible compositional changes in archaeal communities at a deep-sea hydrothermal vent field scale, we examined five different samples obtained after deploying in situ collectors for different times on three spatially separated venting sulphide structures on the East Pacific Rise (13 degrees N). Direct cell counts and whole-cell hybridizations with fluorescently labelled 16S rRNA-based oligonucleotide probes revealed that the relative abundance of archaeal populations represented from 14 to 33% of the prokaryotic community. 16S rDNA sequence analysis of the archaeal clone libraries indicated that a large percentage of clones were closely related to known archaeal isolates recovered from similar habitats. Among the 24 different phylotypes identified, Thermococcales-related sequences were dominant in all the libraries that also included representative genera of orders Methanopyrales, Methanococcales, Archaeoglobales and Desulfurococcales. The presence of most of these phylogenetic groups was confirmed in enrichment cultures performed at temperatures from 60 to 90 degrees C. Additional sequences with no known cultivated relatives grouped with the Marine group I Crenarchaeota, Korarchaeota and Deep-sea Hydrothermal Vent Euryarchaeota (DHVE) within which a novel lineage was identified. Furthermore, the archaeal community composition was distinct from vent to vent within the same vent field and varied within short time scales. This study provides new insights into microbial diversity and distribution at deep-sea hydrothermal vents.

Archaea↗
PubMed1996

Occupancy and composition of proteins bound to the AP-1 sites in the glucocorticoid receptor and c-jun promoters after glucocorticoid treatment and in different cell types.

The glucocorticoid receptor (GR) and c-jun promoters both contain activator protein-1 (AP-1) sites (GR AP-1 site and c-jun AP-1 site, respectively) that vary from the consensus AP-1 site. Electrophoretic mobility shift assays (EMSAs) were used to monitor GR AP-1 and c-jun AP-1 oligonucleotide binding by nuclear extracts from AtT-20 and L929 cells that were hormone- and vehicle-treated for 1, 6, or 24 h. Both AtT-20 and L929 cell nuclear extracts bound the c-jun AP-1 site somewhat better than the GRAP-1 site and, in the majority of cases, extracts from hormone-treated cells shifted both GRAP-1 and c-jun AP-1 oligonucleotides more than nontreated nuclear extracts. Supershift assays, using Jun and Fos family member-specific antibodies, showed that protein complexes formed by AtT-20 cell nuclear extracts bound to the c-jun AP-1 site were comprised of Jun family members, JunD, JunB, and cJun. No Fos family members were present. However, protein complexes from AtT-20 nuclear extracts that bound the GR AP-1 site were supershifted by JunD, JunB, cJun, and Fra-2 specific antibodies. In L929 cell nuclear extracts, the c-jun AP-1 site is bound by JunD and cJun. No clear association of Fos family members with the c-jun AP-1 site could be demonstrated. The GR AP-1 site bound protein complexes composed of JunD, JunB, Fra-2, and Fra-1 from L929 nuclear extracts. This demonstrates that the composition of the protein complexes that associate with the c-jun AP-1 site differs from those that bind the GR AP-1 site. These data also indicate that the protein complexes that bind the GR and c-jun AP-1 sites are cell-type-specific. Computer analysis also revealed five putative cyclic AMP response elements (CREs) in the GR promoter. Relative mobility shift and binding studies suggest that CRE binding protein (CREB), CREB modulator (CREM), or CREB/CREM may be associated with the c-jun AP-1 and/or GR AP-1 sites, but the association at these sites occurs at a lower binding affinity than for a consensus CRE. Nuclear extracts from AtT-20 and L929 cells were able to shift the CRE, and supershift analysis revealed that Jun family members are part of the protein complexes that bind the CRE. Pan Jun and pan Fos antibodies were able to supershift protein-CRE complexes formed using NIH 3T3 nuclear extracts. These data raise the possibility that the promiscuous binding of CREB and/or CREM to the AP-1 site, and AP-1 transcription factors to one or more CREs, in the GR promoter may contribute to the regulation of GR gene expression.

3T3 Cells↗
PubMed1990

The beta-lactam biosynthesis genes for isopenicillin N epimerase and deacetoxycephalosporin C synthetase are expressed from a single transcript in Streptomyces clavuligerus.

Isopenicillin N isomerase (epimerase) has been purified from Streptomyces clavuligerus, and the amino acid sequence of the N-terminus has been determined. By using single oligonucleotide probes based on high GC codon bias ("guessmers"), the translation start codons were determined for two successive genes in the beta-lactam-biosynthetic pathway and mapped within a 3.6-kilobase-pair KpnI restriction fragment. The epimerase gene (cefD) was located immediately upstream of the deacetoxycephalosporin C synthetase (expandase) gene (cefE) that was characterized previously. cefD was sequenced and expressed in Escherichia coli; the resulting cell extracts contained epimerase activity. Western immunoblots demonstrated that a protein comigrated with purified S. clavuligerus epimerase at 44 kilodaltons. cefD and cefE were separated by an 81-base-pair segment. The DNA sequence upstream of the epimerase gene had a high AT content, suggestive of a promoter region. Primer extension analysis of S. clavuligerus mRNA showed that the start of transcription occurred approximately 130 base pairs upstream of the epimerase translation start site; Northern (RNA blot) analysis revealed a hybridization signal large enough to code for both epimerase and expandase, and nuclease S1 protection assays showed that a single message may code for epimerase, expandase, and another unknown protein. When cefD and cefE were placed in an expression vector, concomitant synthesis of both epimerase and expandase occurred in E. coli.

Amino Acid Isomerases↗
PubMed1981

Structural complexity of defective-interfering RNAs of Semliki Forest virus as revealed by analysis of complementary DNA.

The 18S defective interfering RNA of Semliki Forest virus has been reverse transcribed to cDNA, which was shown to be heterogeneous by restriction enzyme analysis. After transformation to E.coli, using pBR322 as a vector, two clones, pKTH301 and pKTH309 with inserts of 1.7 kb and 2 kb, were characterized, respectively. The restriction maps of the two clones were different but suggested that both contained repeating units. At the 3' terminus, pKTH301 had preserved 106 nucleotides and pKTH309 102 nucleotides from the 3' end of the viral 42S genome. The conserved 3' terminal sequence was joined to a different sequence in the two clones, and these sequences were not derived from the region coding for the viral structural proteins. The DI RNAs represented by the two clones are generated from the viral 42S RNA by several noncontinuous internal deletions, since the largest colinear regions with 42S RNA are 320 nucleotides in pKTH301, and 430 and 340 nucleotides in pKTH309. All these fragments had unique RNase T1 oligonucleotide fingerprints, suggesting that they were derived from different regions of 42S RNA.

Base Composition↗
PubMed1995

Targeted mutagenesis in mammalian cells mediated by intracellular triple helix formation.

As an alternative to standard gene transfer techniques for genetic manipulation, we have investigated the use of triple helix-forming oligonucleotides to target mutations to selected genes within mammalian cells. By treating monkey COS cells with oligonucleotides linked to psoralen, we have generated targeted mutations in a simian virus 40 (SV40) vector contained within the cells via intracellular triple helix formation. Oligonucleotide entry into the cells and sequence-specific triplex formation within the SV40 DNA deliver the psoralen to the targeted site. Photoactivation of the psoralen by long-wavelength UV light yields adducts and thereby mutations at that site. We engineered into the SV40 vector novel supF mutation reporter genes containing modified polypurine sites amenable to triplex formation. By comparing the abilities of a series of oligonucleotides to target these new sites, we show that targeted mutagenesis in vivo depends on the strength and specificity of the third-strand binding. Oligonucleotides with weak target site binding affinity or with only partial target site homology were ineffective at inducing mutations in the SV40 vectors within the COS cells. We also show that the targeted mutagenesis is dependent on the oligonucleotide concentration and is influenced by the timing of the oligonucleotide treatment and of the UV irradiation of the cells. Frequencies of intracellular targeted mutagenesis in the range of 1 to 2% were observed, depending upon the conditions of the experiment. DNA sequence analysis revealed that most of the mutations were T.A-to-A.T transversions precisely at the targeted psoralen intercalation site. Several deletions encompassing that site were also seen. The ability to target mutations to selected sites within mammalian cells by using modified triplex-forming oligonucleotides may provide a new research tool and may eventually lead to therapeutic applications.

Animals↗
PubMed1997

Synthesis and properties of oligonucleotide derivatives containing a hydrophobic fluorescent dye at the 2'-position.

The oligonucleotides containing 2'-(6-dimethylamino-2-naphthamide)uridine [U(DAN)] at the different position were synthesized by the fully automated solid phase phosphoramidite methods. The UV melting profiles for the U(DAN)-modified oligonucleotides with complementary DNA exhibited sigmoidal curves whose shapes were similar to those for the unmodified duplexes.

Automation↗