Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Lactoferrin”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,045 records · Page 58Linked to original sources
PubMed2005

Modulation of expression of superantigens by human transferrin and lactoferrin: a novel mechanism in host-Streptococcus interactions.

The role played by host-pathogen interactions in regulation of expression of streptococcal virulence factors in vivo is beginning to become clear. We have reported that the expression of 2 streptococcal virulence factors, the streptococcal pyrogenic exotoxin (Spe) A and the cysteine protease SpeB, was reciprocally modulated during infection with Streptococcus pyogenes. To identify host signals mediating this reciprocal regulation, we cocultured clonal M1T1 isolates with human peripheral blood mononuclear cells (PBMCs). In accordance with our in vivo findings, when bacteria were in direct contact with human PBMCs or were separated in transwells, expression of speA was induced, whereas expression of speB was down-regulated. This phenomenon was mediated by transferrin and lactoferrin and was influenced by the iron-saturation status of these proteins. Iron chelation from media induced expression of speA, but to a much lesser degree than did that with apotransferrin and lactoferrin, suggesting additional effects of these ferrins on modulation of expression of speA and speB. Thus, ferrins may play an important role in host-pathogen interactions in skin and mucosal tissues.

Antigens, Bacterial↗
PubMed2002

Iron status of infants fed low-iron formula: no effect of added bovine lactoferrin or nucleotides.

BACKGROUND: The appropriate level of iron fortification in infant formula remains undetermined. OBJECTIVES: We compared hematologic indexes and iron-status indicators in infants who were either breast-fed or fed formula with concentrations of 2 or 4 mg Fe/L and evaluated the effects of providing part of the iron as bovine lactoferrin and of adding nucleotides. DESIGN: Healthy term infants were exclusively breast-fed (n = 16) or fed formula (n = 10-12) from age 4 +/- 2 wk to 6 mo. Anthropometric measures were taken monthly, and blood samples were taken at 1, 4, and 6 mo. Hematologic indexes; indicators of iron, zinc, and copper status; and erythrocyte fatty acids were assessed. RESULTS: No significant differences in hematology or iron status were observed between groups at 4 and 6 mo of age. Although 34% of all infants had a hemoglobin concentration <110 g/L at 6 mo, the absence of iron deficiency or defective erythropoiesis suggests that this hemoglobin cutoff is too high for this age group. Neither the source or the concentration of iron in formula nor fortification with nucleotides had any significant effect on serum zinc or copper, and nucleotide fortification did not affect erythrocyte fatty acids. CONCLUSIONS: A concentration of 1.6 mg Fe/L formula meets the iron requirement of healthy term infants aged </=6 mo, and providing more iron does not benefit iron stores. Fortification with bovine lactoferrin or nucleotides did not benefit either iron status or erythrocyte fatty acids. Additional studies are needed to establish age-appropriate cutoffs for iron deficiency and iron deficiency anemia in infancy.

Animals↗
PubMed1997

MICs of rifampicin and chloramphenicol for mucoid Pseudomonas aeruginosa strains are lower when human lactoferrin is present.

MlCs of rifampicin and chloramphenicol for mucoid strains of Pseudomonas aeruginosa were lower in the presence of human lactoferrin (0.9 mg/mL, the concentration found in cystic fibrosis sputum) than in its absence. MICs for some strains were lowered to clinically achievable levels of the antibiotics, which is compatible with impressions of greater clinical efficacy in pseudomonas infections than would be predicted by standard sensitivity tests. The routine addition of lactoferrin to sensitivity media for testing of cystic fibrosis isolates may give more useful results than conventional tests as in-vivo conditions are more closely simulated.

Anti-Bacterial Agents↗
PubMed2003

Enhancement of antibacterial and lipopolysaccharide binding activities of a human lactoferrin peptide fragment by the addition of acyl chain.

Cationic antibacterial peptides are potentially therapeutic in the treatment of sepsis, because of their amalgamated antibacterial and lipopolysaccharide-binding activities. We prepared acyl analogues of the peptide fragment of human lactoferrin, which originally had weak antibacterial activity. It was found that 12 carbon units constitute the optimal acyl chain length, enhancing the antibacterial activity and binding of lipopolysaccharide by up to two orders of magnitude. Lactoferrin-based lipopeptides approached the activity of polymyxin B, a lipopeptide of natural origin, but were also active against Gram-positive bacteria.

Acylation↗
PubMed2002

Orally ingested human lactoferrin is digested and secreted in the upper gastrointestinal tract in vivo in women with ileostomies.

Lactoferrin (LF), a glycoprotein present in milk and other secretions, may provide a nutritional ingredient for the treatment of intestinal disorders associated with hyperpermeability, oxidative stress and inflammation. The aim of the study was to determine the survival rate of orally administered recombinant human lactoferrin (rhLF) in the upper gastrointestinal (GI) tract and in the small intestine in vivo in humans. Female ileostomy patients [n = 8; median age 44 (43-57) y] ingested a test beverage containing 5 g rhLF and collected full ileostomy output for 24 h. The passage of the test beverage was monitored using radio-opaque markers. Intact LF in ileal effluent was quantified by ELISA. The entire test beverage passed the small bowel during the 24-h ileal effluent collection period. LF was excreted at a low but constant rate [0.35 (0.28-0.47) micro g LF/2 h]. Gastrointestinal passage of the test beverage and LF excretion over time in the ileal effluent were not correlated. In total, a median of 4 micro g LF was excreted over the 24-h collection period, whereas 5 g rhLF was ingested. Hence, dietary rhLF is digested in the upper GI tract and does not reach the colon. Intact LF appearing in ileostomy effluent is likely to originate from an endogenous source.

Administration, Oral↗
PubMed1999

Isolation and characterization of a gene encoding human Kruppel-like factor 5 (IKLF): binding to the CAAT/GT box of the mouse lactoferrin gene promoter.

The mouse lactoferrin gene promoter includes a CAAT/GT box, GGGCAATAGGGTGGGGCCAGCCC, which functions as the epidermal growth factor response element (EGFRE) in human endometrial carcinoma RL95-2 cells (RL95). A positive clone, EGFREB, of 2575 bp length, was isolated from an expression library of RL95 cells with a multimer of the EGFRE sequence. In this work, we have identified that EGFREB encodes the C-terminus of Kruppel-like factor 5 (KLF5). This mRNA is most abundant in human colon and small intestine. A full-length cDNA clone was isolated from a human colon library using EGFREB as the hybridization probe. The full-length cDNA consists of 3336 bp with a 302 bp 5'-UTR, a 1663 bp 3'-UTR, and a 1371 bp sequence coding for a 457 amino acid polypeptide. Based on its tissue distribution and sequence homology to the mouse IKLF, we renamed this protein IKLF. DNase I footprinting and electrophoresis mobility shift assay confirmed the binding of IKLF to the EGFRE. The human IKLF gene spans >20 kb in length and is organized into four exons, whose intron/exon junctions follow the GT/AG rule. The three zinc fingers are encoded by three exons. Nuclear localization of IKLF was demonstrated by green fluorescence protein (GFP)-tagged IKLF in transfection experiments and western analysis. Overexpression of IKLF in RL95 cells represses the activity of reporter constructs containing the CAAT/GT box of the mouse lactoferrin gene. These findings imply that IKLF is a nuclear transcription factor that binds to the CAAT/GT box, and functions as a modulator of the mouse lacto-ferrin gene promoter activity.

5' Untranslated Regions↗
PubMed1990

Plasma lactoferrin and neutrophil elastase in rheumatoid arthritis and systemic lupus erythematosus.

In order to assess lactoferrin (LF), stored in specific granules of neutrophils, as a marker of inflammation, LF was measured in plasma and serum samples of patients with active rheumatoid arthritis (RA) and systemic lupus erythematosus (SLE). In active RA, the median plasma LF level (800 ng/ml) was significantly higher than in normal individuals (220 ng/ml) (P less than 0.00001) and patients with active SLE (235 ng/ml) (P less than 0.00001). Median plasma elastase-proteinase inhibitor complex (EPIC) and C-reactive protein (CRP) levels were also significantly higher in patients with RA than in normal individuals (P less than 0.00001) and active SLE (P less than 0.00001 for both EPIC and CRP). Elevations of LF, EPIC and CRP in RA were independent of rheumatoid factor titres. Plasma lactoferrin in RA correlated significantly with EPIC (Rs = 0.7, P less than 0.0001), CRP (Rx = 0.72, P less than 0.0001) and absolute neutrophil counts (Rs = 0.483, P less than 0.02), but surprisingly not with the Ritchie index, with which CRP showed a weak but significant correlation (Rs = 0.27, P less than 0.05 greater than 0.025). Thus plasma LF and EPIC are markers of inflammation in RA and their levels may reflect release of mediators of inflammation into the joint space and periarticular tissue.

Adolescent↗
PubMed1995

Pancreatic stone protein and lactoferrin in human pancreatic juice in chronic pancreatitis.

Lactoferrin and pancreatic stone protein (PSP) are thought to be closely related to pancreatic stone formation in chronic pancreatitis. However, the results reported so far have not been conclusive. To reevaluate the pathological importance of PSP in chronic pancreatitis, compared to lactoferrin, levels of PSP were determined by applying an immunoassay specific to PSP to pure pancreatic juice taken from a total of 52 patients. The patients consisted of 16 controls, 19 chronic pancreatitis patients (13 noncalcified and 6 calcified), and 17 probable cases of pancreatitis. The monoclonal antibody PSP antagonist used in the study recognizes both forms of the protein, PSP S1 and S2-5, with equal effectiveness. No significant reduction of PSP was observed in either calcified (mean +/- SEM, 111 +/- 30 micrograms/mg and 24 +/- 3 micrograms/mg protein) or noncalcified (305 +/- 133 and 97 +/- 47) chronic pancreatitis patients compared with controls (85 +/- 23 and 34 +/- 16). PSP levels did not decrease, at least not in the complete forms of the protein found in chronic pancreatitis. PSP antibody and assay results indicated that a reduction of PSP S2-5 alone could not be ruled out in chronic pancreatitis either.

Adult↗
PubMed2004

CXC-chemokine stimulation of neutrophils correlates with plasma levels of myeloperoxidase and lactoferrin and contributes to clinical outcome after pediatric cardiac surgery.

Several CXC-chemokines, of which interleukin (IL)-8 is the prototype, are potent neutrophil chemotactic and activating cytokines, inducing the secretion of granule proteins and the generation of reactive oxygen intermediates that may cause tissue damage and amplify inflammatory responses. Here, we investigated whether chemokines play a key role in the inflammatory process following cardiac surgery with cardiopulmonary bypass (CPB) in children. We performed an observational prospective clinical study of 40 pediatric patients before, during, and after open heart surgery with CPB. Plasma levels of chemokines, myeloperoxidase (MPO), and lactoferrin were measured by immunoassays. Cell surface receptors were detected by flow cytometry. Plasma levels of IL-8 were increased after CPB, correlating strongly with a reduction of expression of the CXC-chemokine receptors (CXCR) 1 and 2 on neutrophils indicating in vivo activation of neutrophils by IL-8. Other CXC-chemokines with Glu-Leu-Arg motif showed no correlation with CXCR1 or CXCR2 expression. Two components of neutrophilic granules, MPO and lactoferrin, were strongly elevated postoperatively, and the levels of both were correlated with IL-8. Levels of monocyte chemoattractant protein (MCP)-1 were increased postoperatively, correlating with a reduction of CCR2 expression and an increase of CD11b expression on monocytes, suggesting monocyte activation by MCP-1. The early postoperative course was complicated in patients with an increase of these inflammatory parameters. Impaired cardiovascular function correlated with increased levels of IL-8 and activation of neutrophils and was most prominent in patients with a long time on CPB and in those with cyanotic heart lesions. In conclusion, MCP-1 is involved in the regulation of chemotaxis and function of monocytes during and early after the end of CPB. Activation of neutrophils and down-regulation of CXCR1 and CXCR2 were predominantly caused by IL-8. This activation implies release of components of neutrophilic granules and correlates with the need for inotropic support.

Chemokine CCL2↗
PubMed1987

Interaction of lactoferrin and transferrins with the outer membrane of Bordetella pertussis.

Bordetella pertussis was able to grow in vitro under conditions where the only iron present was bound to the iron-binding proteins ovotransferrin, transferrin or lactoferrin. Under these conditions the bacteria produced neither hydroxamate nor phenolate-catecholate siderophores to assist in the procurement of iron. Examination of B. pertussis outer-membrane preparations by SDS-PAGE and immunoblotting showed that the iron-binding protein ovotransferrin was bound directly to the bacterial surface. Assays of the binding of radiolabelled transferrin by the bacteria showed that the association was a specific process and that there was turnover of the bound proteins. Competitive binding assays indicated that lactoferrin could be bound in the same way. It is suggested that B. pertussis obtains iron directly from host iron-binding proteins during infection.

Bacterial Outer Membrane Proteins↗
PubMed1989

Identification and comparative analysis of the lactoferrin and transferrin receptors among clinical isolates of gonococci.

Neisseria gonorrhoeae expresses receptors for both lactoferrin (LF) and transferrin (TF). To determine whether qualitative or quantitative changes in these receptors, or both, correlate with the pattern of disease due to N. gonorrhoeae, a dot binding assay with whole cells was used to measure the absolute receptor levels expressed during iron-limited growth of strains isolated from asymptomatic patients and patients with urethritis, cervicitis, pelvic inflammatory disease and disseminated infection. Lactoferrin and transferrin receptor complexes were purified by affinity chromatography and their protein profiles were compared. The molecular weights of the LF and TF receptor complexes from a representative sample of gonococci were homogeneous. We conclude that there is no relationship between the LF and TF receptor levels and disease manifestation, auxotype or serotype.

Carrier State↗
PubMed1989

Identification of the transferrin- and lactoferrin-binding proteins in Haemophilus influenzae.

An affinity procedure with purified, biotinylated human transferrin and streptavidin-agarose was used to identify the transferrin-binding proteins in strains of Haemophilus influenzae. Proteins of 58 and 98 Kda were isolated from total membranes prepared from iron-deficient but not iron-sufficient H. influenzae KC548 cells. The 58-Kda protein was capable of binding human transferrin after sodium dodecyl sulphate (SDS)-polyacrylamide gel electrophoresis (PAGE) and electroblotting. Isolation of transferrin-binding proteins from type-b and non-typable H. influenzae strains demonstrated some variability in the size of the higher mol. wt protein (94-106 Kda) and in ease of elution of the smaller protein from the affinity resin. Use of purified, biotinylated human lactoferrin in the affinity isolation procedure with membranes from a strain expressing lactoferrin-binding activity resulted in isolation of proteins of 105 and 106 Kda distinct from the transferrin-binding proteins.

Haemophilus influenzae↗
PubMed2005

Salivary lactoferrin is recognized by the human herpesvirus-8.

Human herpesvirus-8 (HHV-8) is commonly detected in all epidemiologic forms of Kaposi's sarcoma. Despite the broad cellular tropism of HHV-8, studies on mucosal shedding of HHV-8 have shown that infectious particles are restricted to saliva isolated from the oropharynx. We used biotinylated purified HHV-8 particles in a direct binding assay to whole clarified human salivary samples isolated from HHV-8-infected and uninfected individuals. We found that the major binding activity was carried out by a protein of 78-kDa size, which was further characterized as human lactoferrin (hLf) using 2-D electrophoresis and MALDI-ToF analysis. Preliminary comparison of HHV-8 binding activity of 76 salivary samples from HHV-8-infected and uninfected individuals showed that 7.8% of the uninfected population exhibited a form of Lf not recognized by HHV-8. Deglycosylation of hLf by PNGase F did not reduce HHV-8 binding activity, whereas endoproteinase cleavage of native hLf generated a non-glycosylated 8-kDa peptide recognized by HHV-8 particles and was located at the position Ala606-Tyr679 in the native hLf amino acid sequence, corresponding to the C-terminal region of the glycoprotein. This work identify the lactoferrin in saliva as a ligand for HHV-8 and suggests that this glycoprotein could be used as a carrier for the viral particles.

Adult↗
PubMed1996

Involvement of vulnibactin and exocellular protease in utilization of transferrin- and lactoferrin-bound iron by Vibrio vulnificus.

In vitro growth experiments were conducted to evaluate the ability of vulnibactin, a siderophore produced by Vibrio vulnificus, to sequester transferrin- or lactoferrin bound iron for growth. Comparative studies with the strain producing vulnibactin and its exocellular protease-deficient mutant revealed the involvement of the protease in addition to vulnibactin in effective utilization of iron ion (Fe3+) bound to transferrin and lactoferrin. It appears that the protease causes cleavage of these proteins, thereby making bound iron more accessible to vulnibactin.

Amides↗
PubMed1998

Anti-Candida activity of calprotectin in combination with neutrophils or lactoferrin.

The effect of an anti-microbial protein, calprotectin, in combination with neutrophils on the growth of Candida albicans was investigated. The growth inhibition of C. albicans by murine neutrophils was augmented by the addition of a low concentration of calprotectin prepared from rat peritoneal exudate cells. The concentrations of calprotectin causing 50% inhibition of growth of C. albicans in the absence or presence of neutrophils at an effector-to-target (E/T) ratio of 30 and 60 were estimated to be 0.45, 0.34 and 0.28 U/ml, respectively. The anti-Candida activity of calprotectin was completely inhibited by 2 microM of zinc ion, while it only partially lowered the activity of the combination of calprotectin and neutrophils. Lactoferrin, which is an anti-microbial protein released from neutrophils, strongly inhibited the growth of C. albicans in combination with calprotectin. These results suggest that calprotectin and lactoferrin released from neutrophils may cooperate to inhibit the growth of C. albicans at a local lesion of the infection where there is an accumulation of neutrophils.

Animals↗
PubMed2006

Randomized, double-blind, placebo-controlled trial of bovine lactoferrin in patients with chronic hepatitis C.

Several studies have suggested that lactoferrin administration may decrease the serum level of hepatitis C virus (HCV) RNA in patients with chronic hepatitis C. The aim of the present study was to confirm the efficacy of orally administered bovine lactoferrin (bLF) in patients with chronic hepatitis C. The patients with chronic hepatitis C randomly received either oral bLF at a dose of 1.8 g daily for 12 weeks, or an oral placebo. The primary endpoint was the virologic response, defined as a 50% or greater decrease in serum HCV RNA level at 12 weeks compared with the baseline. The secondary endpoint was the biochemical response, which was defined as a 50% or greater decrease in the serum alanine aminotransferase (ALT) level at 12 weeks compared with the baseline. One hundred and ninety-eight of 199 patients were evaluable for efficacy and safety. bLF treatment was well tolerated and no serious toxicities were observed. A virologic response was achieved in 14 of 97 patients (14.4%) in the bLF group, and 19 of 101 (18.8%) in the placebo group. There was no significant difference in virologic response rates between the two groups (-4.4%, 95% confidence interval -14.8, 6.1). In addition, bLF intake did not have any favorable effect on the serum ALT level. The virologic responses were not different between two groups in any subgroup analysis. In conclusion, orally administered bLF does not demonstrate any significant efficacy in patients with chronic hepatitis C.

Administration, Oral↗
PubMed1991

Lactoferrin inducible monocyte cytotoxicity defective in esterase deficient monocytes.

We recently demonstrated a higher incidence of monocyte esterase deficiency in patients with lymphoproliferative neoplasia and gastrointestinal carcinoma than in the normal population. Using lactoferrin to stimulate monocyte cytotoxicity we have now compared the abilities of esterase positive and esterase deficient monocytes to lyse K562 cells. The esterase deficient monocytes were from normal subjects whose monocytes have consistently failed to show cytochemical esterase staining over 30-72 months and which lack specific monocyte isoenzymes. The esterase positive monocytes were from age and sex matched control subjects. Esterase positive monocytes responded to lactoferrin stimulation by a five-fold increase in cytotoxicity whereas deficient monocytes failed to produce any response. These results indicate a possible defect in cytotoxicity of esterase deficient monocytes and together with the epidemiological findings suggest a link between monocyte esterase deficiency and neoplasia.

Cells, Cultured↗
PubMed1992

Effect of transferrin, lactoferrin and chelated iron on human T-lymphocytes.

The effect of different forms of iron and iron-binding proteins on the proliferative response of human lymphocytes to phytohaemagglutinin (PHA) has been studied. Transferrin enhanced proliferation, the effect being proportional to the degree of iron saturation up to 100%, but decreased if additional iron was present. The lipophilic complex ferric pyridoxal isonicotinoyl hydrazone (FePIH) also enhanced proliferation, but the hydrophilic complex ferric nitrilotriacetate (FeNTA) was inhibitory. Fe-lactoferrin could not substitute for Fe-transferrin, although iron-free (apo) lactoferrin abrogated the inhibitory effect seen when iron levels exceed the binding capacity of transferrin. Lymphocyte ferritin levels increased 4-fold as the iron saturation of transferrin increased from 0 to 90% but no further increase was seen at higher iron levels, suggesting that lymphocytes are poorly equipped to detoxify excess iron through stimulation of ferritin synthesis. The effect of iron on the CD4:CD8 ratio after 72 h culture with PHA was also examined. The ratio was approximately 2:1 for cells cultured with transferrin at iron saturations between 0 and 75%, with FePIH, or without either, but decreased to 1.1:1 when cells were cultured in the presence of FeNTA, regardless of whether or not saturated Fe-transferrin was present. These results show that iron can affect lymphocyte proliferation and subset ratios in different ways according to the form and amount present, and may help to explain some of the immunological disturbances associated with iron overload.

Adult↗