Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “ZAP”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,027 records · Page 57Linked to original sources
PubMed1999

A comparison of the inhibitory activity of PDE4 inhibitors on leukocyte PDE4 activity in vitro and eosinophil trafficking in vivo.

1. Phosphodiesterase (PDE) 4 inhibitors have been shown to inhibit eosinophil PDE4 activity in vitro and accumulation of eosinophils in experimental airways inflammation. However, direct effects on eosinophil trafficking have not been studied in detail and it is not known if activity in vitro translates into efficacy in vivo. In the present study, we compared the activity of five PDE4 inhibitors in vitro and against trafficking of (111)In-eosinophils in cutaneous inflammation in the guinea-pig. 2. The rank order of potency for inhibition of PDE4 activity in guinea-pig eosinophil, neutrophil and macrophage, and human neutrophil lysates was RP73401 > SB207499 >CDP840 > rolipram > LAS31025. On TNFalpha production by human PBMC, all inhibitors with the exception of rolipram showed potency similar to their effect on neutrophil lysates. 3. In a brain cerebellum binding assay, the rank order of potency at displacing [3H]-rolipram was RP73401 > rolipram > SB207499 > CDP840 > LAS30125. 4. Trafficking of (111)In-eosinophils to skin sites injected with PAF, ZAP or antigen in sensitized sites was inhibited by oral administration of all PDE4 inhibitors. The rank order of potency was RP73401 = rolipram > LAS31025 > SB207499 > CDP840. 5. With the exception was RP73401, which was the most potent compound in all assays, there was no clear relationship between activity of PDE4 inhibitors in vitro and capacity to inhibit eosinophil trafficking in vivo. Thus, we conclude that in vitro activity of PDE4 inhibitors does not predict in vivo efficacy in an experimental model of eosinophil trafficking.

3',5'-Cyclic-AMP Phosphodiesterases↗
PubMed2003

Successful unrelated cord blood transplantation in two children with severe combined immunodeficiency syndrome.

We describe the successful unrelated cord blood transplantation in two patients affected by a Zap-70 deficiency and an Omenn-like syndrome, respectively. The patients were hospitalised for recurrent infections at the age of 13 and 2 months, respectively. An unrelated cord blood unit was found for each. The conditioning regimen was cyclophosphamide, busulfan and antithymocyte globulin. The total number of infused cells was 15.1 x 10(7)/kg and 17 x 10(7)/kg, respectively. Neutrophil engraftment was achieved on days +15 and +23, and platelet count >50 x 10(9)/l was achieved on days +21 and +52, respectively. One patient presented acute Graft-versus-host disease (GVHD) grade I and the other grade III. Chimerism was mixed and full donor. Normal lymphoproliferative response to mitogens and alloantigens was detectable at 6 months for both. No chronic GVHD was observed in either. The patients are alive and well at 53 and 15 months after transplantation. In conclusion, umbilical cord blood represents a valid alternative source of haemopoietic stem cells.

Antilymphocyte Serum↗
PubMed2005

Increased expression of CD152 (CTLA-4) by normal T lymphocytes in untreated patients with B-cell chronic lymphocytic leukemia.

Patients with chronic lymphocytic leukemia (CLL) have defects in both cellular and humoral immunity. Since CD152 (CTLA-4) plays a critical role in downregulating T-cell responses, we studied the expression of surface and cytoplasmic CD152 (sCD152 and cCD152, respectively) in freshly isolated T cells from treatment-naïve patients with CLL. CD4+ and CD8+ T cells from these patients demonstrated significantly increased sCD152 and cCD152 compared to normal donors. Furthermore, these patients had an increased proportion of the regulatory CD4(+)/CD25(+)/CD152+ subset that correlated with advanced Rai stage, unfavorable cytogenetics and low serum IgG and IgA levels. The expression of sCD152 by T cells also correlated with ZAP-70 expression by CLL B cells. The proportion of CD4(+)/CD25+ cells was also correlated with unmutated immunoglobulin heavy chain variable gene status. Blockade of CD152 with monoclonal antibody (mAb) in proliferation assays was associated with potent T-cell proliferation in response to autologous and allogeneic CD40-activated CLL B cells. In summary, T cells from patients with CLL may be primed for anergy by expressing increased amounts of CD152; anti-CD152 mAb may represent a therapeutic opportunity to enhance an immune response against autologous leukemia cells.

Adult↗
PubMed2000

Isolation and characterization of sixteen novel p53 response genes.

The EB-1 cell line is a stable transfectant of EB, a p53 null colon carcinoma cell line, with an inducible promoter controlling expression of a wild type p53 cDNA. The induced p53 is transcriptionally active and gives rise to apoptosis in these cells. Using this cellular model for presence or absence of the transcription factor p53 and transactivated genes, the Suppression Subtractive Hybridization (SSH) technique permitted the isolation of 17 mRNA candidates (GIPs-Genes induced by p53), whose expression appears to be p53-dependent. Identity has been established for nine of the 17 isolated candidates. These are HGFL/MSP, Zap-70, APOBEC2, Ponsin/SH3P12/CAP/FLAF2, CDCrel2b/H5/Pnutl2, IgG, lats 2, cytokeratin 15 and PIG-3 (quinone oxidoreductase). The latter gene is the only GIP previously demonstrated to be p53 regulated. Of the eight remaining GIPs, six correspond to Unigene clusters. One candidate, GIP #1, is significantly homologous (72% identity) to a chicken zinc finger protein, CTCF, which binds to insulator elements and thus attenuates enhancer cross-talk between physically adjacent promoters. The p53-dependent expression of GIPs was confirmed by dependence of expression upon induction of wt p53 expression in the EB-1 cellular model and by up-regulation following activation of an endogenous wt p53 by treatment with adriamycin. Oncogene (2000) 19, 3978 - 3987.

Apoptosis↗
PubMed2001

Spleen tyrosine kinase (Syk) deficiency in childhood pro-B cell acute lymphoblastic leukemia.

The cytoplasmic spleen tyrosine kinase (SYK) is a key regulator of signal transduction events, apoptosis and orderly cell cycle progression in B-lineage lymphoid cells. Although SYK has not been linked to a human disease, defective expression of the closely related T-cell tyrosine kinase ZAP-70 has been associated with severe combined immunodeficiency. Childhood CD19(+)CD10(-) pro-B cell acute lymphoblastic leukemia (ALL) is thought to originate from B-cell precursors with a maturational arrest at the pro-B cell stage and it is associated with poor prognosis. Since lethally irradiated mice reconstituted with SYK-deficient fetal liver-derived lymphohematopoietic progenitor cells show a block in B-cell ontogeny at the pro-B to pre-B cell transition, we examined the SYK expression profiles of primary leukemic cells from children with pro-B cell ALL. Here we report that leukemic cells from pediatric CD19(+)CD10(-) pro-B cell ALL patients (but not leukemic cells from patients with CD19(+)CD10(+) common pre-pre-B cell ALL) have markedly reduced SYK activity. Sequencing of the reverse transcriptase-polymerase chain reaction (RT-PCR) products of the Syk mRNA in these pro-B leukemia cells revealed profoundly aberrant coding sequences with deletions or insertions. These mRNA species encode abnormal SYK proteins with a missing or truncated catalytic kinase domain. In contrast to pro-B leukemia cells, pre-pre-B leukemia cells from children with CD19(+)CD10(+) common B-lineage ALL and EBV-transformed B-cell lines from healthy volunteers expressed wild-type Syk coding sequences. Examination of the genomic structure of the Syk gene by inter-exonic PCR and genomic cloning demonstrated that the deletions and insertions in the abnormal mRNA species of pro-B leukemia cells are caused by aberrant splicing resulting in either mis-splicing, exon skipping or inclusion of alternative exons, consistent with an abnormal posttranscriptional regulation of alternative splicing of Syk pre-mRNA. Our findings link for the first time specific molecular defects involving the Syk gene to an immunophenotypically distinct category of childhood ALL. To our knowledge, this is the first discovery of a specific tyrosine kinase deficiency in a human hematologic malignancy.

Agammaglobulinaemia Tyrosine Kinase↗
PubMed2004

TULA: an SH3- and UBA-containing protein that binds to c-Cbl and ubiquitin.

Downregulation of protein tyrosine kinases is a major function of the multidomain protein c-Cbl. This effect of c-Cbl is critical for both negative regulation of normal physiological stimuli and suppression of cellular transformation. In spite of the apparent importance of these effects of c-Cbl, their own regulation is poorly understood. To search for possible novel regulators of c-Cbl, we purified a number of c-Cbl-associated proteins by affinity chromatography and identified them by mass spectrometry. Among them, we identified the UBA- and SH3-containing protein T-cell Ubiquitin LigAnd (TULA), which can also bind to ubiquitin. Functional studies in a model system based on co-expression of TULA, c-Cbl, and EGF receptor in 293T cells demonstrate that TULA is capable of inhibiting c-Cbl-mediated downregulation of EGF receptor. Furthermore, modulation of TULA concentration in Jurkat T-lymphoblastoid cells demonstrates that TULA upregulates the activity of both Zap kinase and NF-AT transcription factor. Therefore, our study indicates that TULA counters the inhibitory effect of c-Cbl on protein tyrosine kinases and, thus, may be involved in the regulation of biological effects of c-Cbl. Finally, our results suggest that TULA-mediated inhibition of the effects of c-Cbl on protein tyrosine kinases is caused by TULA-induced ubiquitylation and degradation of c-Cbl.

Amino Acid Substitution↗
PubMed2004

Treatment options in chronic lymphocytic leukemia.

Chronic lymphocytic leukemia (CLL) is the most common adult hematological malignancy in the Western world and predominantly affects the elderly. The disease encompasses a wide spectrum of clinical symptoms, which translate into variable prognosis and survival. The stratification of patients based on their clinical risk profile has been aided by the recognition of novel prognostic markers, for example, VH mutations and ZAP-70 expression, and this process is fundamental to assigning the most appropriate treatment strategy on an individual basis. Although CLL remains incurable with standard treatments, important progress in treatment has been made. The discovery of purine analogs such as fludarabine has led to significant improvements in remission rates and freedom from progression but, unfortunately, no significant prolongation in survival. With the success of newer therapeutic approaches, such as the monoclonal antibodies and stem cell transplantation, the focus of current therapy is on using these approaches in combination with fludarabine to produce high rates of molecular complete response, to eradicate minimal residual disease, and to lengthen survival. This paper provides an overview of CLL and discusses how recent therapeutic developments have changed the management of this form of leukemia.

Antineoplastic Agents↗
PubMed1991

Cloning, structure and expression of cDNA for mouse contrapsin and a related protein.

A cDNA clone (lambda MC-2) for contrapsin, a serine-proteinase inhibitor, was isolated from a lambda ZAP mouse liver cDNA library. The 1.6 kb cDNA insert of lambda MC-2 contained an open reading frame that encodes a 418-residue polypeptide (46,970 Da), in which a signal peptide of 21 residues was identified by comparison with the N-terminal sequence of the purified protein. The predicted structure (MC-2) also contained other peptide sequences determined by Edman degradation. Four potential sites for N-linked glycosylation were found in the molecule, accounting for the difference in molecular mass between the predicted form and the purified protein (63 kDa). Further screening of the cDNA library with an EcoRI-EcoRI fragment (510 bp) of lambda MC-2 as a probe yielded another cDNA clone (lambda MC-7), which encodes a 418-residue polypeptide (MC-7) with a calculated mass of 47,010 Da. MC-2 showed 83% similarity at the amino acid level to MC-7, in contrast with 44% similarity to alpha 1-proteinase inhibitor. The possible reactive site (P1-P'1) for serine proteinase is suggested to be Lys-Ala for MC-2 and Ser-Arg for MC-7. Northern-blot analysis revealed that both MC-2 and MC-7 mRNAs have the same size of 1.8 kb and are markedly induced in response to acute inflammation. Construction of the expression plasmids pSVMC-2 and pSVMC-7 and their transfection into COS-1 cells demonstrated that pSVMC-2 directs the synthesis of a 63 kDa form whereas pSVMC-7 expresses a 56 kDa form. The difference in molecular mass between the two may be explained by the fact that the MC-7 sequence contains three potential sites for N-glycosylation, one site less than that of MC-2.

Amino Acid Sequence↗
PubMed1991

Molecular cloning and expression of a new putative inositol 1,4,5-trisphosphate 3-kinase isoenzyme.

A human hippocampus cDNA library in lambda ZAP II was screened by hybridization with a rat brain inositol 1,4,5-trisphosphate (InsP3) 3-kinase cDNA. Two clones (hh6 and hh3) were isolated and sequenced. The insert of clone hh6 was shown to correspond to the 3' end of the coding sequence of 50,000-Mr InsP3 3-kinase (referred to as 3-kinase-A). Sequencing of the clone hh3 insert yielded an open reading frame encoding a 472-amino acid protein with a calculated Mr of 53,451 (referred to as 3-kinase-B). The C-terminal part of 3-kinase-B (residues 187-462) was 68% identical with 3-kinase-A in amino acid sequence. The cDNA of clone hh3 was rescued as a Bluescript plasmid and expressed in Escherichia coli as a beta-galactosidase fusion product. It showed InsP3 3-kinase activity that was stimulated in the presence of Ca2+/calmodulin (more than 7-fold in a crude bacterial lysate from expressed plasmid). Regeneration of InsP3 3-kinase activity after SDS/PAGE identified a major polypeptide (Mr 60,000-65,000). The Km for InsP3 of expressed 3-kinase-B was 1.6 microM. These data provide molecular evidence for the existence of InsP3 3-kinase isoenzymes.

Amino Acid Sequence↗
PubMed1993

Cloning and expression of human liver dehydroepiandrosterone sulphotransferase.

Dehydroepiandrosterone sulphotransferase (DHEA-ST) catalyses the 3'-phosphoadenosine 5'-phosphosulphate-dependent sulphation of a wide variety of steroids in human liver and adrenal tissue and is responsible for most, if not all, of the sulphation of bile acids in human liver. This report describes the isolation, characterization and expression of a cDNA which encodes human liver DHEA-ST. The DHEA-ST cDNA, designated DHEA-ST8, was isolated from a Uni-Zap XR human liver cDNA library and is composed of 1060 bp and contains an open reading frame encoding a 285-amino-acid protein with a molecular mass of approx. 33765 Da. Translation of DHEA-ST8 in vitro generated a protein identical in molecular size with that of DHEA-ST. Expression of DHEA-ST8 in COS-7 cells produces an active DHEA-ST protein which is capable of sulphating DHEA, has the same molecular mass as human liver DHEA-ST and is recognized by rabbit anti-(human liver DHEA-ST) antibodies. Northern-blot analysis of human liver RNA detects the presence of three different size transcripts; however, Southern-blot analysis of human DNA suggests that only one gene may be present in the genome. These results describe the cloning of a human ST which has an important role in the sulphation of steroids and bile acids in human liver and adrenals.

Amino Acid Sequence↗
PubMed1993

Cloning of the gene for glutamate decarboxylase and its expression during conidiation in Neurospora crassa.

Neurospora crassa glutamate decarboxylase (GAD) is produced during conidiation and stored in dormant conidia. Polyclonal antibody was generated to GAD that had been purified to homogeneity. The anti-GAD antibody was specific for N. crassa GAD and inhibited GAD activity. The level of GAD protein decreased during conidial germination, indicating that GAD was degraded during this phase of development. The anti-GAD antibody was used to isolate a cDNA clone of GAD from a lambda ZAP cDNA expression library. Escherichia coli containing a plasmid with the cDNA insert produced GAD activity. The cDNA clone contained a 2.6 kbp insert and hybridized to a 2.6 kb mRNA species from conidiating cultures of N. crassa. GAD mRNA was not present in vegetative hyphae. In conidiating cultures, GAD mRNA was first detected when conidia began to appear. The level of GAD mRNA increased as conidiation progressed. This is the first example of the cloning of an enzyme that is regulated at the level of mRNA during the asexual developmental cycle of N. crassa.

Antibodies↗
PubMed1993

Molecular cloning and sequence analysis of the cDNA for ancrod, a thrombin-like enzyme from the venom of Calloselasma rhodostoma.

The 1.54 kb cDNA for ancrod, a thrombin-like enzyme, was cloned from a lambda ZAP cDNA library derived from the venom glands of Calloselasma (Agkistrodon) rhodostoma. The cDNA sequence reveals that ancrod is synthesized as a pre-zymogen of 258 amino acids, including a putative secretory peptide of 18 amino acids and a proposed zymogen peptide of 6 amino-acid residues. The amino-acid sequence of the predicted active form of the enzyme exhibits a high degree of sequence similarity to those of mammalian serine proteases (trypsin and pancreatic kallikrein) and other thrombin-like enzymes (batroxobin and flavoxobin). Key amino-acid residues (His43, Asp88, Ser182 and Asp176) that are thought to be involved in the substrate cleavage and in the substrate-binding reaction are conserved. Ancrod contains 13 cysteine residues. Based on alignment with the amino-acid sequences of trypsin and batroxobin, six disulphide bridges can be predicted to be present in the ancrod protein. The existence of a free cysteine, which changes the common sequence surrounding the Ser182 active site from Gly-Asp-Ser-Gly-Gly-Pro to Cys-Asp-Ser-Gly-Gly-Pro, is unusual for a serine protease.

Amino Acid Sequence↗
PubMed1993

Suggestive evidence for two different mucin genes in rat intestine.

In the present report we describe the isolation and sequence of a partial cDNA (M2-798) for a rat intestinal mucin designated M2. A rat intestinal lambda ZAP II cDNA library was screened using a polyclonal antiserum which was prepared against deglycosylated high-molecular-mass glycopeptides of the purified mucin. Mucin cDNA clones were found to contain tandem repeats of 18 nt which encoded a threonine- and proline-rich peptide having a consensus sequence of TTTPDV. This is the same sequence reported recently by Gum, Hicks, Lagace, Byrd, Toribara, Siddiki, Fearney, Lamport and Kim [(1991) J. Biol. Chem. 266, 22733-22738] for a rat intestinal cDNA called RMUC 176. A novel feature present in the cDNA M2-798 is a 246 nt unique region at the 3' end which encodes a hydrophobic sequence of 82 amino acids. RNA blots probed with M2-798 cDNA produced a single hybridization band between 7.5 and 9.0 kb in rat small intestine and colon. An identical hybridization pattern was obtained with a PCR-generated cDNA probe corresponding solely to the unique hydrophobic region of M2-798, demonstrating that this region is encoded by the authentic M2 mRNA. Our data suggest that the unique region of M2 has the potential to be either a transmembrane region, or a domain which mediates hydrophobic interactions of the mucin with other molecules. Since we have previously reported another rat intestinal cDNA which encodes the C-terminus of a mucin-like peptide (MLP) [Xu, Wang, Huan, Cutz, Forstner and Forstner (1992) Biochem. J. 286, 335-338], we wished to discover whether M2 was encoded by the same gene. RNA blotting experiments with probes specific for M2 and MLP showed different mRNAs for each. The message for M2 (7.5-8.5 kb) was smaller than that for MLP (> 9.5 kb) and, unlike MLP, gave no signal in human colonic LS174T cells. The results of DNA blots probed with M2-798 and an MLP-probe suggest that M2 and MLP are likely to be single-copy genes. It would appear therefore that normal rat intestine, like human intestine, may express two different mucin genes.

Animals↗
PubMed1994

Molecular cloning of cDNA for rat ovarian 20 alpha-hydroxysteroid dehydrogenase (HSD1).

20 alpha-Hydroxysteroid dehydrogenase (20 alpha-HSD, EC 1.1.1.149) catalyses the conversion of progesterone into 20 alpha-dihydroprogesterone (20 alpha-OHP). Previously, we purified the enzyme (37 kDa) from rat ovary and determined its N-terminal amino acid sequence. In the present study we succeeded in cloning a full-length 20 alpha-HSD cDNA. mRNA was extracted from immature rat ovaries after successive treatment with equine chorionic gonadotropin (eCG) and human chorionic gonadotropin (hCG). A cDNA library was constructed in lambda ZAP. For screening, a 576 bp probe was amplified by the PCR using mixed primers based on the N-terminal sequence of 20 alpha-HSD, and labelled with [32P]dCTP. Eight positive clones were isolated from 1.2 x 10(4) recombinants. Analysis of the nucleotide sequence revealed that one clone of 1.2 kbp cDNA (pHSD12-07) contained a polyadenylation site and an open reading frame encoding 323 amino acids with the N-terminal sequence of 20 alpha-HSD. The fusion protein of pHSD12-07 produced by Escherichia coli reacted with a specific polyclonal antibody generated against rat ovarian 20 alpha-HSD. In addition, the in vitro transcription-translation product produced by Xenopus oocytes showed 20 alpha-HSD activity and Northern-blotting analysis revealed that the ovaries from normal adult rats contained a 1.2 kb mRNA. Thus we succeeded in isolating a clone encoding the full length of rat ovarian 20 alpha-HSD. The sequence showed high similarity with those of rat liver 3 alpha-hydroxysteroid dehydrogenase (3 alpha-HSD), bovine lung prostaglandin F synthase (PGFS), human liver chlordecone reductase (CDR), frog lens rho-crystallin and aldose reductases, indicating that 20 alpha-HSD belongs to the aldo-keto reductase family.

20-Hydroxysteroid Dehydrogenases↗
PubMed1994

A novel human airway mucin cDNA encodes a protein with unique tandem-repeat organization.

Highly specific affinity-purified polyclonal antibodies against deglycosylated human tracheobronchial mucin was used to select immunoreactive clones from a Uni-ZAP cDNA expression library prepared from normal human tracheal mRNA. The largest of three positive clones, designated pAM1, which reacted strongly with the polyclonal antibodies, was further characterized. Sequence analyses revealed a partial 941 bp cDNA that encoded a 313-amino-acid polypeptide. Bases 3-892 consisted of imperfect 41-nucleotide tandem repeats (CCAGGAGGGGACACCGGGTTCACGAGCTGCCCACGCCCTCT) that encoded a unique polypeptide with two types of consensus repeats, TSCPRPLQEGTRV and TSCPRPLQEGTPGSRAAHALSRRGHRVHELPTSSPGGDTGF. The overall composition of the deduced amino acid sequence matched that expected for a mucin protein core and is rich in serine, threonine, proline, glycine and alanine (approximately 51%). Northern blots probed with the mucin cDNA exhibited intense polydisperse hybridization bands with RNA isolated from normal human trachea and cystic-fibrosis bronchus. The data indicate that mucin encoded by clone pAM1 represents a unique type of peptide organization which has not been described in mucin cDNAs reported thus far.

Amino Acid Sequence↗
PubMed1994

Regulation of T-cell-receptor-stimulated bivalent-cation entry in Jurkat E6 cells: role of protein kinase C.

Stimulation of Jurkat E6 cells with anti-CD3 antibody results in a characteristic rise in [Ca2+]i which is due to both the release of Ca2+ from intracellular stores and the entry of external Ca2+. Individual components of the [Ca2+]i increase were investigated by measuring intracellular Ca2+ release in the absence of external Ca2+ and determining influx of bivalent cations by following the entry of Mn2+. The increase in [Ca2+]i induced by anti-CD3 antibody in the presence or absence of extracellular Ca2+ could be inhibited by the non-selective kinase inhibitor staurosporine, which also inhibits anti-CD3-stimulated phospholipase C activity. Staurosporine also inhibits the influx of bivalent cations induced by anti-CD3 antibody, but not that induced by depletion of intracellular Ca2+ stores using thapsigargin. The effect of staurosporine was compared with that of Ro 31-8425, a potent and selective inhibitor of protein kinase C (PKC). Ro 31-8425, at concentrations up to 10 microM, has no inhibitory effect on the anti-CD3 antibody-induced [Ca2+]i increase or phospholipase C activity. These studies are consistent with the concept that augmentation of [Ca2+]i by stimulated T-cell receptors requires activation of a kinase, probably a tyrosine kinase such as p56lck, ZAP-70 or p59fyn, and is independent of PKC. Phorbol esters inhibit the anti-CD3-stimulated [Ca2+]i increase and phospholipase C activity, showing that this can be negatively regulated by PKC. A small potentiation of the anti-CD3 antibody-induced [Ca2+]i rise in the presence of extracellular Ca2+ was detected in the presence of Ro 31-8425; this suggests that T-cell-receptor ligation can also limit the increase in [Ca2+]i via PKC activation.

Alkaloids↗
PubMed1996

Differential expression of fibromodulin mRNA associated with tendon fibril growth: isolation and characterization of a chicken fibromodulin cDNA.

A 450 bp cDNA fragment similar to that encoding bovine fibromodulin was isolated using a screening procedure to isolate genes differentially expressed between the pre- and post-growth phases of fibril growth in the developing chicken embryo metatarsal tendon. Using this fragment, a 2.4 kb cDNA clone for chicken fibromodulin was isolated from a lambda ZAP library, and the 5' rapid amplification of cDNA ends technique was employed to clone the 5'end of the fibromodulin cDNA. The full-length cDNA contained an open reading frame coding for a 380-amino-acid protein. There was approximately 80% similarity with human, rat and bovine fibromodulins, which confirmed its identity as fibromodulin. Structural features of the deduced sequence include an 18-amino-acid signal peptide, cysteine residues in conserved positions in the N- and C-terminal regions, and a central leucine-rich domain containing eleven repeats of the sequence LXXLXLXXNXL/I. Features unique to chicken fibromodulin include an additional glycosylation site as well as a decreased number of tyrosine residues that could be sulphated, and therefore potential changes in the charge of the molecule. In addition, there was little similarity among the untranslated regions. When compared with chicken decorin and lumican, fibromodulin showed greater similarity to the other keratan sulphate-containing proteoglycan, lumican. Northern blot analysis revealed a 6-8-fold increase in the fibromodulin mRNA level from day 14 to day 19 of development. In the chicken tendon, collagen fibril growth is a process characterized by a precipitous increase in length during a short developmental period. The necessary changes would require the expression of different genes regulating fibril formation and growth, and interactions between fibromodulin and collagen fibrils may participate in the regulation of collagen fibril growth and matrix assembly.

Amino Acid Sequence↗
PubMed1997

Rat hepatic glutaminase: identification of the full coding sequence and characterization of a functional promoter.

Glutamine catabolism in mammalian liver is catalysed by a unique isoenzyme of phosphate-activated glutaminase. The full coding and 5' untranslated sequence for rat hepatic glutaminase was isolated by screening lambda ZAP cDNA libraries and a Charon 4a rat genomic library. The sequence produces a mRNA 2225 nt in length, encoding a polypeptide of 535 amino acid residues with a calculated molecular mass of 59.2 kDa. The deduced amino acid sequence of rat liver glutaminase shows 86% similarity to that of rat kidney glutaminase and 65% similarity to a putative glutaminase from Caenorhabditis elegans. A genomic clone to rat liver glutaminase was isolated that contains 3.5 kb of the gene and 7.5 kb of the 5' flanking region. The 1 kb immediately upstream of the hepatic glutaminase gene (from -1022 to +48) showed functional promoter activity in HepG2 hepatoma cells. This promoter region did not respond to treatment with cAMP, but was highly responsive (10-fold stimulation) to the synthetic glucocorticoid dexamethasone. Subsequent 5' deletion analysis indicated that the promoter region between -103 and +48 was sufficient for basal promoter activity. This region does not contain an identifiable TATA element, indicating that transcription of the glutaminase gene is driven by a TATA-less promoter. The region responsive to glucocorticoids was mapped to -252 to -103 relative to the transcription start site.

Amino Acid Sequence↗