Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Response Elements”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 991 records · Page 55Linked to original sources
PubMed1996

Electroconvulsive seizure increases the expression of CREM (cyclic AMP response element modulator) and ICER (inducible cyclic AMP early repressor) in rat brain.

Rapid expression of ICER (inducible cyclic AMP early repressor), an inducible member of the CREM (cyclic AMP response element modulator) family of transcription factors, has been reported in neuroendocrine tissues and cell lines, but not in brain. In the present study, we demonstrate that acute electro-convulsive seizure (ECS) increases the expression of ICER in several rat brain regions. RNase protection analysis demonstrated that 1-2 h after administration of ECS, levels of mRNA for ICER and a splice variant, ICER gamma, were significantly increased in hippocampus, frontal cortex, and cerebellum. It is surprising that ECS also increased levels of mRNA for several CREM isoforms that previous studies have reported were not rapidly inducible. In situ hybridization analysis confirmed these findings and demonstrated that ECS induction of ICER was most obvious in the dentate gyrus granule cell layer of hippocampus and deep layers of cerebral cortex. Induction of ICER and CREM was accompanied by increased expression of two small CRE-binding complexes. Gel supershift analysis with CREM/ICER antisera confirmed that the inducible CRE-binding complexes contain CREM/ICER. Induction of CREM and ICER may contribute to negative feedback regulation of gene transcription that is increased by acute seizure and activation of CREB (cyclic AMP response element-binding protein.

Animals↗
PubMed1993

C/ATF, a member of the activating transcription factor family of DNA-binding proteins, dimerizes with CAAT/enhancer-binding proteins and directs their binding to cAMP response elements.

Members of the C/EBP family of basic-leucine zipper (bZip) transcription factors form heterodimers and bind to the CAAT box and other sequence-related enhancer motifs. Using a 32P-labeled protein probe consisting of the bZip domain of C/EBP beta, we isolated a clone encoding C/EBP-related ATF (C/ATF), a bZip protein that heterodimerizes with C/EBP-like proteins but belongs to the CREB/ATF family. C/ATF homodimers do not bind to typical C/EBP DNA sites. Instead they bind to palindromic cAMP response elements such as that of the somatostatin gene. In addition, C/ATF-C/EBP beta heterodimers bind to a subclass of asymmetric cAMP response elements exemplified by those in the phosphoenolpyruvate carboxykinase and proenkephalin genes. Transient transfection studies indicate that interactions between C/ATF and C/EBP beta are the basis for a functional cross talk between these two families of transcription factors that may be important for the integration of hormonal and developmental stimuli that determine the expression of subsets of genes in specific cellular phenotypes.

3T3 Cells↗
PubMed1997

Localization of a negative glucocorticoid response element of the human corticotropin releasing hormone gene.

Corticotropin releasing hormone (CRH) plays a primary role in mediating suprapituitary activation of the hypothalamic-pituitary-adrenal axis and is an important physiologic target of negative feedback regulation by glucocorticoids. We sought to define cis-acting regions of the CRH promoter responsible for cAMP-dependent activation and glucocorticoid-dependent repression of CRH promoter activity. In transiently transfected AtT-20 cells, cAMP-dependent transcriptional activation was mediated largely through a classical, consensus, cAMP-response element (CRE) at - 224 bp. Dexamethasone (DEX) produced a specific 2-3-fold repression of cAMP-stimulated, but not basal, CRH promoter activity. Using a series of 5' nested deletions, dexamethasone-dependent repression of cAMP-stimulated CRH promoter activity was localized to promoter sequences between -278 and -249 bp. Specific, high-affinity binding of glucocorticoid receptor (GR) DNA-binding domain to this promoter region was observed using an eletrophoretic mobility shift assay (EMSA). We conclude that (i) cAMP dependent activation of the CRH promoter is mediated primarily by the CRE at -224 bp, (ii) glucocorticoid-dependent repression is specific for the CRH promoter, and not a generalized effect of glucocorticoid signaling or interference with the protein kinase A (PKA) signaling pathway, (iii) a highly conserved region between -278 and -249 bp is critical for glucocorticoid dependent repression, and (iv) GR is capable of interacting directly with this functionally defined negative glucocorticoid response element of the CRH promoter.

8-Bromo Cyclic Adenosine Monophosphate↗
PubMed1993

Mapping of the pressure response element of the c-fos gene by direct DNA injection into beating hearts.

In vivo gene transfer into various organs of postnatal animals has recently been demonstrated. We applied this technique in order to map the promoter element of the protooncogene c-fos in the myocardium that responds to left ventricular pressure overload in vivo. Beating rat hearts were directly injected with a recombinant plasmid containing a 356-base pair upstream regulatory element of the mouse c-fos gene fused to a reporter gene. Two days after the injection, the hearts were excised and buffer-perfused. Acute pressure overload was applied for 2 h by inflating an intraventricular balloon. Pressure overload increased the myocardial reporter gene activity by 3-8-fold (p < 0.01). Deletion and point mutations in the serum response element (SRE) of the c-fos promoter resulted in loss of pressure-induced reporter gene expression, indicating that the SRE is necessary for pressure response. The SRE alone was sufficient to confer pressure responsiveness to the minimal c-fos promoter, confirming that the pressure response element coincides with the SRE. A construct containing a point mutation at the p62TCF binding site of the SRE did not respond to pressure overload or to a protein kinase C activator but retained responsiveness to a calcium ionophore. This suggests that pressure overload may activate the c-fos promoter by a protein kinase C-dependent pathway. Thus, a directly injected gene can be regulated in the host cells by a physical stimulus to the intact organ. The in vivo DNA injection technique is a useful method to study complex organ physiology at the molecular level.

Animals↗
PubMed1996

Identification of COUP-TFII as a peroxisome proliferator response element binding factor using genetic selection in yeast: COUP-TFII activates transcription in yeast but antagonizes PPAR signaling in mammalian cells.

Peroxisome proliferator-response elements (PPRE) are cis-acting regulatory elements that confer responsiveness to peroxisome proliferators and various fatty acids by serving as target sites for ligand-activated peroxisome proliferator-activated receptor (PPAR)/retinoid X receptor (RXR) heterodimers. Other cellular factors, including additional nuclear hormone receptors, also interact with PPREs and modulate PPAR function. We have developed a positive selection strategy in yeast to identify mammalian factors that functionally interact with PPREs. Saccharomyces cerevisiae containing an integrated copy of the HIS3 gene under transcriptional control of a minimal CYC1 promoter and two copies of the rat enoyl-CoA hydratase/3-hydroxyacyl-CoA dehydrogenase PPRE was constructed and transformed with a rat liver cDNA yeast expression library. Plasmids were isolated from his + transformants. One plasmid contained a cDNA encoding the complete rat chicken ovalbumin upstream promoter transcription factor II (COUP-TFII), an orphan member of the nuclear hormone receptor superfamily. COUP-TFII potently activated PPRE-linked reporter gene expression in yeast, and COUP-TFII synthesized in yeast or in vitro formed specific protein/DNA complexes with this PPRE. Significantly, COUP-TFII did not activate transcription of PPRE-linked reporter genes in mammalian cells but rather strongly inhibited induction mediated by PPAR/RXR. Our findings demonstrate the utility of using genetic screening in yeast to identify sequence-specific DNA binding transcription factors.

Animals↗
PubMed1989

1,25-dihydroxyvitamin D-responsive element and glucocorticoid repression in the osteocalcin gene.

The active hormonal form of vitamin D3, 1,25-dihydroxyvitamin D3[1,25(OH), which regulates cellular replication and function in many tissues and has a role in bone and calcium homeostasis, acts through a hormone receptor homologous with other steroid and thyroid hormone receptors. A 1,25(OH)2D3-responsive element (VDRE), which is within the promoter for osteocalcin [a bone protein induced by 1,25(OH)2D3] is unresponsive to other steroid hormones, can function in a heterologous promoter, and contains a doubly palindromic DNA sequence (TTGGTGACTCACCGGGTGAAC; -513 to -493 bp), with nucleotide sequence homology to other hormone responsive elements. The potent glucocorticoid repression of 1,25(OH)2D3 induction and of basal activity of this promoter acts through a region between -196 and +34 bp, distinct from the VDRE.

Animals↗
PubMed1995

A novel nerve growth factor-responsive element in the stromelysin-1 (transin) gene that is necessary and sufficient for gene expression in PC12 cells.

Stromelysin-1 (ST-1) is an extracellular matrix metalloproteinase whose expression is transcriptionally regulated by nerve growth factor (NGF) in the PC12 rat pheochromocytoma cell line. In this paper, we define sequences in the proximal ST-1 promoter that contain a novel NGF-responsive element(s). We show that this cis-acting promoter element can bind nuclear proteins from both untreated and NGF-treated PC12 cells in a specific and saturable manner and is sufficient to confer NGF-inducibility to a heterologous promoter. At least a portion of this NGF-responsive element lies within a 12-base pair region between positions -241 and -229 of the ST-1 promoter and bears no sequence homology to other known transcriptional elements. In contrast to what has been reported for fibroblasts, an AP1 site centered around position -68 does not seem to be involved in the growth factor regulation of ST-1 in PC12 cells. These results suggest that the NGF regulation of ST-1 gene expression involves different promoter elements, and possibly different transcription factors, from that described for ST-1 induction by other growth factors.

Animals↗
PubMed1999

Stress factors acting at the level of the plasma membrane induce transcription via the stress response element (STRE) of the yeast Saccharomyces cerevisiae.

A variety of stress factors induces transcription via the stress response element (STRE) present in control regions of a number of genes of the yeast Saccharomyces cerevisiae. Induction of transcription involves nuclear translocation of the STRE-binding transcription activators Msn2p and Msn4p. The primary cellular events triggering this translocation are presently not well understood. In this investigation, we have observed that a number of factors acting at the level of the yeast plasma membrane, including the antifungal agent nystatin, the steroidal alkaloid tomatine, benzyl alcohol, a number of detergents and the plasma membrane H+-ATPase inhibitor diethylstilbestrol or mutations in the PMA1 gene encoding the plasma membrane ATPase, induce Msn2p nuclear accumulation and STRE-dependent transcription. At least some of the stress factors acting via STREs cause an increase in plasma membrane permeability, leading to a decrease in membrane potential, which might be a primary cellular stress signal. A decrease in internal pH triggered by permeabilization of the plasma membrane or a change in cAMP levels are at least not obligatory factors in intracellular stress signal transduction. The signal transduction pathway transmitting the signal generated at the plasma membrane to Msn2p is still unknown.

Acids↗
PubMed1993

Cloning and sequence analysis of the 5'-flanking region of the estrogen sulfotransferase gene: steroid response elements and cell-specific nuclear DNA-binding proteins.

A 2954 bp region of the guinea pig estrogen sulfotransferase gene was cloned and sequenced including 2888 nt upstream of the cap site. This represents the first cloning of the promoter region of a steroid sulfotransferase gene. The 5'-flanking region was found to contain a conventional TATA box variant and sequences homologous to estrogen and glucocorticoid response elements. Gel mobility shift assays detected the presence of nuclear proteins in adrenocortical SW-13 and Y-1 cells that bind specifically to 30 mer DNA sequences containing either estrogen or glucocorticoid response elements. In contrast, gel shift experiments using 3T3 fibroblast cells failed to demonstrate similarly upshifted bands. Block deletion studies indicated that regulation of basal estrogen sulfotransferase promoter activity was located within the first 1000 bp upstream of the transcription initiation site.

Adrenal Cortex↗
PubMed1992

A specific sequence with a bulged guanosine residue(s) in a stem-bulge-stem structure of Rev-responsive element RNA is required for trans activation by human immunodeficiency virus type 1 Rev.

We demonstrate that both the in vitro RNA binding and in vivo trans activation functions of human immunodeficiency virus type 1 Rev regulatory protein Rev require the presence of a 9-nucleotide 5'-CACUAUGGG-3' RNA motif on its cognate target, the Rev-responsive element RNA. For optimal Rev recognition, this sequence must be presented as a stem-bulge-stem structure and must contain at least two G's, one of which must be unpaired, and include some or all of the CACUAU sequence upstream of the three G's. Distal mutations which result in the base pairing of the G's eliminate the Rev response. The first G is crucial, but changes at the other G's are tolerated if at least one G is unpaired. The secondary structure or the three-dimensional orientation of the B1 and B2 stem-loops of the Rev-responsive element are not relevant as long as the 5'-CACUAUGGG-3' sequence is preserved, with at least one bulged G residue.

Base Sequence↗
PubMed1993

Antagonist-occupied human progesterone B-receptors activate transcription without binding to progesterone response elements and are dominantly inhibited by A-receptors.

When antagonist-occupied steroid receptors have agonist-like effects, the clinical consequences are grave. We present evidence that human progesterone B-receptors (hPRB) when occupied by progesterone antagonists, inappropriately activate transcription by an unusual mechanism that does not require the canonical progesterone response element (PRE). In HeLa cells cotransfected with a PRE-tk-chloramphenicol acetyltransferase reporter and a hPRB expression vector, strong transcription is seen not only when receptors are activated by the agonist R5020, but also in the presence of the three antiprogestins, RU486, ZK112993, and ZK98299. Human PRB occupied by ZK98299 do not bind to a PRE, suggesting that the transcriptional stimulation is independent of DNA binding. Indeed, a tk-chloramphenicol acetyltransferase promoter-reporter lacking the PRE loses transcriptional activation by the agonist, but retains transactivation by the three antagonists. The PRE-independent antagonist-induced transcription requires that hPRB have an intact DNA-binding domain, but hPR target gene specificity is not required, because a hPRB mutant that binds an estrogen response element still activates transcription. It appears that antagonist-occupied hPR activate transcription without binding to a PRE, perhaps by interacting with tethering proteins instead. Even a gene that is not a normal progesterone target could be aberrantly activated. Human cells contain equimolar amounts of hPRB and the N-terminally truncated natural isotype, hPRA. Unlike hPRB, hPRA are not transcriptionally activated by progesterone antagonists. We, therefore, tested the effects of antagonists when the two receptor isotypes are coexpressed and found that A-receptors can annul the inappropriate transcription by B-receptors. Thus, when both receptor forms are present, the hPRA phenotype is dominant. Moreover, pure hPRB/hPRA heterodimers, produced by fos/jun leucine zipper domain-hPR chimeras, also have the inactive transcriptional phenotype of hPRA. Our studies suggest not only that the two hPR isotypes are functionally quite different, but also that some of the agonist-like transcriptional effects of antagonist-occupied B-receptors proceed through novel mechanisms.

Binding Sites↗
PubMed1993

Identification of c-fos-responsive elements downstream of TAR in the long terminal repeat of human immunodeficiency virus type-1.

Activation of HIV-1 requires the binding of host cell transcription factors to cis elements in the proviral long terminal repeat (LTR). This study identifies c-fos-responsive sequence motifs in the U5 transcribed noncoding leader sequences downstream of the viral transactivator responsive (TAR) element. These DNA sequence motifs are the most downstream regulatory elements described thus far in the HIV-1 LTR. Functional studies, using human colon epithelial cell lines, demonstrate that the downstream elements are transactivated by expression of the c-fos protooncogene and can transmit PMA and TNF alpha activation signals to the viral LTR. Moreover, the c-fos-responsive elements mediate HIV-1 LTR transcription independent of Tat and the NF kappa B-binding enhancer element. Nuclear extracts of colon epithelial cells form distinct gel mobility shift complexes with the c-fos-responsive elements. These complexes comigrate with a gel shift complex formed on a classical CRE oligonucleotide and are competed by CRE oligonucleotides. These data indicate that the HIV-1 LTR contains previously unrecognized functional DNA cis-regulatory elements downstream of TAR in the transcribed noncoding 5' leader sequence and suggest that early response genes such as c-fos play a role in the activation of HIV-1 gene expression.

Base Sequence↗
PubMed1998

Characterization of a negative thyroid hormone response element in the rat sodium, potassium-adenosine triphosphatase alpha3 gene promoter.

The thyroid hormone L-T3 elicits either a stimulatory or an inhibitory effect on expression of the Na,K-adenosine triphosphatase alpha3-subunit gene in primary cultures of neonatal rat cardiac myocytes. The present study was undertaken to characterize a negative thyroid hormone response element present within the rat Na,K-adenosine triphosphatase alpha3-subunit gene proximal promoter. Transient transfection assays indicated that the DNA-binding domain of thyroid hormone receptor was essential for mediating repression of alpha3 gene transcription by thyroid hormone. This negative effect of thyroid hormone was enhanced in the presence of cotransfected retinoid X receptor and its ligand 9-cis-retinoic acid. Inhibition of alpha3 chimeric gene expression by thyroid hormone was dependent on the initial cell plating density. The negative thyroid hormone response element was localized to a region between nucleotides -68 to -6 of the alpha3 gene. Electrophoretic mobility shift assays showed that thyroid hormone receptor binds in a synergistic manner as a heterodimer with retinoid X receptor to two sites at positions -62 to -41 and -39 to -17 of the alpha3 gene promoter. The upstream and downstream heterodimer binding sites coexist with CAAT and TATA elements, respectively.

Animals↗
PubMed2001

Identification of a novel pathogen-responsive element in the promoter of the tobacco gene HSR203J, a molecular marker of the hypersensitive response.

The tobacco gene, HSR203J, which is specifically activated during the early steps of incompatible plant/pathogen interactions has been shown to be a molecular marker of the hypersensitive response (HR). It constitutes an ideal model for the identification of HR-responsive cis-regulatory elements. As a first step in the promoter dissection, deletion mutants of the 5' flanking sequence of HSR203J fused to the GUS reporter gene were analyzed. Then, the construction and study of chimeric constructs containing HSR203J promoter fragments fused to a minimal promoter enabled us to identify a 28-bp regulatory element located between -106 and -79 upstream of the transcription initiation site. This element has been shown to be necessary and sufficient for transcriptional activation in response to pathogen. It contains a 10-bp palindrome followed by its imperfect repeat. The mutagenesis of these two sequence elements led to the identification of a 12-bp motif termed HSRE (HSR203 responsive element) responsible for the marked induction of the HSR203J gene during the HR. Since this DNA region did not show any homology with known regulatory sequences, this 12 bp motif corresponds to a novel cis-regulatory element.

Base Sequence↗
PubMed2002

A cluster region of AP-1 responsive elements is required for transcriptional activity of mouse ODC gene by hepatocyte growth factor.

Ornithine decarboxylase (ODC) activity is regulated by a variety of mechanisms including transcription, translation, and RNA and protein half-life. Since in mouse B16-F1 melanoma cells an early and remarkable (about 6-fold) increase in steady state mRNA levels was observed after hepatocyte growth factor (HGF) treatment, we investigated the transcriptional regulation of mouse ODC promoter. Transient transfection of various ODC-luciferase promoter constructs into the B16-Fl cells in combination with electrophoretic mobility shift assays identified the HGF-responsive element as a cluster of three AP-1 binding sites (-1660 to -1572). Even if each site differs from the canonical TPA responsive element for one nucleotide, only the first two AP-1 consensus sequences seemed to be functional since allowed DNA-binding activity of nuclear proteins after HGF treatment. Comparison of the results of transfection assays with the pOD2.5-luc (2.5 kb gene fragment) and with the construct deprived of the AP-1 cluster pOD-B-luc showed that this 50 bp region was required for ODC transactivating activity in response to HGF. Since in B16-F1 cells HGF increased AP-1 activity and the mRNA expression of various AP-1 subunits, we may conclude that HGF-induced transcription of mouse ODC was largely due to triggering of AP-1 pathway.

Animals↗
PubMed1993

Creation of an active estrogen-responsive element by a single base change in the flanking sequence of a cellular oncogene: a possible mechanism for hormonal carcinogenesis?

Estrogens are considered to act as promoters in a multistep process of hormonal carcinogenesis, although the molecular mechanisms by which these hormones act in tumorigenesis are unclear at present. Estradiol is known to induce expression of certain proto-oncogenes, and this led us to examine potential regulatory regions of the cellular c-fos oncogene. The 5'-flanking region of the murine c-fos contains a 13-bp palindromic sequence (GGTCTnnnAGACC) with striking homology to the consensus estrogen-responsive element (ERE) GGTCAnnnTGACC. However, the c-fos sequence did not bind the human estrogen receptor or confer hormonal responsiveness in a yeast-based transcriptional test system. Importantly, a single base change in the fifth position of the c-fos sequence (GGTCTnnnAGACC to GGTCA/GnnnAGACC) produced an element that bound the estrogen receptor and conferred estrogen-dependent transcriptional activation of a reporter gene. This suggests a specific hypothesis by which estrogens could act as tumor promoters. In this paradigm, the regulatory region of the cellular oncogenes, tumor suppressor genes, and growth-factor genes contain inactive sequences with close homologies to hormone-responsive elements. Initiation occurs when some agent (e.g., a chemical carcinogen) causes a mutation in such a sequence to create a functional hormone-responsive element. Estrogens, acting through their receptors and the mutated element, can then activate the target gene to stimulate cell proliferation and increase the population of initiated cells.

Animals↗
PubMed1994

Differential effects of monoclonal antibodies on activating transcription factor-1 and cAMP response element binding protein interactions with DNA.

Activating transcription factor-1 (ATF1) and cAMP response element binding protein (CREB) have been implicated in cAMP-, calcium-, and virus-induced transcriptional alterations. Although CREB and ATF1 share extensive homology, they appear to mediate distinct cellular functions. We investigated the effect on DNA binding and in vitro transcription of four monoclonal antibodies (mAb) that bound to domains in either the regulatory region (mAb 1 and 3) or unique regions near the DNA-binding domains (mAb 4 and 5) of ATF1.mAb 1 and 3 supershifted both ATF1 and CREB in a DNA binding assay but did not affect in vitro transcription. mAb 4 prevented ATF1-DNA binding while supershifting CREB.DNA complexes and inhibited in vitro transcription by 95% from the CRE-containing murine proliferating cell nuclear antigen promoter. mAb 5 reacted specifically with ATF1 and did not prevent DNA binding or affect in vitro transcription. The mAb 4 epitope was located within ATF1 amino acid residues 205-219, including the first 3 basic residues in the putative DNA-binding domain. Secondary structural analysis predicted that this region comprises a transition site from alpha-helix to a turn-like conformation in ATF1. The transition to turn-like motifs is predicted to occur in CREB after 5 additional residues, with a correspondingly longer alpha-helical domain. Although regulatory domains distinct from DNA binding regions are thought to account for most of the differences in activity of members of the CREB subfamily, our results suggest that small structural variations adjacent to DNA binding regions may also contribute to the distinct functional activities of ATF1 and CREB.

Activating Transcription Factor 1↗
PubMed1999

Aberrant expression of cAMP-response-element-binding protein ('CREB') induces apoptosis.

We have reported previously that cAMP-response-element-binding protein (CREB) was phosphorylated in a cell-cycle-dependent manner, showing that it was phosphorylated at early S-phase at casein kinase II target sites. To assess the possible involvement of CREB in cell cycle progression, CREB expression vector was transiently transfected into various cells. Unexpectedly we found that transfection with CREB expression vector resulted in an abundance of dead cells. Morphological examination revealed that these cells had undergone apoptosis. The coincidence of CREB overexpression and apoptosis induction at the individual cell level was confirmed by a immunohistochemical study. To confirm that overexpression of CREB was the cause of apoptosis, a dominant-negative mutant of CREB, KCREB, was co-expressed with the wild type. The co-existence of KCREB effectively rescued CREB-mediated apoptosis in a dose-dependent manner, verifying that apoptosis was truly a specific effect of overexpressed CREB and not an artifact of the transfection procedure. Deletion analysis indicates that neither the Q1 transactivation domain, which functions in transcription, nor the kinase-inducible domain, in which a cluster of various kinase targets exists, is necessary; however, the Q2 transactivation domain is required for the induction of apoptosis. A more precise study indicates that the four-residue stretch Glu-Glu-Ala-Ala at the most C-terminal region of the Q2 domain is especially important for the induction of apoptosis. Thus overexpressed CREB induces apoptosis by transmitting certain signals from the C-terminal portion of the Q2 domain. Possible roles of cell-cycle-regulated phosphorylation and also an elevation of the intracellular cAMP level in CREB-induced apoptosis are suggested.

Amino Acid Sequence↗