Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “LEPTOSPIRA INFECTIONS”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,027 records · Page 57Linked to original sources
PubMed2001

Serum and vitreous humor antibody titers in and isolation of Leptospira interrogans from horses with recurrent uveitis.

OBJECTIVE: To measure antibody titers against Leptospira interrogans in serum and vitreous humor and determine the prevalence of L interrogans in vitreous humor of horses with recurrent uveitis. DESIGN: Cross-sectional study. ANIMALS: 242 horses (270 eyes) with recurrent uveitis undergoing vitrectomy and 39 control horses (54 eyes) without any history or clinical signs of recurrent uveitis undergoing euthanasia or enucleation for unrelated reasons. PROCEDURE: Serum and vitreous humor were tested for antibodies against 13 serovars of L interrogans. Vitreous humor was submitted for leptospiral culture; isolates were typed to the serogroup level. RESULTS: Leptospira interrogans was isolated from vitreous humor from 120/229 (52%) horses (126/252 [50%] eyes) with recurrent uveitis but was not isolated from vitreous humor from 36 eyes of 21 control horses. Duration of recurrent uveitis was > or = 1 year for 45 of the 120 (38%) horses from which the organism was isolated. Geometric mean antibody titers against L interrogans in the vitreous humor and serum of horses with recurrent uveitis were 1:1,332 and 1:186, respectively. Only 91 of 120 (76%) horses from which the organism was isolated had a 4-fold or greater difference between serum and vitreous humor antibody titers. CONCLUSIONS AND CLINICAL RELEVANCE: Results suggest that persistent ocular infection with L interrogans is common in horses with recurrent uveitis. A 4-fold increase in vitreous humor versus serum antibody titers may not be a sensitive test for the diagnosis of L interrogans-induced recurrent uveitis. We hypothesize that the immune component of recurrent uveitis can be directly induced and maintained by persistent infection of the eye with L interrogans.

Animals↗
PubMed1980

Immunogenicity of boiled compared with formalized leptospiral vaccines in rabbits, hamsters and humans.

Leptospires (Leptospira interrogans serovar pomona) grown in chemically defined medium were immunogenic when given intradermally in humans if the leptospires were killed with formalin but not if they were boiled. Boiled leptospires were immunogenic for rabbits and hamsters and protected hamsters from challenge infection. On the other hand, boiled leptospires of the biflexa complex, serovar patoc, did retain some immunogenicity in humans, but the antisera did not protect hamsters against challenge with serovar pomona.

Agglutination Tests↗
PubMed1997

Leptospirosis in brushtail possums: is Leptospira interrogans serovar balcanica environmentally transmitted?

In New Zealand, the biological control of introduced brushtail possums (Trichosurus vulpecula) may be the only affordable option for achieving a significant long term reduction in pest numbers on a national scale. Leptospira interrogans serovar balcanica is among the potential biocontrol agents and vectors currently being investigated for this purpose. As the transmission pathways of L. interrogans serovar balcanica between possums are poorly understood, the objective of the study was to determine whether infection could result from exposure to contaminated environments. Sixteen individually housed, uninfected possums, in three groups, were regularly exposed over a period of 32 days to contaminated cages or grass enclosures of 16 other experimentally infected possums all shedding leptospires in their urine. None of the 16 challenged possums developed serological evidence of L. interrogans serovar balcancia infection. These results suggest that this organism is unlikely to be transmitted environmentally, supporting previous circumstantial evidence that social contact may be required for transmission of L. interrogans serovar balcanica between possums.

Animals↗
PubMed1993

[Amplified 23S rRNA gene of 52 strains of Leptospira and detection of leptospiral DNA in 55 patients by PCR].

Based upon the polymerase chain reaction (PCR), We have developed a sensitive assay for Leptospira interrogans, the agent of leptospirosis. DNA amplification was carried out using primer A: 5'GATCTAATTCGCTGTAGCAGG3' and primer B: 5'ACTTTCACCCTCTATGGTCGG3'. After 30 cycles of amplification, the product could be detected by agarose gel electrophoresis. A segment (124 bp) was amplified in all strains of L. interrogans including 20 Serogroups, 49 Serovars tested, but it was not detected in Patoc I strain, Serovar patoc of Leptospira biflexa and 3055 strain of Leptonema illini (both of which are nonpathogenic). All of the serum (first time) which proved either by blood culture or MAT showed that positive rates were 100%. Leptospiral infection in humans and some domestic animals leads to one or more of a variety of manifestation and persists through a considerable duration of time. However it is relatively difficult to demonstrate the presence of leptospires in serum. The serum (second time) obtained from 55 patients with leptospirosis (6-60 days after on set) showed that PCR positive rates were 74.55% (41/55). The PCR positive rates for healthy subjects were 15% (3/20), P < 0.001. The diagnosis of leptospirosis by using PCR may become a significant addition to the routine laboratory diagnosis and a valuable technique for the investigation of leptospirosis pathogenesis.

Base Sequence↗
PubMed1990

[A case of Akiyami C disease, infected in the area of Yoshino].

A 47-year-old male was admitted because of persistent jaundice. Akiyami C disease was diagnosed by serological tests using the microscopic agglutination tests. The source was considered to be a water contaminated with leptospiras which he had drunk while working at a civil engineering job. The reported cases of Akiyami C disease have recently decreased and this is the 6th case reported in the last 15 years.

Antibodies, Bacterial↗
PubMed1991

Seroepidemiology of leptospirosis in Minnesota wolves.

Serum samples (n = 457) from wolves (Canis lupus) in northern Minnesota were collected from 1972 through 1986 and were tested for antibodies against Leptospira interrogans using a microtiter agglutination test. Twelve serovars included in the study were: australis, autumnalis, ballum, bataviae, bratislava, canicola, copenhageni, grippotyphosa, hardjo, pomona, pyrogenes, and tarassovi. Fifty-two (11%) sera had antibody titers of greater than or equal to 1:50 against one or more serovars of L. interrogans. The seroprevalence of different serovars in decreasing order was: grippotyphosa, bratislava, autumnalis, canicola, pomona, ballum, pyrogenes, hardjo, and copenhageni. No antibodies were found against australis, bataviae, and tarassovi. These results indicate that L. interrogans infection may occur in wolves of Minnesota.

Agglutination Tests↗
PubMed1979

Bovine mycotic abortion caused by Acremonium kiliense Grutz.

Acremonium kiliense was cultured from the placenta and abomasal contents of an aborted bovine foetus; attempts to isolate viruses and bacteria were unsuccessful although the serum of the dam contained antibodies to Leptospira pomona. The fungus was nonpathogenic for mice but was able to survive in murine tissues for at least 13 weeks. The possibility of this case being a foetal infection as a result of insemination with contaminated semen is discussed.

Abomasum↗
PubMed1998

Risk factors in the transmission of leptospiral infection.

An unmatched case control study was conducted to study the various risk factors for acquiring leptospiral infection in Diglipur tehsil of North Andaman. A random sample of 1014 persons residing in various villages of Diglipur was inducted into the study. Serum samples were collected from them and tested for anti-leptospiral antibodies using microscopic agglutination test (MAT) using Leptospira grippotyphosa, L. australis, L. canicola and L. icterohaemorrhagiae antigens. Persons with a titre of 1:50 or more were considered as the cases (550) and the seronegatives as controls (464). Information about 30 variables relating to household characteristics, occupation, contact with animals and behavioural factors was collected by interviewing the subjects. The prevalences of these variables in both the groups were calculated and the odds ratio with 95 per cent confidence intervals were computed. The seroprevalence rate was found to increase linearly with age and it was significantly higher in males. None of the risk factors studied had any association with seropositivity to serovar L. icterohaemorrhagiae. For the other serovars, some form of recent exposure to outdoor environment had significant association. Other factors which had association with infection with specific serovars included use of well or stream water and presence of dogs in the house for infection with L. grippotyphosa, farming families and presence of cattle in the houses for infection with L. australis and the habit of bathing in ponds for infection with L. canicola. These observed associations can be taken as clues of the transmission cycles and would help in guiding further investigations for understanding the epidemiology of leptospirosis in these islands.

Age Factors↗
PubMed1993

The association between antibody titres against Campylobacter fetus and milk production efficiency in dairy cattle.

The association between serological evidence of exposure to Campylobacter fetus and milk production performance was studied in 178 lactating cows from three California Dairy Herd Improvement Association herds using a cross-sectional study design in December 1986. ELISAs were used to determine the antibody titres against Campylobacter fetus, Haemophilus somnus and Leptospira hardjo, which were classified as either negative or positive. The status of a cow as negative or positive against C. fetus and H. somnus represents the serological evidence of natural exposure to the corresponding bacteria. However, the status against L. hardjo was assumed to be the level of vaccinal titre against this organism since all the cows studied had been vaccinated against this agent. The data on demographic and productivity variables relating to the current lactation of the cows were obtained from Dairy Herd Improvement Association individual cow records for December 1986. Four measures of milk production efficiency for the current lactation were used. The status against L. hardjo and other covariates suggested by previous studies were included in modelling the relationships of interest. Stepwise multiple linear regression was used to study the adjusted relationship of C. fetus with each measure of milk production efficiency. Multivariate analyses revealed that the adjusted relationships of C. fetus with the test-day's milk production, the extended 305-day milk production and the relative value of milk production were not significant (p > 0.1). However, after adjusting for possible covariates, C. fetus-positive cows had an average of 7.43% lower mature equivalent milk production than C. fetus-negative cows (p = 0.02).(ABSTRACT TRUNCATED AT 250 WORDS)

Animals↗
PubMed2000

Epidemiological trend of human leptospirosis in Italy between 1994 and 1996.

In the three-year period 1994 1996, 222 reports on human cases of leptospirosis were received by the Italian Ministry of Health. The average annual number of reports was 29.2% lower than in the preceding eight years. In all cases but two the infections were thought to have been acquired in Italy. As in previous years, the majority of cases was observed in the northern regions of the country (83.8%), mostly in males (88.9%). Cases occurred in all age groups, but were more common in the working-age population (15-64 years). There was no common-source outbreaks. The typical leptospiral seasonal course, with a peak in August, was observed. During 1994, leptospirosis was the reported cause of death in 19 patients. Mortality was higher among males than females. The overall fatality rate was 22.6%. During the study period, a total of 126 cases of leptospirosis were confirmed by the National Centre for Leptospirosis or one of the 12 Regional Leptospira Laboratories. Of the 103 patients for whom information on place of residence, contact with animals, occupational and recreational activities was available, 98 (95.1%) were people who live in rural areas or devote themselves to occupational or recreational activities at risk. The likely source of infection and the mode of exposure were known for 55 patients. Forty-five patients (81.8%) were likely infected by contaminating water (43 cases) or soil (2 cases), ten (18.2%) by direct contact with animals or animal urine. Both running (51.2%) and stagnant water (27.9%) have been reported as a source of infection. Rodents were implicated in 50.0% of the 10 cases involving animals. In comparison with the preceding eight-year period, the risk of contracting leptospirosis was found to have increased for recreational activities (from 34.7 to 38.2%) and decreased for occupational activities (from 45.8 to 32.7%). A large number of infections, however, was ascribed to accidental events (25.5%). As in the previous period, besides fever, the involvement of the liver was the most frequent clinical manifestation (70.8%). Influenza-like symptoms were the only signs of illness in 15.1% of cases. Infections by 9 different serogroups were detected. The most frequent antibodies were those against serovars icterohaemorrhagiae, poi, copenhageni and brattislava. The presence of co-agglutinins against serovars belonging to different serogroups prevented the identification of the presumptive infecting serogroup in 19.8% of subjects.

Adolescent↗
PubMed1987

A comparison of live and formalised leptospiral microscopic agglutination test.

The sensitivity and reliability of a formalised leptospiral antigen battery was compared with a smaller battery of live leptospiral antigens with 152 human sera positive for leptospirosis. There was good concurrence of results between the formalised and live antigens, however the live battery did fail to detect some positive sera where the antibody level was low. The formalised antigens were more sensitive than the live (P less than 0.001) and more reliable in the detection of early leptospiral infection, but the live antigens were more specific in the determination of probable infecting serogroup.

Agglutination Tests↗
PubMed1979

A sero-epidemiological study of Leptospira interrogans serovar Balcanica in four brush-tailed possum populations in Victoria, Australia.

The microscopic agglutination (MA) test was utilised to study the prevalence of antibodies to Leptospira interrogans serovar hardjo in 4 populations of brush-tailed possums (Trichosurus vulpecula). The overall antibody prevalence varied from 14% to 66%; however, the age distribution of MA test titres was remarkably similar in all 4 populations. Antibody prevalence was similar in both males and females and demonstrable antibodies were limited to sexually mature animals. The greater prevalence of high titres (greater than or equal to 1:128) in the 18- to 24-month age group suggested that primary infections were acquired at this age. The findings suggested that infection was maintained in possum populations by direct transmission, probably associated with breeding. Focal interstitial nephritis was observed in kidneys of possums greater than 18 months of age and was associated with MA titres to hardjo (P less than 0.001). Serovar balcanica was isolated from possum kidneys from 2 of these populations, suggesting that balcanica infections were responsible for most of the hardjo titres. However, agglutinin-absorption tests indicated that some possums may be infected with a leptospire more closely related to hardjo than to balcanica.

Age Factors↗
PubMed1991

Differential susceptibility of two stocks of Mongolian gerbils (Meriones unguiculatus) to Leptospira.

Mongolian gerbils (Meriones unguiculatus) of Tumble Blook (TUM) and Japan Medical Science (JMS) stocks were compared with regard to susceptibility to Leptospira interrogans serovar copenhageni. The TUM gerbil died 6 to 9 d after intraperitoneal inoculation with 10 organisms, showing jaundice and systemic hemorrhage. However, 25% of the JMS gerbils survived infection with 10(3) or 10(4) organisms and there was no fatal case after infection with 10(2) organisms.

Animals↗
PubMed1979

A study of leptospirosis among animals in Barbados W.I.

Microscopic agglutination tests performed during 1971 and 1972 on Barbadian livestock showed positive serological reactions for leptospirosis as follows: cattle 51%, pigs 13%, sheep 18%, horses 64% and goats 19%. The serogroup Autumnalis predominated in all but horses in which the reactions to the Pyrogenes group appeared slightly higher. After the isolation of a strain of Leptospira serotype fort-bragg (Barbadian strain No. 119) of the Autumnalis serogroup in 1973, and its subsequent inclusion in our test battery of leptospiral antigens, high percentages of cattle, dogs, mongooses and man showed sero-positive reactions against the strain. Attention is called to the wide dissemination of the fort-bragg serotype on the island and to the role of rodents and the mongoose in its spread. 74 clinically affected Barbadian cattle from three herds were studied during 1975-76; 60 (81%) were serologically positive and nine different serogroups were represented. Predominant sero-positive reactions to Hebdomadis, Autumnalis, Ballum and Pyrogenes antigens were recorded. The highest titres were against Autumnalis, Hebdomadis and Pomona. Hebdomadis and Pomona serogroup antibodies may be due to many importations of cattle with those infections into Barbados.

Agglutination Tests↗
PubMed1999

Infertility and abortion among first-lactation dairy cows seropositive or seronegative for Leptospira interrogans serovar hardjo.

OBJECTIVE: To estimate the extent to which exposure to Leptospira hardjo before or at the time of first parturition was associated with infertility and abortion during the first lactation among dairy cows that had not been vaccinated for > or = 12 months. ANIMALS: 207 first-lactation cows from a herd of 2,000 lactating cows. PROCEDURE: Cows were tested for antibodies to L hardjo within 40 days after calving. Time from calving to first breeding, time from calving to conception, number of breedings per conception, and risk of abortion were compared between cows seropositive for L hardjo and cows that were seronegative. RESULTS: For the 9 (4.3%) cows that were seropositive for L hardjo, median time from calving to conception (132.6 days) was significantly longer than time for seronegative cows (95.4 days). Cows that were seropositive were twice as likely (relative risk, 2.07) to fail to conceive as seronegative cows. Mean number of breedings required per conception for seropositive cows (3.4) was significantly higher than that for seronegative cows (2.1). The proportion of seropositive cows that aborted was not significantly different from the proportion of seronegative cows that aborted. CONCLUSIONS AND CLINICAL RELEVANCE: Exposure of nonvaccinated dairy cows to L hardjo can be associated with a subsequent reduction in fertility, as indicated by a greater time from calving to conception and higher number of breedings required per conception. The efficacy of leptospiral vaccines should be assessed to determine whether vaccination will minimize herd infertility associated with L hardjo infection.

Abortion, Veterinary↗
PubMed1975

Pathogenic leptospiras isolated from Malaysian surface waters.

Pathogenic leptospiras (1,424) isolated from natural waters and wet soils in Malaysia comprised 29 different serovars (synonym serotypes). All except two of the serovars had been found previously in Malaysia. The exceptional serovars were werrasingha, an Autumnalis serogroup member originally isolated in Ceylon, and a new serovar designated evansi. Serovar evansi had serological affinities with serovar ranarum which was isolated from the kidney of a frog in Iowa. The large variety of serovars found in jungle areas was consistent with similar previous findings of diverse serovar infections in troops who had operated in Malaysian jungles.

Agglutination Tests↗