Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “thyroid hormones”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,009 records · Page 56Linked to original sources
PubMed2001

Suppression of the deafness and thyroid dysfunction in Thrb-null mice by an independent mutation in the Thra thyroid hormone receptor alpha gene.

Deletion of thyroid hormone receptor beta (TR beta), a ligand-dependent transcription factor encoded by the Thrb gene, causes deafness and thyroid hyperactivity in Thrb-null (Thrb(tm1/tm1)) mice and in a recessive form of the human syndrome of resistance to thyroid hormone. Here, we have determined that a targeted mutation (Thra(tm2)) in the related Thra gene, encoding thyroid hormone receptor alpha suppresses these phenotypes in mice. Thra encodes a TR alpha 1 receptor which is non-essential for hearing and a TR alpha 2 splice variant of unknown function that neither binds thyroid hormone nor transactivates. The Thra(tm2) mutation deletes TR alpha 2 and concomitantly causes overexpression of TR alpha 1 as a consequence of the exon structure of the gene. Thra(tm2/tm2) mice have normal auditory thresholds indicating that TR alpha 2 is dispensable for hearing, and have only marginally reduced thyroid activity. However, a potent function for the Thra(tm2) allele is revealed upon its introduction into Thrb(tm1/tm1) mice, where it suppresses the auditory and thyroid phenotypes caused by loss of TR beta. These findings reveal a novel modifying function for a Thra allele and suggest that increased expression of TR alpha 1 may substitute for the absence of TR beta. The TR isotypes generated by the distinct Thrb and Thra genes represent a small family of receptors that have diverged to mediate different physiological roles; however, the ability of changes in Thra expression to compensate for loss of Thrb indicates that many functions of these genes remain closely related.

Animals↗
PubMedDate not supplied

Thyroid hormones and illness.

OBJECTIVE: To review illness-associated changes in thyroid hormone levels with respect to the alterations in metabolism, regulation, and transport of thyroid hormones present in such a setting. METHODS: We summarize normal pituitary-thyroid function and categorize the types of changes that have been noted during illness. In addition, we examine studies that have addressed the metabolic status of patients with low thyroid hormone levels and the potential utility of thyroid hormone treatment in severely ill patients. RESULTS: The finding of altered thyroid hormone levels in hospitalized patients confirms the participation of these factors in the adaptive response to illness. Thyroid hormone alterations that occur during illness can be classified into three categories: (1) decreased production of triiodothyronine, (2) decreased serum binding of thyroid hormones, and (3) decreased secretion of thyrotropin. Study of these hormonal changes has provided insight into normal thyroid hormone regulation and metabolism as well as into neuroendocrine adaptations to illness. CONCLUSION: It seems reasonable to conclude that illness-associated changes in thyroid hormone levels are generally beneficial to the patient as a whole; however, the possibility of concomitant regional or individual tissue hypothyroidism exists. Conclusions about the potential utility of pharmacologic administration of triiodothyronine in selected diseases and clinical settings must await additional clinical trials. Finally, the predictable occurrence of altered thyroid hormone levels in hospitalized patients necessitates caution in both the selection and the interpretation of thyroid hormone tests in this patient population.

Journal Article↗
PubMed1985

Free thyroid hormone levels and TSH response to TRH in patients with autonomous thyroid adenomata and normal T3 and T4.

Free thyroid hormone levels together with basal and TRH stimulated TSH levels, have been determined in 50 patients with autonomous thyroid adenomata, who had normal serum total T3 and T4 values. Similar measurements were made in 33 healthy subjects. FT3 and FT4 plasma levels were significantly higher (P less than 0.01 and P less than 0.05 respectively), and basal and TRH stimulated TSH were significantly lower (P less than 0.05 and P less than 0.001 respectively) in the patients than in the controls. The TSH response to TRH was decreased in spite of normal free thyroid hormones in 25 patients and in a further ten both the delta TSH after TRH and the free fractions were normal. Eighteen patients were studied over periods from 4 37 months by repeating thyroid hormone levels and TRH tests. In six of them a change of these parameters toward toxicity was observed. The data obtained in the longitudinal study indicate that the values of free thyroid hormones and the result of the TRH test obtained by a single determination may represent different steps in the evolution of autonomous thyroid adenomata rather than a distinct pathophysiological condition.

Adenoma↗
PubMed1991

[Pathology of thyroid hormone receptors].

The syndrome of resistance to thyroid hormones may affect overall or only some tissues. The generalized resistance associates a familial eu or hypometabolic goiter, increased free thyroid hormones with normal or elevated plasma TSH levels. The inheritance of the disease is autosomal dominant in most of the patients. In vivo or in vitro tests may be used to assess the diagnosis. Therapy refers to high doses of T3 or T4. Pituitary resistance to thyroid hormones leads to hyperthyroidism with normal or high TSH levels. The treatment uses different TSH suppressive drugs. Peripheral resistance associates hypometabolism with normal T4-T3 secretion and needs high T3 doses for therapy. An inherited abnormality of T3 nuclear receptor seems to be the consequence of a mutant gene. Hypersensitivity to thyroid hormones associates hypermetabolism with low or normal free thyroid hormone levels and increased T3 nuclear receptors.

Drug Resistance↗
PubMed1993

AP-1 antagonizes thyroid hormone receptor action on the thyrotropin beta-subunit gene.

Thyrotropin-releasing hormone (TRH) stimulates and thyroid hormone (T3) inhibits transcription of the thyrotropin beta-subunit gene (TSH-beta). The first exon contains DNA sequences necessary for both responses and binds both AP-1 and thyroid hormone receptor (T3R). T3 did not inhibit TSH-beta gene expression in a T3R-deficient cell line. Transfection of a T3R expression vector, however, resulted in a 70% inhibition of expression by T3, which was abolished by cotransfection of c-jun and c-fos expression vectors. Mutations surrounding the transcription initiation site and DNA binding studies demonstrate both a functional and structural interaction between c-jun and T3R. Thus, TRH, acting through AP-1, may alter the set point and magnitude of thyroid hormone negative feedback of the TSH-beta gene through an interaction between AP-1 and T3R. Other regulatory pathways acting through AP-1 may alter thyroid hormone action in man.

Animals↗
PubMed1987

Fetal and maternal thyroid hormones.

It is well known that insufficient production of thyroid hormones during the fetal and neonatal period of development may result in permanent brain damage unless treatment with thyroid hormone is instituted very soon after birth. But congenital hypothyroidism is not the only situation in which brain damage may be related to insufficient thyroid function. Cretinism is the most severe manifestation of iodine deficiency disorders found in areas where iodine intake is greatly reduced. Some of the manifestations of cretinism suggest that the insult to the developing brain starts earlier than in the case of congenital hypothyroidism. Hypothyroxinemia of mothers with adequate iodine intake may also leave permanent, though less severe, mental retardation. For these reasons the possible role of maternal transfer of thyroid hormones during early fetal development have been reinvestigated, using the rat to obtain various experimental models. It has been shown that thyroid hormones are found in embryonic tissues before onset of fetal thyroid function and that thyroidectomy of the mother results in delayed development of the concepta. The concentrations of T4 and T3 in embryonic tissues from thyroidectomized dams were undetectable before the onset of fetal thyroid function, and still reduced in some tissues near term, despite the onset of fetal thyroid function. Treatment of control and thyroidectomized dams with methyl-mercaptoimidazole to block fetal thyroid function reduced thyroid hormone concentrations in fetal tissues near term, but this decrease could be partially avoided by infusion of physiological doses of thyroxine to the mothers. Iodine deficiency of the mothers resulted in thyroid hormone deficiency of the developing embryo, which was very marked until term in all tissues including the brain. The results strongly support a role of maternal thyroid hormones in fetal thyroid hormone economy both before and after the onset of the fetal thyroid function, at least in the rat. They also support a role of the hypothyroxinemia of iodine-deficient mothers in initiating the brain damage of the endemic cretin, a damage which would not be corrected once the fetal thyroid becomes active, as iodine-deficiency of the fetus would impair adequate production of hormones by its own thyroid, and maternal transfer would continue to be low.

Congenital Hypothyroidism↗
PubMed1994

Modulation of renal EGF in dichromate-induced acute renal failure treated with thyroid hormone.

Administration of either thyroid hormone or epidermal growth factor (EGF) ameliorates injury in a variety of experimental acute renal failure (ARF) models. Since thyroid hormone augments EGF release and EGF receptor expression, a hypothesis suggesting that the mechanism of thyroid action is via EGF appears attractive. The present study is an attempt to evaluate the role of EGF in thyroid mediated protection from ARF induced in rats by dichromate. Renal parenchymal levels of acid extractable endogenous EGF were measured by RIA in dichromate exposed, otherwise untreated animals and in those receiving dichromate followed by thyroid. In the untreated case serum creatinine peaked at 2.5 mg % on the third day following dichromate exposure. Endogenous levels of EGF closely paralleled serum creatinine with a six-fold increase observed at peak injury. The source of EGF increase appeared to be a membrane bound precursor as soluble levels of EGF rose in injured kidneys at the expense of Triton-X-100 extractable, immunoreactive material that upon treatment with trypsin yielded additional EGF. T3 administered one hour following dichromate resulted in significant functional protection (peak injury serum creatinines 2.63 +/- 0.76 control vs. 0.98 +/- 0.14 with T3) as well as an approximate doubling in renal EGF levels at 24, 48 and 72 hours (4.7 +/- 0.3 vs. 9.7 +/- 0.8 at 24 hr, 33.5 +/- 6.5 vs. 63.2 +/- 20.0 at 48 hr, and 23.1 +/- 10.0 vs. 44.1 +/- 8.7 ng/g wet weight at 72 hr). There was no beneficial effect of exogenous EGF on renal function either when given in conjunction with T3 or when used alone.(ABSTRACT TRUNCATED AT 250 WORDS)

Acute Kidney Injury↗
PubMed2005

Thyroid hormones and brain development.

The action of thyroid hormones (thyroxine, T4; triiodothyronine, T3) on brain development and function is gaining renewed interest. It has been known for many years that thyroid hormones are very important in mammalian brain maturation, influencing many aspects related to neural cell migration, differentiation, and signaling. In the last 10 years, genes regulated by thyroid hormones have been identified in the rodent brain, and understanding of the role of thyroid hormone nuclear receptors has been facilitated with the analysis of the phenotype of mutant mice for the different receptor isoforms. The general picture that emerges is that T4 and T3 may enter the brain through specific transporters. T4 is converted to the active hormone, T3, in glial cells, astrocytes, and tanycytes, although the main target cells are neurons and maturing oligodendrocytes. T3, acting through the nuclear receptors, controls the expression of genes involved in myelination, cell differentiation, migration, and signaling. In addition to transducing the T3 signal, the nuclear receptors also have activity in the unliganded state (i.e., as aporeceptors), mainly as repressors of transcription. The physiological meaning of aporreceptor action is not known, but they may play a role in the genesis of the hypothyroid phenotype. Among the questions that remain to be explored in more detail is the role of thyroid hormones and the T3 receptors, both liganded and unliganded, in the fetal brain, especially before onset of fetal thyroid gland function. These questions are relevant for human health and the management of thyroid diseases during pregnancy.

Animals↗
PubMed2003

Do unliganded thyroid hormone receptors have physiological functions?

Thyroid hormone (TH) is required for the development of vertebrates and exerts numerous homeostatic functions in adults. TH acts through nuclear receptors which control the transcription of target genes. Unliganded and liganded thyroid hormone receptors (TRs) have been shown to exert opposite effects on the transcription of target genes in vitro. However, the occurance of an aporeceptor activity in vivo and its potential physiological significance has not been clearly addressed. Several data generated using experimental hypothyroidism and thyrotoxicosis in wild type and TR knockout mice support the notion that apoTRs have an intrinsic activity in several tIssues. ApoTRs, and in particular TRalpha1, are predominant during the early stages of vertebrate development and must be turned into holoTRs for post-natal development to proceed normally. However, the absence of striking alterations of embryonic and fetal development in mice devoid of TRs indicates that apoTRs do not play a fundamental role. During development, as well as in adults, apoTRs rather appears as a system which increases the range of transcriptional responses to moderate variations of T3.

Aging↗
PubMed2004

Selective activators of thyroid hormone receptors.

An excess of thyroid hormone (TH) leads to a mix of deleterious (increased heart rate, muscle wasting and osteoporosis) and beneficial effects (reduced serum cholesterol and lipoprotein A and weight loss). All of these actions are mediated by nuclear thyroid hormone receptors (TRs), however, genetic evidence suggests that different TR isoforms do not contribute equally to individual TH effects. Thus, TR isoform selective activators could mimic the beneficial aspects of TH excess while avoiding the harmful effects. This article reviews new selective TR activators, their mechanism of action (they work by targeting the TR-beta isoform) and their actions in animal models. It is clear that these compounds represent a promising new avenue for the treatment of lipid disorders and obesity.

Animals↗
PubMed1996

Diagnostic accuracy of 131I scanning with recombinant human thyrotropin versus thyroid hormone withdrawal in a patient with metastatic thyroid carcinoma and hypopituitarism.

The diagnostic and therapeutic use of radioactive iodine in patients with thyroid cancer requires a sufficient serum concentration of thyrotropin (TSH) for efficient thyroid tissue uptake of radioiodine. Recombinant human TSH (rhTSH) is a promising new agent, which appears to facilitate radioiodine scanning with similar efficacy to thyroid hormone withdrawal without the immunologic side-effects of bovine TSH (bTSH) administration. Patients with thyroid cancer and concomitant secondary hypothyroidism are particularly difficult to treat because of their inability to elevate endogenous TSH and the limitations of bTSH administration. We describe a patient with metastatic thyroid carcinoma and secondary hypothyroidism with metastases visible only after administration of rhTSH previously unappreciated on thyroid hormone withdrawal scans. This patient exemplifies the usefulness of rhTSH administration before radioactive iodine for this group of patients.

Carcinoma, Papillary↗
PubMed1990

Tissue-specific regulation of the expression of rat kallikrein gene family members by thyroid hormone.

We have altered the thyroid hormonal status of both male and female rats and examined the expression of six functional members of the rat kallikrein gene family (PS, S1, S2, S3, K1 and P1) in the submandibular gland (SMG), kidney, prostate, testis and anterior pituitary gland (AP) of these animals. On Northern-blot analysis with gene-specific oligonucleotide probes, the steady-state mRNA levels of S1, S2, S3, K1 and P1 were all dramatically altered in the SMG of male and female rats treated with propylthiouracil (PTU; 100 mg/litre of drinking water) or thyroxine (T4; 10 micrograms/100 mg body wt.) for 3 weeks. The SMG mRNA levels of these five genes were all lowered (30-90%) in hypothyroid (PTU-treated) male and female rats and elevated (1.4-4-fold, male; 1.5-11-fold, female) in the hyperthyroid (T4-treated) and PTU/T4-treated animals. In contrast, PS (true kallikrein) mRNA levels in the male or female SMG or kidney were essentially unchanged. K1 mRNA levels in the kidney were considerably less responsive to thyroid status than those in the SMG. Changes in S3 and P1 mRNA levels in the prostate were also variable, but essentially unaffected by these treatments. AP PS mRNA levels were also unaffected by changes in thyroid-hormonal status, as were levels of a novel P1-like mRNA in the testis. In summary, these studies demonstrate that the same kallikrein gene family member(s) may be differentially regulated by thyroid hormones in the rat SMG, kidney, prostate and pituitary, and thus further extend the concept of tissue-specific expression and hormonal regulation of the kallikrein gene family in the rat.

Animals↗
PubMedDate not supplied

The effects of thyroid hormone level and action in developing brain: are these targets for the actions of polychlorinated biphenyls and dioxins?

Alterations in thyroid hormone level or responsivity to thyroid hormone have significant neurologic sequelae throughout the life cycle. During fetal and early neonatal periods, disorders of thyroid hormone may lead to the development of motor and cognitive disorders. During childhood and adult life, thyroid hormone is required for neuronal maintenance as well as normal metabolic function. Those with an underlying disorder of thyroid hormone homeostasis or mitochondrial function may be at greater risk for developing cognitive, motor, or metabolic dysfunction upon exposure to substances which alter thyroid hormone economy. Polychlorinated biphenyls (PCBs) and dioxins have been argued to interfere with thyroid hormone action and thus may affect the developing and mature brain. Animal models provide useful tools for studying the effects of thyroid hormone disorders and the effects of environmental endocrine disruptors. The congenitally hypothyroid, hyt/hyt, mouse exhibits abnormalities in both the cognitive and motor systems. In this mouse and other animal models of thyroid hormone disorders, delayed somatic and reflexive development are noted, as are permanent deficits in hearing and locomotor and adaptive motor behavior. This animal's behavioral abnormalities are predicated on anatomic abnormalities in the nervous system. In turn, these abnormalities are correlated with differences in neuronal structural proteins. In normal mice, the expression of mRNAs coding for these proteins occurs temporally with the onset of autonomous thyroid hormone production. The hyt/hyt mouse has a mutation in the thyroid stimulating hormone receptor (TSHr) gene which renders it incapable of transducing the TSH signal in the thyrocyte to produce thyroid hormone. Some behavioral and possibly some biochemical abnormalities in mice exposed to PCBs are similar to those seen in the hyt/hyt mouse. In addition to direct effects on brain development and neuronal maintenance, thyroid hormone is necessary for maintaining metabolic functioning through its influence on mitochondria. Because the brain is particularly sensitive to inadequate energy generation, disorders of thyroid hormone economy also indirectly impair brain functioning. Alterations in thyroid hormone level result in differing expression of mitochondrial genes. Mutations in these mitochondrial genes lead to well-recognized syndromes of encephalomyopathy, myopathy, and multisystem disorder. Hence, PCBs and dioxins, by possibly altering the thyroid hormone milieu, may alter the functioning of mitochondria in the generation of adenosine triphosphate (ATP). The use of animal models of thyroid hormone deficiency for behavioral, anatomic, histologic, and molecular comparison will help elucidate the mechanisms of action of these putative endocrine-disrupting compounds. The study of thyroid hormone disorders provides a template for relating thyroid hormone mediated effects on the brain to these compounds.

Animals↗
PubMed1997

Clinical and hormonal outcome after two years of triiodothyroacetic acid treatment in a child with thyroid hormone resistance.

We report here a new family with thyroid hormone resistance (RTH), with phenotypic variability among subjects. Particular emphasis is given to the clinical and hormonal outcome after 2 years of triiodothyroacetic acid (TRIAC) treatment in an affected child with peripheral thyrotoxic features (pituitary RTH [PRTH]). The genetic defect was a substitution in position 1642 (C to A) within the exon 10 of thyroid hormone receptor beta1 (TRbeta1) gene, resulting in the codon change P453T. The mutant receptor had a significantly reduced triiodothyronine (T3) binding affinity. Within this family, the child and the mother suffered from hyperthyroidism and were clinically classified as PRTH, while the maternal grandmother was clinically euthyroid, indicating a generalized form of the disease (GRTH). Rapid normalization of heart rate was initially obtained by the association of the cardioselective beta-blocker atenolol with TRIAC. Nevertheless, long-term TRIAC therapy, through its lowering action of serum thyrotropin (TSH) and thyroid hormone levels, maintained a normal heart rate after atenolol discontinuation and normalized the neurological disturbances and the clinical signs in the child, without any apparent side effect. In fact, growth velocity remained unchanged and no alteration of several parameters of thyroid hormone action at the tissue level was observed, whereas soluble interleukin-2 receptor levels improved significantly, confirming the safety and efficacy of long-term TRIAC therapy for PRTH also during childhood. We thus recommend testing the efficacy of TRIAC therapy in all RTH patients presenting with clinical features of hyperthyroidism.

Biomarkers↗
PubMed1994

Activation of myoD gene transcription by 3,5,3'-triiodo-L-thyronine: a direct role for the thyroid hormone and retinoid X receptors.

Thyroid hormones are major determinants of skeletal muscle differentiation in vivo. Triiodo-L-thyronine treatment promotes terminal muscle differentiation and results in increased MyoD gene transcription in myogenic cell lines; furthermore myoD and fast myosin heavy chain gene expression are activated in rodent slow twitch muscle fibers (Molecular Endocrinology 6: 1185-1194, 1992; Development 118: 1137-1147, 1993). We have identified a T3 response element (TRE) in the mouse MyoD promoter between nucleotide positions -337 and -309 (5' CTGAGGTCAGTACAGGCTGGAGGAGTAGA 3'). This sequence conferred an appropriate T3 response to an enhancerless SV40 promoter. In vitro binding studies showed that the thyroid hormone receptor alpha (TR alpha) formed a heterodimeric complex, with either the retinoid X receptor alpha or gamma 1 isoforms (RXR alpha, RXR gamm), on the MyoD TRE that was specifically competed by other well characterised TREs and not by other response elements. Analyses of this heterodimer with a battery of steroid hormone response elements indicated that the complex was efficiently competed by a direct repeat of the AGGTCA motif separated by 4 nucleotides as predicted by the 3-4-5 rule. EMSA experiments demonstrated that the nuclear factor(s) present in muscle cells that bound to the myoD TRE were constitutively expressed during myogenesis; this complex was competed by the myosin heavy chain, DR-4 and PAL-0 TREs in a sequence specific fashion. Western blot analysis indicated that TR alpha 1 was constitutively expressed during C2C12 differentiation. Mutagenesis of the myoD TRE indicated that the sequence of the direct repeats (AGGTCA) and the 4 nucleotide gap were necessary for efficient binding to the TR alpha/RXR alpha heterodimeric complex. In conclusion our data suggest that the TRE in the helix loop helix gene, myoD, is a target for the direct heterodimeric binding of TR alpha and RXR alpha/gamma. These results provide a molecular mechanism/model for the effects of triiodo-L-thyronine on in vitro myogenesis; the activation of myoD gene expression in the slow twitch fibres and the cascade of myogenic events regulated by thyroid hormone.

Animals↗
PubMed2000

[Physiology and pathophysiology of thyroid hormone receptors: the contributions of murine models].

Thyroid hormones are involved in vertebrate development and metabolic homeostasis. Their actions are mediated through several nuclear receptors encoded by TRalpha and TRB genes. The interspecies conservation of 3 functional receptors (TRalpha1, TRB1 and TRB2) and their partially distinct tissue distribution suggest that they serve non-redundant physiological functions. The exclusive TRB gene involvement in the resistance to thyroid hormone (RTH) reinforces the hypothesis of a functional specificity. Recent mouse knock-out and transgenesis methods allow invalidation or overexpression of a gene of interest, respectively. They therefore provide powerful means to determine the specific function of a gene and have been applied to the thyroid hormone receptor genes. Mice TRB(-/-) represent a model of the recessive form of RTH. They have been shown to develop goiter and high thyroid hormone and TSH (Thyroid Stimulating Hormone) levels, suggesting an unique role for TRB in the negative regulation of TSH pituitary secretion. The associated disorder in audition maturation also showed that TRB plays an essential role in the development of audition. By contrast, mice TRalpha(-/-) exhibited thyroid gland atrophy along with decreased thyroid hormones and TSH levels. Clinical phenotype included growth interruption and retardation of both intestine and bone maturation, but no hearing loss. Mice TRalphaB(-/-) combined the disorders, including delayed neonatal development despite hyperactive hypothalamus-pituitary axis. Finally, transgenic overexpression of a mutant TRB gene reproduced the dominant form of RTH and confirmed the major role of dominant negative activity in the occurrence of some phenotypic key-features such as high circulating hormone levels despite high TSH levels, hyperactivity and lack of severe hearing loss. From these studies, it is suggested that TRalpha and TRB receptors are to some extent able to cooperate or substitute for each other. However some organs constitute TR-specific T3 target-tissues such as inner ear, pituitary, heart, liver, bone and small intestine.

Animals↗
PubMed1994

Osteoblasts mediate thyroid hormone stimulation of osteoclastic bone resorption.

Thyroid hormones increase bone turnover in vivo and stimulate bone resorption in vitro. Clinical states associated with excess circulating thyroid hormone levels are known to produce osteoporosis. To determine the effect of T3 on bone resorption, we used an isolated rat osteoclast bone resorption assay in the absence or presence of added osteoblasts. This makes it possible to distinguish between direct and indirect effects of thyroid hormones on osteoclasts. In short settlement osteoclast cultures, which contain relatively few osteoblasts, 24-h treatment with T3 (10(-10)-10(-8) M) produced no stimulation of bone resorption. However, after 48-h incubation in the presence of T3, an increase in resorption was observed (2.3-fold at 10(-9) M). In cocultures of osteoclasts and osteoblasts (UMR 106-01 osteoblast-like cells or long settlement cultures), T3 stimulated resorption at 24 h. Furthermore, stimulation of resorption occurred when osteoblasts (UMR 106-01 or rat calvarial cells) were pretreated with T3 and the subsequent osteoblast-osteoclast cocultures conducted for 24 h in the absence of T3. Thus, direct exposure of osteoclasts to T3 was not required for the stimulatory effect. Treatment for 48 h with T3 (10(-9) M) or PTH (10(-8) M) had no effect on bone resorption in osteoblast-free cultures derived from human osteoclastoma tumours. T4 was 100-fold less potent than T3 as a stimulator of osteoclast activity, and rT3 had no effect. T3-induced stimulation was inhibited by salmon calcitonin (10(-10) M). These findings indicate that thyroid hormone can act on osteoblasts to indirectly stimulate osteoclastic bone resorption.

Animals↗