SEARCH · Search PubMed
Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.
Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.
The present review is focused on the main achievements realized in the lysozyme research field since the meeting held in 1972 to commemorate the fiftieth anniversary of the discovery of this enzyme. Despite of extensive structural, physico-chemical, crystallographic, genetic, immunological and evolutionary studies devoted to lysozymes, their biological role is still not exactly known.
Tryptic peptide map analyses of five K- and three D-gene products of various H-2 haplotypes are presented. These data support earlier sequence studies and demonstrate that the variations in allelic gene products of the K or D loci are scattered throughout much of the polypeptide chains. Furthermore, the K allelic gene products are no more closely related to one another than they are to the D allelic gene products. This apparent lack of K-ness and D-ness places interesting constraints on the genetic organization and evolutionary history of the genes encoding the transplantation antigens.
The lutein-epoxide cycle (Lx cycle) is an auxiliary xanthophyll cycle known to operate only in some higher-plant species. It occurs in parallel with the common violaxanthin cycle (V cycle) and involves the same epoxidation and de-epoxidation reactions as in the V cycle. In this study, the occurrence of the Lx cycle was investigated in the two major families of mistletoe, the Loranthaceae and the Viscaceae. In an attempt to find the limiting factor(s) for the occurrence of the Lx cycle, pigment profiles of mistletoes with and without the Lx cycle were compared. The availability of lutein as a substrate for the zeaxanthin epoxidase appeared not to be critical. This was supported by the absence of the Lx cycle in the transgenic Arabidopsis plant lutOE, in which synthesis of lutein was increased at the expense of V by overexpression of epsilon-cyclase, a key enzyme for lutein synthesis. Furthermore, analysis of pigment distribution within the mistletoe thylakoids excluded the possibility of different localizations for the Lx- and V-cycle pigments. From these findings, together with previous reports on the substrate specificity of the two enzymes in the V cycle, we propose that mutation to zeaxanthin epoxidase could have resulted in altered regulation and/or substrate specificity of the enzyme that gave rise to the parallel operation of two xanthophyll cycles in some plants. The distribution pattern of Lx in the mistletoe phylogeny inferred from 18S rRNA gene sequences also suggested that the occurrence of the Lx cycle is determined genetically. Possible molecular evolutionary processes that may have led to the operation of the Lx cycle in some mistletoes are discussed.
Association of HLA and diseases is well known. Several population studies are available suggesting evidence of association of HLAs in more than 40 diseases. HLA found across various populations vary widely. Some of the reasons attributed for such variation are occurrence of social stratification based on geography, language and religion, consequences of founder effect, racial admixture or selection pressure due to environmental factors. Hence certain HLA alleles that are predominantly associated with disease susceptibility or resistance in one population may or may not show any association in other populations for the same disease. Despite of these limitations, HLA associations are widely studied across the populations worldwide and are found to be important in prediction of disease susceptibility, resistance and of evolutionary maintenance of genetic diversity. This review consolidates the HLA data on some prominent autoimmune and infectious diseases among various ethnic groups and attempts to pinpoint differences in Indian and other population.
The trypanosomatids combine a relatively uniform morphology with ability to parasitise a very diverse range of hosts including animals, plants and other protists. Along with their sister family, the biflagellate bodonids, they are set apart from other eukaryotes by distinctive organisational features, such as the kinetoplast-mitochondrion and RNA editing, isolation of glycolysis enzymes in the glycosome, use of the flagellar pocket for molecular traffic into and out of the cell, a unique method of generating cortical microtubules, and bizarre nuclear organisation. These features testify to the antiquity and isolation of the kinetoplast-bearing flagellates (Kinetoplastida). Molecular sequencing techniques (especially small subunit ribosomal RNA gene sequencing) are now radically reshaping previous ideas on the phylogeny of these organisms. The idea that the monogenetic (MG) trypanosomatids gave rise to the digenetic (DG) genera is losing ground to a view that, after the bodonids, the African trypanosomes (DG) represent the most ancient lineage, followed by Trypanosoma cruzi (DG), then Blastocrithidia (MG), Herpetomonas (MG) and Phytomonas (DG), with Leptomonas (MG), Crithidia (MG), Leishmania (DG) and Endotrypanum (DG) forming the crown of the evolutionary tree. Vast genetic distances (12% divergence) separate T. brucei and T. cruzi, while the Leishmania species are separated by very short distances (less than 1% divergence). These phylogenetic conclusions are supported by studies on RNA editing and on the nature of the parasite surface. The trypanosomatids seem to be able to adapt with ease their energy metabolism to the availability of substrates and oxygen, and this may give them the ability to institute new life cycles if host behaviour patterns allow. Sexual processes, though present in at least some trypanosomatids, may have played only a minor part in generating diversity during trypanosomatid evolution. On the other hand, the development of altruistic behaviour on the part of some life cycle stages may be a hitherto unconsidered way of maximising fitness in this group. It is concluded that, owing to organisational constraints, the trypanosomatids can undergo substantial molecular variation while registering very little in the way of morphological change.
There are many methods of inference in common use in biology that are based on population sampling, including such diverse areas as sampling organisms to determine the population structure of an ecosystem, sampling a set of DNA sequences to infer evolutionary history, sampling genetic loci to build a genetic map, sampling differentially expressed genes to find phenotypic markers, and many others. Recently developed PCR-based methods for nucleic acid fingerprinting can be used as sampling tools with general applicability in molecular biology, evolution and genetics. These methods include arbitrarily primed PCR (AP-PCR; Welsh and McClelland, 1990) and random amplified polymorphic DNA (RAPD; Williams et al., 1990) for the fingerprinting of DNA, and RNA arbitrarily primed PCR (RAP-PCR; Welsh et al., 1992a) and differential display (DD; Liang and Pardee, 1992) for the fingerprinting of RNA. Novel ways of looking at genetic control are facilitated by the high data-acquisition capabilities of the fingerprinting methods. In this article, we review some of the applications of DNA fingerprinting to the study of mutagenesis, and of RNA fingerprinting to the study of normal and abnormal signal transduction. We propose that these fingerprinting approaches may also have applications in the study of senescence and aging.
The main factors shaping codon usage bias in the Deinococcus radiodurans genome were reported. Correspondence analysis (COA) was carried out to analyze synonymous codon usage bias. The results showed that the main trend was strongly correlated with gene expression level assessed by the "Codon Adaptation Index" (CAI) values, a result that was confirmed by the distribution of genes along the first axis. The results of correlation analysis, variance analysis and neutrality plot indicated that gene nucleotide composition was clearly contributed to codon bias. CDS length was also key factor in dictating codon usage variation. A general tendency of more biased codon usage of genes with longer CDS length to higher expression level was found. Further, the hydrophobicity of each protein also played a role in shaping codon usage in this organism, which could be confirmed by the significant correlation between the positions of genes placed on the first axis and the hydrophobicity values (r=-0.100, P<0.01). In summary, gene expression level played a crucial role, nucleotide mutational bias, CDS length and the hydrophobicity of each protein just in a minor way in shaping the codon usage pattern of D. radiodurans. Notably, 19 codons firstly defined as "optimal codons" may provide useful clues for molecular genetic engineering and evolutionary studying.
Cytogenetically unrelated clones are uncommon findings in hematologic disorders. In the present study, among the 1,110 various hematologic malignancies analyzed during the past seven years, 27 (2.4%) patients had karyotypically unrelated clones: 3.5% (7/202) of acute myeloid leukemias, 5.3% (11/206) of myelodysplastic syndromes, none of 40 acute lymphoblastic leukemias, 0.4% (1/233) of myeloproliferative disorders, and 2.6% (8/306) lymphoproliferative disorders with clonal chromosomal abnormalities. Twenty-five patients showed two unrelated clones and two had three unrelated clones. The most consistent chromosome abnormalities were del(5q) (seven cases), +8 (six cases), del(20q) (five cases), and del(7q), +12, +21, and -22 (three cases each). Of interest, the high frequency of different numeric or structural abnormalities affecting the same chromosomes in such clones supports the hypothesis that these karyotypically unrelated clones originate from the common malignant clone through submicroscopic molecular genetic changes and evolutionary processes.
The combination of molecular biology, epidemiology, virology, evolutionary and population genetics has enabled us to understand the delicate interplay between HIV and the CCR5-Delta32 HIV resistance allele. We here review and collect from the different approaches to show how they can be combined to elucidate the interaction between host and pathogen genetics in this system. We will present an overview of the normal role of CCR5, its involvement in HIV, the molecular biology of the CCR5-Delta32 allele and its probable origins. By focusing on this well-documented and important system we hope to demonstrate the power that such a "holistic" approach might offer in the study of infectious diseases.
Arginine decarboxylase (ADC) is a key enzyme involved in the synthesis of polyamines, which have been implicated in developmental processes and stress responses in higher plants. An ancestral ADC gene appears to have been duplicated at the origin of the Brassicaceae family, thus yielding two paralogues in the derived taxa. ADC gene structure was investigated in Pringlea antiscorbutica R. Br., a geographically isolated Brassicaceae species that is endemic from the subantarctic region. P. antiscorbutica exhibits several biochemical and physiological adaptations related to this cold and harsh environment, including high levels of polyamines, which is unusual in higher plants, and especially high levels of agmatine, the product of the ADC-catalysed reaction. Various ADC clones were obtained from P. antiscorbutica. Sequence and phylogenetic analysis showed that all these clones fitted with the presence of two paralogues, PaADC1 and PaADC2, in P. antiscorbutica. Expression of these ADC paralogues was analyzed in P. antiscorbutica during vegetative development and response to stress. Whereas PaADC2 was expressed at both seedling and mature stages, PaADC1 transcripts were hardly detected during early development and were significantly expressed in mature plants. Moreover, PaADC2, but not PaADC1, expression was up-regulated in response to chilling and salt stress at seedling stage. Analysis of 5' regulatory regions of these ADC genes revealed several differences in putative cis-regulatory elements, which could be associated with specific expression patterns. These results were compared to ADC paralogue expression in Arabidopsis thaliana and are discussed in the evolutionary context of genetic diversity resulting from gene duplication.
The teeth of the Homo erectus child (Garba IV) recovered from Melka Kunture Ethiopia and dated to 1.5 Ma are characterized by generalized enamel dysplasia, reduced enamel radio-opacity, and severe attrition. This combination of features is found in a large group of hereditary, generalized enamel dysplasias known as amelogenesis imperfecta (AI). SEM studies carried out on epoxy replicas of teeth from the Garba IV child, confirmed that the defects noted were developmental and not due to diagenesis. The enamel prism arrangement is abnormal and there are deep vertical furrows lacking enamel on both buccal and lingual surfaces of all molars. The lesions differ from those characteristic of linear enamel hypoplasia that form discrete horizontal lesions or pits within otherwise normal enamel. We propose that the Garba IV child is the earliest example of AI and provides a link between palaeoanthropology and molecular biology in investigations of the evolutionary history of genetic disorders.
Human language is unique among the communication systems of the natural world. The vocabulary of human language is unique in being both culturally transmitted and symbolic. In this paper I present an investigation into the factors involved in the evolution of such vocabulary systems. I investigate both the cultural evolution of vocabulary systems and the biological evolution of learning rules for vocabulary acquisition. Firstly, vocabularies are shown to evolve on a cultural time-scale so as to fit the expectations of learners-a population's vocabulary adapts to the biases of the learners in that population. A learning bias in favour of one-to-one mappings between meanings and words leads to the cultural evolution of communicatively optimal vocabulary systems, even in the absence of any explicit pressure for communication. Furthermore, the pressure to conform to the biases of learners is shown to outweigh natural selection acting on cultural transmission. Human language learners appear to bring a one-to-one bias to the acquisition of vocabulary systems. The functionality of human vocabulary may therefore be a consequence of the biases of human language learners. Secondly, the evolutionary stability of genetically transmitted vocabulary learning biases is investigated using both static and dynamic models. A one-to-one learning bias, which leads to the cultural evolution of optimal communication, is shown to be evolutionarily stable. However, the evolution de novo of this bias is complicated by the cumulative nature of the cultural evolution of vocabulary systems. This suggests that the biases of human language learners may not have evolved specifically and exclusively for the acquisition of communicatively functional vocabulary.
The study of insect seminal fluid proteins provides a unique window upon adaptive evolution in action. The seminal fluid of Drosophila melanogaster contains over 80 proteins and peptides, which are transferred together with sperm by mating males. The functions of many of these substances are not yet known. However, those that have been characterized have marked effects on the reproductive success of males and females. For example, seminal fluid proteins and peptides can decrease female receptivity, can increase egg production and can increase sperm storage, and are necessary for sperm transfer and success in sperm competition. In this review we focus on the currently known functions of seminal fluid molecules and on new technologies and approaches that are enabling novel questions about their form and function to be addressed. We discuss how techniques for disrupting the production of seminal fluid proteins, such as homologous recombination and RNA interference, along with the use of microarrays and yeast two hybrid systems, should allow us to address ever more sophisticated questions about seminal fluid protein function. These and similar techniques promise to reveal the function of naturally-occurring variants of these proteins and hence the evolutionary significance of genetic variation for them.
Cyril Dean Darlington (1903-1981) has been forgotten by historians, but was in his day, the leading cytologist of the premolecular era. Of humble and inconspicuous beginnings, Darlington started his career as an unpaid volunteer worker under the aging William Bateson. Working in almost total isolation and with no scientific guidance, he boldly deduced the laws of chromosome behaviour, making cytology relevant once again both to genetics and to evolutionary theory. This process did not proceed smoothly, for both Darlington's method, and cross-disciplinary approach made the reception of his novel ideas difficult. This article examines Darlington's contribution to the premolecular understanding of Life, and the reasons why it was so difficult to accept.
Interesting and intriguing questions involve complex systems whose properties cannot be explained fully by reductionist approaches. Last century was dominated by physics, and applying the simple laws of physics to biology appeared to be a practical solution to understand living organisms. However, although some attributes of living organisms involve physico-chemical properties, the genetic program and evolutionary history of complex biological systems make them unique and unpredictable. Furthermore, there are and will be 'unobservable' phenomena in biology which have to be accounted for.
Insulin resistance, defined as a diminished effect of a given dose of insulin on glucose homeostasis, is a highly prevalent feature of women with PCOS. Insulin resistance in PCOS is closely associated with an increase in truncal-abdominal fat mass, elevated free fatty acid levels, increased androgens, particularly free testosterone through reduced SHBG levels, and anovulation. The causes for insulin resistance in PCOS are still unknown. One line of evidence suggests that an increase in truncal-abdominal fat mass and subsequently increased free fatty acid levels induce insulin resistance in women with PCOS. Increased effects of corticosteroids and a relative reduction in oestrogen and progesterone seem to be involved in the aberrant body fat distribution. Conversely, there are also results supporting primary, genetic target cell defects as a cause of insulin resistance in PCOS. An explanation for these seemingly contradictory results could be that the group of women with PCOS is heterogeneous with respect to the primary event in carbohydrate/insulin disturbances. Also insulin secretion in PCOS is characterized by heterogeneity. At one end of the spectrum is a large subgroup of mainly obese women with reduced insulin secretion, which appears to result from failure of the beta cells to compensate for insulin resistance in susceptible women, resulting in glucose intolerance and NIDDM. In the insulin-resistant patients with normal glucose tolerance, most of the hyperinsulinaemia is probably due to secondarily increased insulin secretion and decreased insulin degradation. However, a component of the increased first-phase insulin release is not due to measurable insulin resistance. Notably, this is also found in lean women with normal insulin sensitivity, and is not reversed after weight reduction, in contrast to the findings for insulin resistance. The implications of this enhanced insulin release are not fully clear, but it may tentatively be associated with carbohydrate craving and subsequently increased risks for development of obesity and insulin resistance. It may represent a primary disturbance of insulin secretion in PCOS or may be associated with the perturbed steroid balance in anovulation. The insulin-androgen connection in PCOS appears to be amplified by several different mechanisms, notably in both directions, the initiating event probably varying between individuals. Thus insulin increases the biological availability of potent steroids, primarily testosterone, through the suppression of SHBG synthesis. Insulin is also involved as a progonadotrophin in ovarian steroidogenesis, with the possible net result of interfering with ovulation and/or increasing ovarian androgen production in states of hyperinsulinaemia. Conversely, testosterone may indirectly contribute to insulin resistance through facilitating free fatty acid release from abdominal fat, but perhaps also through direct muscular effects at higher serum levels. It seems likely that this constitution, presumably genetic, would provide evolutionary advantages in times of limited nutrition, given the energy-saving effects of insulin resistance. Hypothetically, hyperinsulinaemia (primary) could provide a stimulus to ensure intake of nourishment, but unlimited food supplies could in some cases initiate a vicious 'anabolic' circle, in which several of the proposed amplifying mechanisms between insulin and androgens--in both directions--could take part.
Expression of vnd in ventral, ind in intermediate, and msh in dorsal columns of fly neurectoderm, and of homologous gene families in corresponding domains of vertebrate neurectoderm, suggests that elements of dorsoventral neural patterning have been evolutionarily conserved. However, upstream signaling pathways regulating this columnar gene expression pattern appear to have diverged significantly throughout evolution. In addition, while recent loss-of-function studies in flies and mice indicate that these three genes may have a conserved role in regional specification, there is no obvious conservation of the particular cell fates deriving from corresponding domains. The three-column expression pattern may thus represent a developmental mechanism that is more resistant to evolutionary changes than genetic events upstream or downstream of it.
We have found that, in the presence of a thermophilic restriction endonuclease, thermophilic DNA polymerase efficiently synthesizes and amplifies DNA in the absence of any added template and primer nucleic acid under isothermal conditions. More than 10 microg of DNA can be synthesized by 1 unit of DNA polymerase in 1 h, and the reaction proceeds until available dNTPs are consumed. We used mostly the Tsp509I restriction endonuclease (recognition sequence: decreasing AATT), the TspRI restriction endonuclease (recognition sequence: NNCA(G/C)TGNN decreasing), and Vent (exo(-)) and Vent DNA polymerase. The synthesized double-stranded DNA has a highly repetitive palindromic sequence, e.g. (AAAAATTTTT)(n) and (ATACACTGTATATACAGTGTAT)(n). In every repeating unit, there are one or two recognition sites for the restriction enzyme. Our data show that the high efficiency of the restriction-endonuclease-DNA-polymerase (RE-pol) DNA synthesis results from an efficient exponential amplification involving digestion-elongation cycles: a longer DNA with numerous recognition sites for the restriction enzyme is digested to short fragments, and the short fragments are used as seeds for elongation to synthesize longer DNA. A possible role of RE-pol DNA synthesis in the evolutionary development of genetic materials is briefly discussed.