Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Terminal Repeat Sequences”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 991 records · Page 55Linked to original sources
PubMed1999

Genetic variation of chlorella viruses: variable regions localized on the CVK2 genomic DNA.

A physical map of the Chlorella virus CVK2 genomic DNA has been constructed based on a cosmid contig covering the entire genomic region. By using Southern blot analysis with 22 gene probes, the gene arrangement along the genome was compared between CVK2 and PBCV-1, the prototypic member of Phycodnaviridae, whose genomic sequence is now available. The major rearrangements were (1) an insertion of a 20-kbp region around the left end of CVK2 DNA, (2) a duplication of the gene for major capsid protein in CVK2 DNA, (3) deletions/insertions of some open reading frames, and (4) divergence in the terminal inverted repeat sequences. Despite these changes, extensive colinearity was revealed between most of the genes along the CVK2 and PBCV-1 genomes. These data imply that the Chlorella virus genome has an overall high degree of genomic stability, encompassing specific islands of rearrangements.

Amino Acid Sequence↗
PubMed1989

Hepatitis B virus X gene can transactivate heterologous viral sequences.

The smallest open reading frame of hepatitis B virus (HBV) has been designated the X gene and its biological function during HBV infection and replication is not known. Experiments described here demonstrate that expression of the HBV X gene in HepG2 cells containing a plasmid with the chloramphenicol acetyltransferase (CAT) gene under control of the human immunodeficiency virus (HIV-1) long terminal repeat (LTR) sequence leads to a marked increase in CAT gene transcription as well as expression of the gene product (CAT). The HIV-1 tatIII gene and the HBV X gene together increased HIV-1 LTR-regulated CAT expression above that observed with either gene alone, suggesting a synergistic effect of the X gene and tat. HBV X gene also stimulated expression of the CAT gene under control of the simian virus 40 enhancer and early promoter but not the visna virus LTR or the human T-cell lymphotropic virus type I (HTLV-I) LTR, indicating that the HBV X gene can transactivate some but not other heterologous viral sequences. Transactivation of the HIV-1 LTR by the HBV X gene varied in different cell lines, suggesting that it may be mediated by a cellular factor(s).

Cell Line↗
PubMed2003

Diverse sequences within Tlr elements target programmed DNA elimination in Tetrahymena thermophila.

Tlr elements are a novel family of approximately 30 putative mobile genetic elements that are confined to the germ line micronuclear genome in Tetrahymena thermophila. Thousands of diverse germ line-limited sequences, including the Tlr elements, are specifically eliminated from the differentiating somatic macronucleus. Macronucleus-retained sequences flanking deleted regions are known to contain cis-acting signals that delineate elimination boundaries. It is unclear whether sequences within deleted DNA also play a regulatory role in the elimination process. In the current study, an in vivo DNA rearrangement assay was used to identify internal sequences required in cis for the elimination of Tlr elements. Multiple, nonoverlapping regions from the approximately 23-kb Tlr elements were independently sufficient to stimulate developmentally regulated DNA elimination when placed within the context of flanking sequences from the most thoroughly characterized family member, Tlr1. Replacement of element DNA with macronuclear or foreign DNA abolished elimination activity. Thus, diverse sequences dispersed throughout Tlr DNA contain cis-acting signals that target these elements for programmed elimination. Surprisingly, Tlr DNA was also efficiently deleted when Tlr1 flanking sequences were replaced with DNA from a region of the genome that is not normally associated with rearrangement, suggesting that specific flanking sequences are not required for the elimination of Tlr element DNA.

Animals↗
PubMed2001

Effects of a second intron on recombinant MFG retroviral vector.

The retroviral vectors based on an MFG-type backbone have superior expression characteristics, in part, due to the presence of the retroviral chimeric intron (MFG intron). We tested the hypothesis that inclusion of a second intron in MFG vectors may influence packaging and/or LTR-driven transgene expression. We constructed two MFG retroviral vectors, MFG/hFIXc and MFG/hFIXm2, containing human factor IX (hFIX) cDNA without and with a 0.3-kb hFIX intron, respectively. When tested with primary mouse myoblasts or HepG2 cells in culture for transient expression activity, pMFG/hFIXm2 plasmid produced two-to-three fold higher hFIX than pMFG/hFIXc. These vectors produced equivalent retroviral titers from packaging cells. In transduced cells, the splicing of the MFG intron in the retroviral transcripts occurred at a similar efficiency; however, MFG/hFIXc virus gave two-fold higher hFIX expression than that of the MFG/hFIXm2 viral infection. Analyses of MFG/hFIXm2 virion RNA and transduced cell genomic DNA suggested that, although the hFIX intron containing viral RNA are packaged, these viruses fail to integrate their transgenes into the genome of transduced cells, suggesting a block at the reverse transcription and/or integration steps. Similar results were also obtained with the prototype vectors, LIXcSN and LIXm2SN, lacking the MFG intron. Together, these results suggest that a hFIX cDNA sequence in the retroviral vectors performs better over hFIX intron-containing minigene.

Animals↗
PubMed2004

IS6110 functions as a mobile, monocyte-activated promoter in Mycobacterium tuberculosis.

The mobile insertion sequence, IS6110, is an important marker in tracking of Mycobacterium tuberculosis strains. Here, we demonstrate that IS6110 can upregulate downstream genes through an outward-directed promoter in its 3' end, thus adding to the significance of this element. Promoter activity was orientation dependent and was localized within a 110 bp fragment adjacent to the right terminal inverted repeat. Transcripts from this promoter, named OP6110, begin approximately 85 bp upstream of the 3' end of IS6110. Use of green fluorescent protein (GFP) expression constructs showed that OP6110 was upregulated in M. tuberculosis during growth in human monocytes and in late growth phases in broth. Analysis of natural insertion sites in M. tuberculosis showed that IS6110 upregulated expression of several downstream genes during growth in human monocytes, including Rv2280 in H37Rv and the PE-PGRS gene, Rv1468c, in the clinical strain 210, which is a member of the Beijing family. Transcription between IS6110 and downstream genes was confirmed by reverse transcription polymerase chain reaction. The ability to activate genes during infection suggests that IS6110 has the potential to influence growth characteristics of different strains, and indicates another mechanism by which IS6110 can impact M. tuberculosis evolution.

Artificial Gene Fusion↗
PubMed2002

Transcriptional regulation of porcine endogenous retroviruses released from porcine and infected human cells by heterotrimeric protein complex NF-Y and impact of immunosuppressive drugs.

Recent studies revealed a significant promoter activity of porcine endogenous retrovirus (PERV) long terminal repeats (LTRs) in different human and mammalian cell lines, which is mediated by a 39-bp repeat located in the U3 region in different numbers, representing an enhancer (G. Scheef, N. Fischer, U. Krach, and R. R. Tönjes, J. Virol. 75:6933-6940, 2001). A statistical transcription factor analysis revealed putative binding sites for the CCAAT-binding transcription factor NF-Y inside the 39-bp repeat. Specific binding of NF-Y to the repeat sequence was demonstrated by electrophoretic mobility shift assays and supershift assays with specific antibodies directed against the three subunits of NF-Y. To identify further transcription-regulating elements, genetically modified LTRs lacking the repeat box, U3, R, or U5 were investigated. The results indicated a strong inhibitory element in the R region, as the deletion of R caused a significantly increased promoter activity. Since PERV might play a potential role in the application of xenogeneic cell therapy and xenotransplantation techniques, we have investigated whether immunosuppressive drugs that are routinely used in transplantation medicine have an impact on the promoter activity. Neither cyclosporine nor prednisolone had any influence on the promoter strength of the PERV LTRs. By performing a real-time PCR we were able to compare the proviral loads of porcine and infected human cells as well as the amount of released virions, which revealed a direct link between LTR activity and the number of released retroviruses.

Animals↗
PubMed2006

Role of genomic architecture in PLP1 duplication causing Pelizaeus-Merzbacher disease.

Genomic architecture, higher order structural features of the human genome, can provide molecular substrates for recurrent sub-microscopic chromosomal rearrangements, or may result in genomic instability by forming structures susceptible to DNA double-strand breaks. Pelizaeus-Merzbacher disease (PMD) is a genomic disorder most commonly arising from genomic duplications of the dosage-sensitive proteolipid protein gene (PLP1). Unlike many other genomic disorders that result from non-allelic homologous recombination utilizing flanking low-copy repeats (LCRs) as substrates, generating a common and recurrent rearrangement, the breakpoints of PLP1 duplications have been reported not to cluster, yielding duplicated genomic segments of varying lengths. This suggests a distinct molecular mechanism underlying PLP1 duplication events. To determine whether structural features of the genome also facilitate PLP1 duplication events, we analyzed extensively the genomic architecture of the PLP1 region and defined several novel LCRs (LCR-PMDs). Array comparative genomic hybridization showed that PLP1 duplication sizes differed, but revealed a subgroup of patients with apparently similar PLP1 duplication breakpoints. Pulsed-field gel electrophoresis analysis using probes adjacent to the LCR-PMDs detected unique recombination-specific junction fragments in 12 patients, enabled us to associate the LCR-PMDs with breakpoint regions, and revealed rearrangements inconsistent with simple tandem duplications in four patients. Two-color fluorescence in situ hybridization was consistent with directly oriented duplications. Our study provides evidence that PLP1 duplication events may be stimulated by LCRs, possibly non-homologous pairs at both the proximal and distal breakpoints in some cases, and further supports an alternative role of genomic architecture in rearrangements responsible for genomic disorders.

Base Sequence↗
PubMed1977

Rous sarcoma virus genome is terminally redundant: the 3' sequence.

A sequence of 20 nucleotide residues immediately adjacent to the 3'-terminal poly(A) in Rous sarcoma virus (Prague strain, subgroup C) 35S RNA has been determined by extension of a riboguanylic acid-terminated oligothymidylic acid primer hybridized at the 5' end of the 3'-terminal poly(A) with purified reverse transcriptase (RNA-directed DNA polymerase; deoxynucleosidetriphosphate:DNA deoxynucleotidyltransferase, EC 2.7.7.7) from avian myeloblastosis virus. The sequence is 5'GCCAUUUUACCAUUCACCACpoly(A)3'. This same nucleotide sequence, excluding the poly(A) segment, has also been found at the 5' terminus of Rous sarcoma virus RNA (W. A. Haseltine, A. Maxam, and W. Gilbert, this issue pp. 989-993), and therefore the RNA genome of this virus is terminally redundant. Possible mechanisms for endogenous in vitro copying of the complete RNA genome by reverse transcriptase which involve terminally repeated nucleotide sequences are discussed.

Avian Sarcoma Viruses↗
PubMed1992

Natural variants of the HIV-1 long terminal repeat: analysis of promoters with duplicated DNA regulatory motifs.

Sequence variation in the long terminal repeat (LTR) region of HIV-1 was analyzed in viral isolates of 17 infected individuals. Two classes of LTR size variants were found. One HIV-1 variant was detected containing an additional binding site for the transcription factor Sp1. Another LTR size variation was observed in four patients in a region just upstream of the NF-kappa B enhancer. This variation was the result of a duplication of a short DNA sequence (CTG-motif). Cell culture experiments demonstrated that the natural variant with four Sp1 sites had a slightly higher promoter activity and viral replication rate than the isogenic control LTR with three Sp1 sites. No positive effect of the duplicated CTG-motif could be detected. In order to measure small differences in virus production more accurately, equal amounts of a size variant and the wild-type plasmid were cotransfected into T-cells. The virus with four Sp1 sites did outgrow the three Sp1 virus in 35 days of culture and CTG-monomer virus outcompeted the CTG-dimer virus in 42 days. Based on these results we estimate a 5-10% difference in virus production of the LTR variants when compared to that of wild-type.

Base Sequence↗
PubMed2001

Homonuclear (1)H-NMR assignment and structural characterization of human immunodeficiency virus type 1 Tat Mal protein.

The transacting transcriptional activator (Tat) is a viral protein essential for activation of the human immunodeficiency virus (HIV) genes, and it plays an important role in HIV induced immunodeficiency. We report the NMR structural characterization of the active Tat Mal variant that belongs to a highly virulent D-subtype HIV type-1 (HIV-1) strain (Mal) found mainly in Africa. A full Tat Mal protein (87 residues) is synthesized. This synthetic protein is active in a transactivation assay with HeLa cells infected with the HIV long terminal repeated noncoding sequences of the HIV-1 provirus (LTR) lac Z gene. Homonuclear (1)H-NMR spectra allows the sequential assignment of the Tat Mal spin systems. Simulating annealing generates 20 conformers with similar folding. The geometry of the mean structure is optimized with energy minimization to obtain a final structure. As the European variant (Tat Bru) the N-terminal region of Tat Mal constitutes the core, and there is a hydrophobic pocket composed of the conserved Trp 11 interacting with several aromatic residues. The two functional regions of Tat (basic and the cysteine-rich regions) are well exposed to the solvent. A short alpha-helix is observed in region V adjacent to the basic region. This alpha helix induces local structural variations compared to the NMR structure of Tat Bru, and it brings the cysteine-rich and basic regions closer. This study suggests that similar folding exists among Tat variants.

Africa↗
PubMed2002

Cloning of complete genome sets of six dsRNA viruses using an improved cloning method for large dsRNA genes.

Cloning full-length large (>3 kb) dsRNA genome segments from small amounts of dsRNA has thus far remained problematic. Here, a single-primer amplification sequence-independent dsRNA cloning procedure was perfected for large genes and tailored for routine use to clone complete genome sets or individual genes. Nine complete viral genome sets were amplified by PCR, namely those of two human rotaviruses, two African horsesickness viruses (AHSV), two equine encephalosis viruses (EEV), one bluetongue virus (BTV), one reovirus and bacteriophage Phi12. Of these amplified genomes, six complete genome sets were cloned for viruses with genes ranging in size from 0.8 to 6.8 kb. Rotavirus dsRNA was extracted directly from stool samples. Co-expressed EEV VP3 and VP7 assembled into core-like particles that have typical orbivirus capsomeres. This work presents the first EEV sequence data and establishes that EEV genes have the same conserved termini (5' GUU and UAC 3') and coding assignment as AHSV and BTV. To clone complete genome sets, one-tube reactions were developed for oligo-ligation, cDNA synthesis and PCR amplification. The method is simple and efficient compared to other methods. Complete genomes can be cloned from as little as 1 ng dsRNA and a considerably reduced number of PCR cycles (22-30 cycles compared to 30-35 of other methods). This progress with cloning large dsRNA genes is important for recombinant vaccine development and determination of the role of terminal sequences for replication and gene expression.

African Horse Sickness Virus↗
PubMed2003

New insertion sequence elements in the upstream region of cfiA in imipenem-resistant Bacteroides fragilis strains.

The 747-bp cfiA gene, which encodes a metallo-beta-lactamase, and the regions flanking cfiA in six imipenem-resistant and four imipenem-susceptible Bacteroides fragilis strains isolated in Japan were analyzed by PCR and DNA sequencing. The nucleotide sequences of the cfiA genes (designated cfiA(1) to cfiA(10)) of all 10 strains tested varied from that of the standard cfiA gene from B. fragilis TAL2480. However, putative proteins encoded by the cfiA variants contained conserved amino acid residues important for zinc binding and hairpin loop formation, suggesting that cfiA variants have the capability of producing metallo-beta-lactamases with full catalytic activities. PCR assay indicated that six metallo-beta-lactamase-producing, imipenem-resistant strains had an insertion mutation in the region immediately upstream of cfiA. Nucleotide sequencing of the PCR-amplified fragments along with the upstream region of cfiA revealed that there were five new kinds of insertion sequence (IS) elements (designated IS612, IS613, IS614, IS615, and IS616, with a size range of 1,594 to 1,691 bp), of which only IS616 was found to be almost identical to IS1188, one of the IS elements previously identified in the upstream region of cfiA. These elements had target site duplications of 4 or 5 bp in length, terminal inverted repeats (14, 15, or 17 bp in size), and a large open reading frame encoding a putative transposase which is required for the transcription of IS elements. Each element was inserted such that the transcriptional direction of the transposase was opposite to that of cfiA. A computer-aided homology search revealed that, based on the homology of their putative transposases, the sizes of their terminal inverted repeat sequences, and their target site duplications, IS612, IS613, IS614, and IS615 belong to the IS4 family, which includes IS942, previously found in some drug-resistant B. fragilis strains, but that IS616 belongs to the IS1380 family. All the IS elements appear to have putative promoter motif sequences (the -7 region's TAnnTTTG motif and the -33 region's TTG or TG) in their end regions, suggesting that the IS elements provide a promoter for the transcription of cfiA upon insertion. These data provide additional proof that various IS elements may exist to provide a promoter to express the cfiA gene.

Amino Acid Sequence↗
PubMed1997

Occurrence of deletions, associated with genetic instability in Streptomyces ambofaciens, is independent of the linearity of the chromosomal DNA.

The chromosomal structures of mutant strains of Streptomyces ambofaciens which have arisen from genetic instability were investigated by using pulsed-field gel electrophoresis and probing with sequences cloned from the unstable region which maps near the ends of the linear chromosomal DNA. The chromosomal structures of seven mutant strains harboring large deletions were classified into three types. (i) Deletions internal to one chromosomal arm were characterized in two of the mutant strains. In these strains, a linear chromosomal structure was retained, as were parts of the terminal inverted repeats sequences (TIRs) and the proteins bound to them. (ii) Four of the mutants presented a deletion including all sequences from the TIRs. A junction fragment homologous to sequences originating from internal region of both arms was characterized. Consequently, the chromosomal DNA of these strains was deduced to be circularized. Furthermore, chromosomal stability was assessed in the progeny of these circular DNA mutants. Additional deletion events were detected in 11 mutants among the 13 strains isolated, demonstrating that circular chromosomes do not correspond to a stabilization of the chromosome structure and that the occurrence of deletion could be independent of the presence of chromosomal ends. (iii) A mutant with DNA amplification was shown to have a linear chromosome with a deletion of all sequences between the amplified region and the end of the chromosome. The other chromosomal arm remained unaffected by deletion and associated with protein.

Bacterial Proteins↗
PubMed1999

Minimum requirements for efficient transduction of dividing and nondividing cells by feline immunodeficiency virus vectors.

The development of gene delivery vectors based on feline immunodeficiency virus (FIV) is an attractive alternative to vectors based on primate sources for the delivery of genes into humans. To investigate the requirements for efficient transduction of dividing and nondividing cells by vector particles based on FIV, a series of packaging and vector constructs was generated for which viral gene expression was minimized and from which unnecessary cis-acting sequences were deleted. Pseudotyped vector particles produced in 293T cells were used to transduce various target cells, including contact-inhibited human skin fibroblasts and growth-arrested HT1080 cells. FIV vectors in which the U3 promoter was replaced with the cytomegalovirus promoter gave rise to over 50-fold-higher titers than FIV vectors containing the complete FIV 5' long terminal repeat (LTR). Comparison of the transduction efficiencies of vectors containing different portions of the FIV Gag coding region indicates that at least a functional part of the FIV packaging signal (Psi) is located within an area which includes the 5' LTR and the first 350 bp of gag. Transduction efficiencies of vectors prepared without FIV vif and orf2 accessory gene expression did not differ substantially from those of vectors prepared with accessory gene expression in either dividing or nondividing cells. The requirement for FIV rev-RRE was, however, demonstrated by the inefficient production of vector particles in the absence of rev expression. Together, these results demonstrate the efficient transduction of nondividing cells in vitro by a multiply attenuated FIV vector and contribute to an understanding of the minimum requirements for efficient vector production and infectivity. In addition, we describe the ability of an FIV vector to deliver genes in vivo into hamster muscle tissue.

Animals↗
PubMed1998

A map of interactions between the proteins of a retrotransposon.

The yeast two-hybrid system and in vitro binding assays were used to characterize 54 potential interactions between the proteins of Tf1, an LTR-retrotransposon found in Schizosaccharomyces pombe. The Tf1 integrase (IN) protein was found to interact strongly with itself and not with other control proteins. In addition, the IN core domain interacted strongly with itself and full-length IN. Interestingly, the two-hybrid analysis detected an interaction between the RNase H domain of reverse transcriptase and IN. The biological implications of these interactions are discussed.

Base Sequence↗
PubMed2001

The antiterminator NusB enhances termination at a sub-optimal Rho site.

Interactions between the antiterminator NusB and boxA elements in the nut sites are necessary to ensure lambda N-mediated processive antitermination. Similarly, in the bacterial cell, interactions between NusB and boxA elements help RNA polymerase to counteract polarity during transcription of rrn operons. We analyzed the effects of NusB on intragenic termination at the level of two tandem terminators located in the hisG cistron, GTTE1 and GTTE2. Unexpectedly, we found that NusB enhances transcription termination at the sub-optimal Rho site GTTE1. Moreover, site-directed mutagenesis of a boxA homolog located within GTTE1 and the masking of this element by translating ribosomes demonstrated that the recruitment of NusB in the termination complex is mediated by a boxA element. The mutated boxA also abolishes the formation of a NusB-dependent complex on GTTE1 RNA. On the whole, results provide evidence that interactions between NusB and boxA can enhance Rho-dependent termination.

Bacterial Proteins↗
PubMed2004

Genetic engineering of onco/lentivirus hybrids results in formation of infectious but not of replication-competent viruses.

To achieve specific gene transfer into human CD4(+) cells, murine leukaemia virus (MLV)-based pseudotype vector particles were generated employing Env variants derived from human or simian immunodeficiency virus (HIV-1 or SIVagm). Here, we describe the generation of full-length onco/lentivirus hybrid genomes comprising components of MLV and HIV-1 or SIVagm, respectively, to assess the possibility of replication-competent hybrid virus formation. The env reading frame of an infectious molecular clone of MLV was replaced with the analogous coding regions of HIV-1 or SIVagm encompassing the env gene and accessory genes. Resulting MLV/HIV-1 or MLV/SIVagm hybrid genomes were transfected into 293T cells. Expression of viral proteins and budding of retroviral particles was shown by specific immunostaining and electron microscopy. The viral particles mediated CD4- and co-receptor-specific infection of human cells as demonstrated by PCR and immunostaining in the respective target cells. However, no productive infection resulting in the generation of infectious virus was detected in these cells. Thus, these onco/lentivirus hybrids, although able to initiate single-round infection, were not replication competent. Thus, MLV-based pseudotype vectors carrying Env variants of HIV-1 or SIVagm are not prone to form replication-competent retroviruses, suggesting a favourable safety profile for MLV-based CD4-specific pseudotype vectors.

Base Sequence↗